Document Detail

A Toll/IL-1R/resistance domain-containing thioredoxin regulates phagocytosis in Entamoeba histolytica.
Jump to Full Text
MedLine Citation:
PMID:  23043976     Owner:  NLM     Status:  MEDLINE    
Abstract/OtherAbstract:
BACKGROUND: Entamoeba histolytica is a protozoan parasite that infects humans and causes amebiasis affecting developing countries. Phagocytosis of epithelial cells, erythrocytes, leucocytes, and commensal microbiota bacteria is a major pathogenic mechanism used by this parasite. A Toll/IL-1R/Resistance (TIR) domain-containing protein is required in phagocytosis in the social ameba Dictyostelium discoideum, an ameba closely related to Entamoeba histolytica in phylogeny. In insects and vertebrates, TIR domain-containing proteins regulate phagocytic and cell activation. Therefore, we investigated whether E. histolytica expresses TIR domain-containing molecules that may be involved in the phagocytosis of erythrocytes and bacteria.
METHODS: Using in silico analysis we explored in Entamoeba histolytica databases for TIR domain containing sequences. After silencing TIR domain containing sequences in trophozoites by siRNA we evaluated phagocytosis of erythrocytes and bacteria.
RESULTS: We identified an E. histolytica thioredoxin containing a TIR-like domain. The secondary and tertiary structure of this sequence exhibited structural similarity to TIR domain family. Thioredoxin transcripts silenced in E. histolytica trophozoites decreased erythrocytes and E. coli phagocytosis.
CONCLUSION: TIR domain-containing thioredoxin of E. histolytica could be an important element in erythrocytes and bacteria phagocytosis.
Authors:
Ismael Mancilla-Herrera; Alfonso Méndez-Tenorio; Isabel Wong-Baeza; Alexis P Jiménez-Uribe; Marcela Alcántara-Hernández; Ramon Ocadiz-Ruiz; Mario A Moreno-Eutimio; Lourdes A Arriaga-Pizano; Constantino López-Macías; Jorge González-y-Merchand; Armando Isibasi
Related Documents :
23573936 - Midget connects cop1-dependent development with endoreduplication in arabidopsis thaliana.
3512706 - Isolation and partial characterization of an eosinophil chemotactic factor from metaces...
1631116 - Purification and identification of bovine liver gamma-carboxylase.
7927776 - Fusions of anthrax toxin lethal factor with shiga toxin and diphtheria toxin enzymatic ...
25019686 - Engineering light-inducible nuclear localization signals for precise spatiotemporal con...
23573936 - Midget connects cop1-dependent development with endoreduplication in arabidopsis thaliana.
Publication Detail:
Type:  Journal Article; Research Support, Non-U.S. Gov't     Date:  2012-10-08
Journal Detail:
Title:  Parasites & vectors     Volume:  5     ISSN:  1756-3305     ISO Abbreviation:  Parasit Vectors     Publication Date:  2012  
Date Detail:
Created Date:  2012-10-29     Completed Date:  2013-03-04     Revised Date:  2013-07-11    
Medline Journal Info:
Nlm Unique ID:  101462774     Medline TA:  Parasit Vectors     Country:  England    
Other Details:
Languages:  eng     Pagination:  224     Citation Subset:  IM    
Affiliation:
Medical Research Unit on Immunochemistry, Specialties Hospital, National Medical Centre Siglo XXI, Mexican Social Security Institute, Mexico City, Mexico.
Export Citation:
APA/MLA Format     Download EndNote     Download BibTex
MeSH Terms
Descriptor/Qualifier:
Adaptor Proteins, Vesicular Transport / chemistry,  genetics,  metabolism*
Computational Biology
Entamoeba histolytica / genetics,  physiology*
Erythrocytes
Escherichia coli
Gene Silencing
Phagocytosis*
Protein Conformation
Thioredoxins / chemistry,  genetics,  metabolism*
Chemical
Reg. No./Substance:
0/Adaptor Proteins, Vesicular Transport; 52500-60-4/Thioredoxins
Comments/Corrections

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine

Full Text
Journal Information
Journal ID (nlm-ta): Parasit Vectors
Journal ID (iso-abbrev): Parasit Vectors
ISSN: 1756-3305
Publisher: BioMed Central
Article Information
Download PDF
Copyright ©2012 Mancilla-Herrera et al.; licensee BioMed Central Ltd.
open-access:
Received Day: 22 Month: 2 Year: 2012
Accepted Day: 22 Month: 9 Year: 2012
collection publication date: Year: 2012
Electronic publication date: Day: 8 Month: 10 Year: 2012
Volume: 5First Page: 224 Last Page: 224
PubMed Id: 23043976
ID: 3481431
Publisher Id: 1756-3305-5-224
DOI: 10.1186/1756-3305-5-224

A Toll/IL-1R/resistance domain-containing thioredoxin regulates phagocytosis in Entamoeba histolytica
Ismael Mancilla-Herrera12 Email: mahi_25803@yahoo.com.mx
Alfonso Méndez-Tenorio3 Email: amendezt@ipn.mx
Isabel Wong-Baeza14 Email: isa_wb@yahoo.com.mx
Alexis P Jiménez-Uribe1 Email: athumbix@hotmail.com
Marcela Alcántara-Hernández14 Email: marciza_ac@hotmail.com
Ramon Ocadiz-Ruiz6 Email: xmemesisx@hotmail.com
Mario A Moreno-Eutimio15 Email: marioadan@inmunoquimica.com
Lourdes A Arriaga-Pizano1 Email: lanapi@hotmail.com
Constantino López-Macías1 Email: constantino@sminmunologia.org
Jorge González-y-Merchand7 Email: jgonzal1212@yahoo.com.mx
Armando Isibasi1 Email: isibasi@prodigy.net.mx
1Medical Research Unit on Immunochemistry, Specialties Hospital. National Medical Centre “Siglo XXI”. Mexican Social Security Institute (IMSS), Mexico City, Mexico
2Graduate Program on Biomedicine and Biotechnology, ENCB-IPN, Mexico City, Mexico
3Genomic Biotechnology and Bioinformatics Laboratory, Biochemistry Department, National School of Biological Sciences, National Polytechnic Institute (ENCB-IPN), Mexico City, Mexico
4Graduate Program on Immunology, ENCB-IPN, Mexico City, Mexico
5Mexico’s Juarez Hospital, SSA, Mexico City, Mexico
6Departamento de Infectómica y Patogénesis Molecular. Departamento de Patología Experimental, Centro de Investigación y de Estudios Avanzados del IPN, México City, México
7Molecular Microbiology Laboratory, Microbiology Department, ENCB-IPN, Mexico City, Mexico

Background

Entamoeba histolytica is the etiological agent of amebiasis. It is estimated that this protozoan parasite infects 500 million people worldwide (its prevalence is around 1% in industrialized countries and reaches 50–80% in tropical countries, causing 40,000–110,000 deaths per year) [1-3]. Phagocytosis of epithelial cells, erythrocytes, leucocytes and bacteria from the commensal microbiota is a major pathogenic mechanism used by E. histolytica. Phagocytosis requires recognition of ligands on target cells and activation of signaling pathways that lead to cytoskeletal reorganization and vesicle trafficking. In E. histolytica, the recognition of target cells is mediated by a galactose/N-acetylgalactosamine-binding lectin [4-6] and by a phagosome-associated transmembrane kinase (PATMK) that binds phosphatidylserine in host cells [7]. This is a mechanism that involves the recruitment of thiol-specific antioxidants (such as thioredoxins) for phagosome biogenesis and cytoskeletal rearrangement [8-10]. Included in thioredoxin functions are cell protection from oxidants, regulation of transcription factors and protein binding, and catalysis of protein folding [11,12].

Phagocytosis is essential for the survival of unicellular organisms. In the social ameba Dictyostelium discoideum, a Toll/IL-1R/resistance (TIR) domain-containing protein (TirA) is required for the phagocytosis of bacteria, which is essential for nutrition and for protection against infection [13]. Moreover, phagocytic cells play a central role in the innate immune systems of multicellular organisms, and TIR domain-containing proteins regulate the activation of these cells in insects and vertebrates. The TIR domain encompasses three highly conserved regions; i.e., Box1, Box2, and Box3 [14].

The TIR domain is present in a wide variety of eukaryotic organisms, from free-living amebas (which are closely related to E. histolytica in phylogeny) to insects and vertebrates. It has been suggested that in E. histolytica, the phagocytosis of natural substrates (such as human erythrocytes and E. coli) is mediated by TIR domain-containing proteins that participate in a signaling component that existed before the diversification of eukaryotes [15]. Therefore, in the present study, we investigated whether E. histolytica expresses TIR domain-containing molecules that participate in the regulation of the phagocytosis of human erythrocytes and E. coli. Using an in silico analysis of the E. histolytica proteome, we identified a TIR domain-containing sequence that corresponds to a thioredoxin. Furthermore, the downregulation of this thioredoxin by siRNA led to decrease of phagocytosis of erythrocytes and E. coli by E. histolytica trophozoites. These results suggest that the TIR domain-containing thioredoxin is involved in E. histolytica phagocytosis.


Methods
In silico analysis of the E. histolytica TIR domain-containing sequences

A Hidden Markov Model (HMM) for TIR domain proteins was built with HMMER software v2.3.2 ( http://hmmer.janelia.org) and a seed alignment collection of TIR proteins from PFAM database. (Pfam:PF01582, http://www.sanger.ac.uk/Software/Pfam) [16]. Through the HMM, a sequence analysis was implemented to search proteins that contain a probable TIR domain in Protein (NCBI), the Wellcome Trust Sanger Institute ( http://www.sanger.ac.uk), and the Pathema Bioinformatics Resource Center ( http://pathema.jcvi.org) databases for Entamoeba genus. Using BLAST (Basic Local Alignment Search Tool, http://blast.ncbi.nlm.nih.gov/Blast.cgi) on E. histolytica proteins of NCBI databases, sequences of primary structure scoring E values < 0.001 with TIR domain-containing proteins of Entamoeba species were selected as homologous proteins.

The primary and secondary structures of the TIR domain-containing proteins of Entamoeba histolytica identified were compared with the primary structures of the TIR domains of Arabidopsis thaliana (TAO1, GenPept: ABS82021), Drosophila melanogaster (Toll4, GenPept: AAF52747), and Homo sapiens (IL-1R, TLR2, and MyD88, GenPept: AAB84059, AAH33756 and AAC50954 respectively) by a multiple sequence alignment calculated with T-Coffee ( http://tcoffee.crg.cat/). Secondary structures were calculated with the Psipred Protein Structure Prediction Server ( http://bioinf.cs.ucl.ac.uk/psipred/). The tertiary structure of the TIR domain of the identified protein was modeled using I-TASSER server ( http://zhanglab.ccmb.med.umich.edu/I-TASSER/[17,18]) and compared with the tertiary structure of the TIR domain of human interleukin-1 receptor (PDB: 1T3GA). The best structural alignment was calculated by Chimera ( http://www.cgl.ucsf.edu/chimera/). The obtained structures were displayed in pdb format using RasMol v. 2.6.

Culture of E. histolytica trophozoites

Trophozoites of the E. histolytica strain HM-1:IMSS were axenically grown in TYI-S-33 medium, according to Diamond et al. [19]. Trophozoites were grown at 37°C for 40–72 h and harvested by chilling on ice water for 10 min, to detach them from the culture tubes. Trophozoites were washed twice in phosphate-buffered saline solution using low-speed centrifugation (600 × g for 5 min) and suspended in TYI-S-33 medium to a final concentration of 106 cells/mL.

Reverse transcriptase (RT)-PCR assays

Total RNA was extracted from E. histolytica trophozoites using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). RNA was treated with DNase (Qiagen, Germantown, MD, USA) and reverse-transcribed using SuperScript II RNase H-Reverse Transcriptase (Promega, WI, USA). Primers for thioredoxin and PATMK (which was used as an expression control) were designed using Primer3 v.0.4.0 ( http://frodo.wi.mit.edu/primer3[20]) and actin primers were selected according to background [21]. The final reaction mixture contained 10 nM of each dNTP (Promega), 10 × Mg-free reaction buffer (Promega), 25 mM MgCl2 (Promega), 0.25 μl of dimethyl sulfoxide (Sigma, St. Louis, MO, USA), 2.5 U of Taq DNA polymerase (Promega), 0.5 μM of each primer (Thioredoxin: sense 5′–GGAGGTAATGGCTGAAATGC–3′, antisense 5′–GGAGGTAATGGCTGAAATGC–3′; PATMK: sense 5′–AATGGGTGTGCTGTTTGTCA–3′, antisense 5′–CCCTTCAGCACATCTGTCAC–3′; actin: sense 5-AGCTGTTCTTTCATTATATGC-3, antisense 5-TTCTCTTTCAGCAGTAGTGGT-3, and 100–1,000 ng of cDNA, in a final volume of 25 μL. The reaction mixture was denatured at 94°C for 5 min, followed by 35 cycles of denaturation (94°C for 60 s), annealing (59°C for 90 s), and extension (72°C for 90 s); a final extension of 5 min at 72°C was also performed. PCR products were electrophoresed in 2% agarose gels at 70 V for 60 min and stained with GelRed™ Nucleic Acid Stain (Invitrogen). The density band was documented by a EC3 Bioimaging System (UVP, CA,USA), using ultraviolet illumination. Densitometric analysis was made using VisionWorksLS program v6.4.3 (UVP, CA, USA).

Silencing of gene expression

Expression of thioredoxin and PATMK were silenced using small interfering double stranded-RNAs ( Additional file 1: Table S1), which were designed using the SciTools for RNAi Design from Integrated DNA Technologies ( http://www.idtdna.com/Scitools/Applications/RNAi/RNAi.aspx). For each gene, three double-stranded oligonucleotides of 21–23 bp that bound to the initial, mid, and terminal regions of the corresponding transcripts were used. Each oligonucleotide (50, 100 and 250 μg) were added to 106 trophozoites in a final volume of 1.0 mL of TYI-S-33 medium, and the trophozoites were cultured for 15 h at 37°C (“soaking strategy” [22]). The silencing efficiency was evaluated using the RT–PCR approach described above.

Erythrophagocytosis assay

All experimental procedures were approved by the Local Ethical Committee of Health Research of Specialties Hospital, Mexican Social Security Institute (IMSS), Mexico City, Mexico (Register number. R-2009-3601-157). Venous blood (2 mL) from healthy donors was layered over Lymphoprep™ (Axis-Shield, Oslo, Norway) and centrifuged at 800 × g for 20 min, to remove mononuclear cells. Erythrocytes were washed and suspended in phosphate-buffered saline solution. Erythrocytes (1 × 107) were incubated with 1 × 106 trophozoites (untreated or in the presence of thioredoxin or PATMK silencing) in 1 mL of TYI-S-33 medium at 37°C for 30 min, with agitation at 150 rpm. One milliliter of phosphate-buffered saline solution was added after the incubation, and the culture plate was centrifuged at 600 × g for 5 min. The pellet was lysed in 1 mL of cold concentrated formic acid (Sigma-Aldrich), and absorbance at 400 nm was measured using a spectrophotometer (Beckman Coulter, DU® Series 700 UV/Vis Scanning Spectrophotometer). Results were analyzed using Repeated-measures one-way ANOVA and Bonferroni test. Significance was set at P < 0.05.

Bacteria phagocytosis assay

The Escherichia coli strain DH-5α was transformed with a plasmid encoding GFP and an ampicillin resistance gene and grown overnight at 37°C in LB medium with 100 mg/mL of ampicillin. Bacteria were harvested by centrifugation at 9,000 × g for 10 min, washed three times with phosphate-buffered saline solution, and suspended in phosphate-buffered saline solution to a concentration of 1 × 108 colony forming unit (CFU) per mL. Incubation of 1 × 108 CFU with 1 × 106 trophozoites (untreated or in the presence of thioredoxin or PATMK silencing) was performed in 1 mL of TYI-S-33 medium at 37°C for 45 min, with agitation at 150 rpm. Gentamicin (15 ng) was added after the incubation; 10 min later, the culture plate was centrifuged at 600 × g for 5 min. The pellet was suspended in 1 mL of phosphate-buffered saline solution, and the fluorescence of each sample was measured using a flow cytometer (FACS Aria, Becton Dickinson, NJ, USA). At least 10,000 events were acquired per sample. Data were analyzed using BD FACS DiVa software 2.1, and mean fluorescence intensity (MFI) was reported. Results were analyzed using Repeated-measures one-way ANOVA and Bonferroni test. Significance was set at P < 0.05.


Results
In silico identification of a TIR domain-containing thioredoxin in E. histolytica

We generated a HMM from a seed alignment (Pfam:PF01582) of TIR domain and searched proteins containing a TIR domain in Pathema database for Entamoeba genus. Two hypothetical proteins (Pathema:EIN_052840, E value = 0.00039; and Pathema:EIN_134280, E value = 0.00047) and two putative proteins (Pathema:EIN_092020, E value = 0.00047; and Pathema:EIN_191870, elongation factor 1-alpha, E value = 0.0016) were identified. A exploration on Entamoeba histolytica Protein databases for homologues TIR-domain containing proteins of any Entamoeba genus led us to identify a sequence which also contain a thioredoxin domain (GenPept:XP_649779). This whole sequence will be termed “thioredoxin” henceforth.

The putative TIR domain spanned positions 344–442, and its primary structure had low similitude with representative TIR domains from different proteins from different species, including human TLR2, IL1-R, and MyD88, D. melanogaster Toll4, and A. thaliana TAO1 (Figure 1). Even the Box1 and Box2, have structural coincidences, the Box3 exhibited differences in primary (absence of tyrosine residues) and secondary structure (presence of sheets, yellow colored, rather than helixes, red colored).

To demonstrate that the region spanning positions 344 to 442 of this E. histolytica thioredoxin is a member of the TIR family, the 3D protein structure was modeled using a threading strategy on the I-Tasser server (Figure 2, right model). The specific one-on-one 3D structure alignment of the thioredoxin protein sequence with the human Inteleukin-1 Receptor (IL-1R) (Figure 2, left model) and TLR2 (data not shown) TIR domain sequences were determined. These alignments have a root-mean-square distance (RMSD) value of 2.83 and 6.1 Å, respectively, which corresponds to the similarity degree of the tridimensional structure of these proteins and suggests that this region is part of the TIR domain family. Accordingly, the 3D model of the TIR protein from E. histolytica was remarkably similar to the TIR domain (Figure 2, superimposition).

Silencing of TIR domain-containing thioredoxin decrease the phagocytosis of human erythrocytes and E. coli by E. histolytica trophozoites

To show the presence of the region of the mRNA corresponding to TIR domain on thioredoxin transcript, we designed a set of primers which amplified the 344 to 442 region corresponding to thioredoxin protein sequence. We found that E. histolytica trophozoites expressed the TIR domain-containing thioredoxin mRNA, as assessed using RT–PCR (Figure 3a).

To elucidate the possible participation of TIR domain-containing thioredoxin in phagocytosis process of erythrocytes and bacteria, we silenced the expression of thioredoxin putative mRNA in E. histolytica trophozoites using small interfering double stranded-RNAs (siRNA) ( Additional file 1: Table S1) and evaluated the silencing efficiency using RT–PCR. As a positive control of silencing, we also dowregulated the expression of the mRNA of PATMK protein, which has been involve in the initialization of erythrocytes phagocytosis in E. histolytica trophozoites, according to Boettner et al. study. This protein is a good candidate to repressed the phagocytosis process, due the inhibited by three pathways including monoclonal antibodies, mRNA knock-down using shRNA and PATMK gene mutation the reduction on erythrophagocytosis is clear [23].

We observed that 15 hours after the exposition to 250 μg of siRNA, the expression of the PATMK mRNA was reduced until ~40%, and the thioredoxin mRNA was reduced by ~60% (Figure 3a and 3b). According to literature, the downregulation of PATMK gene expression decreases the capability to phagocyte erythrocytes in trophozoites [23]. In other hand, trophozoites with reduced expression of thioredoxin also exhibited less ability to ingest erythrocytes in a concentration-dependent fashion (Figure 3c). In the same way, downregulation of thioredoxin transcripts, also decreases the capability of trophozoites to engulf E. coli-GFP compared with untreated trophozoites (Figure 3d).

Previously, Boettner et al. [23], demonstrated that PATMK silencing decrease the erythrocytes phagocytosis, and in this report we show that PATMK is also required for the bacteria phagocytosis (Figure 3d). All these results suggest that the TIR domain-containing thioredoxin, similar to PATMK, could be associated to a phagocytosis process on E. histolytica trophozoites.


Discussion

The TIR domain consists of approximately 200 amino acids that form five β sheets surrounded by five α helixes [14]. In animals and plants, as well as in free-living amebae, the TIR domain participates in diverse biological activities such as pathogen resistance, immune recognition and feeding [13,24-27]. In this study, we identified a thioredoxin in the E. histolytica proteome which contains a putative TIR domain in a thioredoxin protein. Primary structure of this TIR domain differ from other TIR domains found in plants and animals, but secondary structures show more similar regions, mainly in Box1 and Box2 that are essential regions to fold the protein, and both are conformed by two helixes [14]. On the other hand, the specific one-on-one 3D structure alignment showed that the thioredoxin has structural analogues of TIR domains in mammalian protein IL-1R and TLR2. This supports the idea that three-dimensional structure is much more closely associated with function than its lineal sequence, tertiary structure is more evolutionarily conserved than primary structure ( http://www.ncbi.nlm.nih.gov/books/NBK22362). Both TIR domains, of mammalian IL-1R and TLR2, mediate homotypic protein–protein interactions in the signal transduction that facilitate the activation and expression of mechanisms which increase several biological process, including phagocytic activity [14,28,29].

The participation of this domain on phagocytosis during infection resistance and feeding observed in the evolutionary related ameba Dictyostelium discoideum[13,15,30], led us to think that the thioredoxin found, may participate in the phagocytosis of natural sources of nutrients through human commensal bacteria (such as Escherichia coli) and erythrocytes to uptake iron [23]. In E. histolytica, phagocytosis process is Gal/GalNAc lectin and PATMK dependent [31].

In this report, we observed reduction in phagocytosis of human erythrocytes and E. coli after incubation with small interfering double stranded-RNAs for thioredoxin, suggesting a role for the TIR domain-containing thioredoxin in trophozoites phagocytosis. These results could support the proteomic approach explored by McCoy et al., and Okada et al.[32,33], which suggest that the phagocytosis process Gal/GalNAc lectin-mediated involves the recruitment of thiol-specific antioxidants (such as thioredoxin) for phagosome biogenesis and cytoskeletal rearrangement [8-10]. If this is right, PATMK and Gal/GalNAc lectin, both of which are involved in the interaction with the membrane of erythrocytes, could be involved in the formation of microdomains necessaries to signaling in phagocytosis, in which molecules like thioredoxin could participate. However this must be investigated further.

The above mentioned, is similar to reported to the majority of these TIR domain-containing proteins that have been described in plants, insects, and vertebrates and participate in phagocytic and cell activation [13,25]. However, despite finding similarities among the reduction of phagocytosis when the expression of these transcripts is reduced, according to other reports, we cannot reject the possibility that the thioredoxin identified here participates in the phagocytic process via a mechanism that is not related to its TIR domain, for example the redox state thioredoxin-dependent processes which regulate cellular functions, such as endocytosis and cell adhesion [34-36].

A diverse number of specific functions and cofactor activities have been described for thioredoxins. These functions include growth factor activity, cell protection from toxic compounds (especially oxidants and electrophiles), activation of inflammatory pathways, regulation of transcription factors and protein binding, and catalysis of protein folding; each of these activities has an effect on cellular responses to toxic insults [11,12]. However, no other thioredoxin is involved in the regulation of phagocytic processes. E. histolytica expresses other proteins with thioredoxin activity that participate in nicotinamide adenine dinucleotide phosphate (NADPH)-dependent hydrogen peroxide reduction [35]; these detoxifying thioredoxins do not share the TIR domain identified here.

In this report we present evidence that protein sequence corresponding to 344–442 position in E. histolytica thioredoxin (GenPept:XP_649779) has a TIR-domain. Considering that several members of TIR domain family have been involved in signal transduction in many organisms, and silencing its expression decrease erythrocytes and bacteria phagocytosis, the thioredoxin could play a central role in signal transduction during this event, hence influencing the E. histolytica survival mechanisms.


Conclusion

Uptake of nutrients in Entamoeba histolytica by phagocytosis involves recruitment of proteins such as PATMK, and our results suggest that TIR domain-containing thioredoxin also can support this activity on bacterial and erythrocytes phagocytosis.


Competing interests

The authors have declared that no competing interests exist.


Authors’ contributions

IMH, AMT, AJU, IWB, and CLM conceived the study, and all authors participated in the study design, coordination and writing the manuscript. All authors read and approved the final manuscript.


Supplementary Material Additional file 1

Table S1. Double-stranded oligonucleotides used for the silencing of the expression of thioredoxin and PATMK in E. histolytica trophozoites.



Acknowledgements

This work was supported by Mexican Social Security Institute (IMSS) health research founding (FIS/IMSS/PROT/MD09/732). Mancilla-Herrera received a scholarship by CONACyT (216244). Authors thanks to Ph. D Mario Rodriguez (Departamento de Infectómica y Patogénesis Molecular. Centro de Investigación y de Estudios Avanzados del IPN. A.P. 14–740 México, DF 07360, México) for technical advices, and Hisaki E. for the graphical design.


References
Araujo J,Garcia ME,Diaz-Suarez O,Urdaneta H,[Amebiasis: importance of the diagnosis and treatment. Minireview]Invest ClinYear: 20084926527118717272
Blanc DS,Determination of taxonomic status of pathogenic and nonpathogenic Entamoeba histolytica zymodemes using isoenzyme analysisJProtozoolYear: 1992394714791403982
Bruckner DA,AmebiasisClinMicrobiolRevYear: 19925356369
Petri WA Jr,Schnaar RL,Purification and characterization of galactose- and N-acetylgalactosamine-specific adhesin lectin of Entamoeba histolyticaMethods EnzymolYear: 1995253981047476421
Petri WA Jr,Haque R,Mann BJ,The bittersweet interface of parasite and host: lectin-carbohydrate interactions during human invasion by the parasite Entamoeba histolyticaAnnuRev MicrobiolYear: 200256396410.1146/annurev.micro.56.012302.160959
Haque R,Huston CD,Hughes M,Houpt E,Petri WA Jr,AmebiasisNEnglJ MedYear: 20033481565157310.1056/NEJMra022710
Boettner DR,Huston CD,Sullivan JA,Petri WA Jr,Entamoeba histolytica and Entamoeba dispar utilize externalized phosphatidylserine for recognition and phagocytosis of erythrocytesInfect ImmunYear: 2005733422343010.1128/IAI.73.6.3422-3430.200515908370
Tannich E,Horstmann RD,Knobloch J,Arnold HH,Genomic DNA differences between pathogenic and nonpathogenic Entamoeba histolyticaProc Natl Acad Sci U S AYear: 1989865118512210.1073/pnas.86.13.51182544890
Poole LB,Chae HZ,Flores BM,Reed SL,Rhee SG,Torian BE,Peroxidase activity of a TSA-like antioxidant protein from a pathogenic amoebaFree Radic Biol MedYear: 19972395595910.1016/S0891-5849(97)00066-X9378375
Bruchhaus I,Richter S,Tannich E,Removal of hydrogen peroxide by the 29 kDa protein of Entamoeba histolyticaBiochem JYear: 1997326Pt 37857899307028
Jin C,Flavell RA,Inflammasome activation. The missing link: how the inflammasome senses oxidative stress. Immunol Cell BiolYear: 20108851051210.1038/icb.2010.5620458338
Watson WH,Yang X,Choi YE,Jones DP,Kehrer JP,Thioredoxin and its role in toxicologyToxicolSciYear: 200478314
Chen G,Zhuchenko O,Kuspa A,Immune-like Phagocyte activity in the Social AmoebaScienceYear: 200731767868110.1126/science.114399117673666
Xu Y,Tao X,Shen B,Horng T,Medzhitov R,Manley JL,Tong L,Structural basis for signal transduction by the Toll/interleukin-1 receptor domainsNatureYear: 200040811111510.1038/3504060011081518
Song J,Xu Q,Olsen R,Loomis WF,Shaulsky G,Kuspa A,Sucgang R,Comparing the Dictyostelium and Entamoeba genomes reveals an ancient split in the Conosa lineagePLoSComputBiolYear: 20051e71
Finn RD,Tate J,Mistry J,Coggill PC,Sammut SJ,Hotz HR,Ceric G,Forslund K,Eddy SR,Sonnhammer EL,Bateman A,The Pfam protein families databaseNucleic Acids ResYear: 200836D281D28810.1093/nar/gkn22618039703
Roy A,Kucukural A,Zhang Y,I-TASSER: a unified platform for automated protein structure and function predictionNat ProtocYear: 2010572573810.1038/nprot.2010.520360767
Zhang Y,Template-based modeling and free modeling by I-TASSER in CASP7ProteinsYear: 200769Suppl 810811717894355
Diamond LS,Harlow DR,Cunnick CC,A new medium for the axenic cultivation of Entamoeba histolytica and other EntamoebaTransRSocTropMedHygYear: 197872431432
Rozen S,Skaletsky H,Primer3 on the WWW for general users and for biologist programmersMethods MolBiolYear: 2000132365386
Banuelos C,Garcia-Rivera G,Lopez-Reyes I,Orozco E,Functional characterization of EhADH112: an Entamoeba histolytica Bro1 domain-containing proteinExp ParasitolYear: 200511029229710.1016/j.exppara.2005.03.00515955327
Vayssie L,Vargas M,Weber C,Guillen N,Double-stranded RNA mediates homology-dependent gene silencing of gamma-tubulin in the human parasite Entamoeba histolyticaMolBiochemParasitolYear: 20041382128
Boettner DR,Huston CD,Linford AS,Buss SN,Houpt E,Sherman NE,Petri WA Jr,Entamoeba histolytica phagocytosis of human erythrocytes involves PATMK, a member of the transmembrane kinase familyPLoSPathogYear: 20084e8
Akira S,Takeda K,Toll-like receptor signalling. NatRevImmunolYear: 20044499511
Burch-Smith TM,Dinesh-Kumar SP,The functions of plant TIR domainsSci SignalYear: 20072007e46
Nurnberger T,Brunner F,Kemmerling B,Piater L,Innate immunity in plants and animals: striking similarities and obvious differencesImmunol RevYear: 200419824926610.1111/j.0105-2896.2004.0119.x15199967
Sillo A,Bloomfield G,Balest A,Balbo A,Pergolizzi B,Peracino B,Skelton J,Ivens A,Bozzaro S,Genome-wide transcriptional changes induced by phagocytosis or growth on bacteria in DictyosteliumBMCGenomicsYear: 20089291
Doyle SE,O’Connell RM,Miranda GA,Vaidya SA,Chow EK,Liu PT,Suzuki S,Suzuki N,Modlin RL,Yeh WC,et al. Toll-like receptors induce a phagocytic gene program through p38J Exp MedYear: 2004199819014699082
Hosmane S,Tegenge MA,Rajbhandari L,Uapinyoying P,Kumar NG,Thakor N,Venkatesan A,Toll/interleukin-1 receptor domain-containing adapter inducing interferon-beta mediates microglial phagocytosis of degenerating axonsJ NeurosciYear: 2012327745775710.1523/JNEUROSCI.0203-12.201222649252
Eichinger L,Noegel AA,Comparative genomics of Dictyostelium discoideum and Entamoeba histolyticaCurrOpinMicrobiolYear: 20058606611
Okada M,Nozaki T,New insights into molecular mechanisms of phagocytosis in Entamoeba histolytica by proteomic analysisArchMed ResYear: 200637244252
McCoy JJ,Mann BJ,Proteomic analysis of Gal/GalNAc lectin-associated proteins in Entamoeba histolyticaExp ParasitolYear: 200511022022510.1016/j.exppara.2005.02.01315955316
Okada M,Huston CD,Mann BJ,Petri WA Jr,Kita K,Nozaki T,Proteomic Analysis of Phagocytosis in the Enteric Protozoan Parasite Entamoeba histolyticaEukaryotic CellYear: 2005482783110.1128/EC.4.4.827-831.200515821141
Arias DG,Carranza PG,Lujan HD,Iglesias AA,Guerrero SA,Immunolocalization and enzymatic functional characterization of the thioredoxin system in Entamoeba histolyticaFree Radic Biol MedYear: 200845323910.1016/j.freeradbiomed.2008.03.00818394433
Arias DG,Gutierrez CE,Iglesias AA,Guerrero SA,Thioredoxin-linked metabolism in Entamoeba histolyticaFree RadicBiolMedYear: 20074214961505
Vicente JB,Ehrenkaufer GM,Saraiva LM,Teixeira M,Singh U,Entamoeba histolytica modulates a complex repertoire of novel genes in response to oxidative and nitrosative stresses: implications for amebic pathogenesisCell MicrobiolYear: 200911516910.1111/j.1462-5822.2008.01236.x18778413

Figures

[Figure ID: F1]
Figure 1 

Sequence alignment of TIR domains from several species. Representative sequences are show from: Homo sapiens (IL-1R, TLR2, and MyD88_[Hs]), Drosophila melanogaster (Toll4_[Dm]), Arabidopsis thaliana (TAO1_[At]) as well as the sequences from Entamoeba invadens (EIN_134280_[Ei]) and Entamoeba histolytica (thioredoxin_[Eh]). Colors correspond to secondary structure derived from 3D structures for representative TIR domains, Psipred predictions for EIN_134280_[Ei] and the 3D modeled structure for Thioredoxin_[Eh]: helixes are colored in red and sheets in yellow. The three highly conserved regions previously described in TIR domains [14] are highlighted as boxes 1 to 3. I-Tasser secondary structure assignments are shown at the bottom (H= helix, S= sheet).



[Figure ID: F2]
Figure 2 

Comparison of structures of IL1R from Homo sapiens and Thioredoxin from E. histolytica . TIR domain of human interleukin-1 receptor (PDB: 1T3GA) is show in left model. Tertiary structure of TIR domain-containing thioredoxin was calculated by I-Tasser and show in right model. Structure superimposition is show in the center. (Calculated by Chimera).



[Figure ID: F3]
Figure 3 

Thioredoxin silencing in E. histolytica reduce the Erythrocytes and E. coli phagocytosis. Entamoeba histolytica trophozoites were preincubated in the presence or absence of 50, 100 or 250 μg of PATMK and thioredoxin siRNA during 15 h. a) representative RT-PCR bands of PAMTK and thioredoxin amplified products of silencing and non-silencing trophozoites. b) Densitometric analysis RT-PCR products normalized to PATMK/Actin or Thioredoxin/Actin density of non-silenced trophozoites. c) Erythrophagocytosis of siRNA PATMK and thioredoxin silenced trophozoites. d) GFP-labeled E. coli phagocytosis of siRNA PATMK or thioredoxin silenced trophozoites (MIF: Median Intensity Fluorescence). Results were analyzed using Repeated-measures one-way ANOVA and Bonferroni test. Significance was set at P < 0.05.



Article Categories:
  • Research

Keywords: Entamoeba histolytica phagocytosis, Toll/IL-1R/resistance domain, Erythrocytes phagocytosis, Bacteria phagocytosis.

Previous Document:  A prospective analysis of the functional and radiological outcomes of minimally invasive plating in ...
Next Document:  Human Umbilical Cord Perivascular Cells Exhibit Enhanced Cardiomyocyte Reprogramming and Cardiac Fun...