Document Detail

A comparison of molecular markers to detect Lutzomyia longipalpis naturally infected with Leishmania (Leishmania) infantum.
Jump to Full Text
MedLine Citation:
PMID:  25004147     Owner:  NLM     Status:  Publisher    
Abstract/OtherAbstract:
The aim of the present study was to detect natural infection by Leishmania (Leishmania) infantum in Lutzomyia longipalpis captured in Barcarena, state of Pará, Brazil, through the use of three primer sets. With this approach, it is unnecessary to previously dissect the sandfly specimens. DNA of 280 Lu. longipalpis female specimens were extracted from the whole insects. PCR primers for kinetoplast minicircle DNA (kDNA), the mini-exon gene and the small subunit ribosomal RNA (SSU-rRNA) gene of Leishmania were used, generating fragments of 400 bp, 780 bp and 603 bp, respectively. Infection by the parasite was found with the kDNA primer in 8.6% of the cases, with the mini-exon gene primer in 7.1% of the cases and with the SSU-rRNA gene primer in 5.3% of the cases. These data show the importance of polymerase chain reaction as a tool for investigating the molecular epidemiology of visceral leishmaniasis by estimating the risk of disease transmission in endemic areas, with the kDNA primer representing the most reliable marker for the parasite.
Authors:
Kárita Cláudia Freitas-Lidani; Iara J de Messias-Reason; Edna Aoba Y Ishikawa
Related Documents :
8056337 - Cloning of the sole (solea senegalensis) growth hormone-encoding cdna.
22634887 - Amplification of the flge gene provides evidence for the existence of a brazilian borre...
12688537 - A novel cdna encodes a putative hraly-like protein, hralyl.
14672407 - Isolation and characterization of a cdna encoding a putative high mobility group (hmg)-...
23266947 - (1)h, (13)c and (15)n resonance assignments of s114a mutant of uvi31+ from chlamydomona...
12135577 - The zygomycetous fungus, benjaminiella poitrasii contains a large family of differentia...
Publication Detail:
Type:  JOURNAL ARTICLE     Date:  2014-7-03
Journal Detail:
Title:  Memorias do Instituto Oswaldo Cruz     Volume:  0     ISSN:  1678-8060     ISO Abbreviation:  Mem. Inst. Oswaldo Cruz     Publication Date:  2014 Jul 
Date Detail:
Created Date:  2014-7-8     Completed Date:  -     Revised Date:  -    
Medline Journal Info:
Nlm Unique ID:  7502619     Medline TA:  Mem Inst Oswaldo Cruz     Country:  -    
Other Details:
Languages:  ENG     Pagination:  0     Citation Subset:  -    
Export Citation:
APA/MLA Format     Download EndNote     Download BibTex
MeSH Terms
Descriptor/Qualifier:

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine

Full Text
Journal Information
Journal ID (nlm-ta): Mem Inst Oswaldo Cruz
Journal ID (iso-abbrev): Mem. Inst. Oswaldo Cruz
ISSN: 0074-0276
ISSN: 1678-8060
Publisher: Instituto Oswaldo Cruz, Ministério da Saúde
Article Information
Download PDF

open-access:
Received Day: 28 Month: 5 Year: 2013
Accepted Day: 2 Month: 6 Year: 2014
Electronic publication date: Day: 03 Month: 7 Year: 2014
Print publication date: Month: 7 Year: 2014
Volume: 109 Issue: 4
First Page: 442 Last Page: 447
PubMed Id: 25004147
ID: 4155845
DOI: 10.1590/0074-0276130285

A comparison of molecular markers to detect Lutzomyia longipalpis naturally infected with Leishmania (Leishmania) infantum
Kárita Cláudia Freitas-Lidani1+
Iara J de Messias-Reason1
Edna Aoba Y Ishikawa2
1Laboratório de Imunopatologia Molecular, Departamento de Patologia Médica, Hospital de Clínicas, Universidade Federal do Paraná, Curitiba, PR, Brasil
2Núcleo de Medicina Tropical, Universidade Federal do Pará, Belém, PA, Brasil
+ Corresponding author: kari.lidani@gmail.com

Leishmaniasis is a group of diseases caused by various species of the protozoan Leishmania and showing a wide range of clinical manifestations. Leishmaniasis represents a serious threat to public health in tropical and subtropical regions of several countries (Alvar et al. 2012) and is considered one of the most important neglected parasitic diseases (WHO 2010). Approximately two million new cases per year are estimated, with 350 million people at risk of contracting the disease.

Visceral leishmaniasis (VL) is a systemic and chronic disease that is fatal in cases that do not receive suitable treatment (Freitas-Junior et al. 2012). Brazil is one of the six countries that together include more than 90% of all recorded VL cases worldwide (Alvar at al. 2012); in this case, the disease is caused by Leishmania (Leishmania) infantum [syn. Leishmania (Leishmania) chagasi] (Kuhls et al. 2011). The sandfly Lutzomyia cruzi can be infected by L. (L.) infantum (Santos et al. 2003, Missawa et al. 2011), but the sandfly Lutzomyia longipalpis is considered the main vector (Lainson & Rangel 2005).

The Brazilian VL control program is based on treating human cases, controlling vectors and reservoirs and euthanising seropositive infected dogs (MS/SVS/DVE 2006). One useful tool for epidemiological studies of leishmaniasis is the determination of the infection rate of parasites in sandflies (Kato et al. 2007).

Several methods have been applied to detect infection in sandflies. Classical methods consist of searching for promastigotes in loco and isolating the parasite after the dissection of the digestive tract of the insect in a culture medium, which requires experience (Fernandes et al. 1994, Perez et al. 2007).

Molecular diagnostic assays, such as the polymerase chain reaction (PCR) assay, have been used for the identification and characterisation of Leishmania in vectors, especially in epidemiological field studies when a large number of samples need to be handled (Rodríguez 1999, Miranda et al. 2002). Different targets derived from nuclear and kinetoplast parasite DNA have been used to detect Leishmania spp in naturally infected phlebotomines. These targets include the rRNA gene, the mini-exon-derived RNA gene, repeated genome sequences, glucose-6-phosphate dehydrogenase and the kinetoplast minicircle DNA (kDNA) minicircle (de Bruijin & Barker 1992, Castilho et al. 2003, Paiva et al. 2006).

Because several markers are available to detect different genic regions of Leishmania, it is important to determine and compare their efficiency in identifying the parasite in epidemiological surveys. The present study aims to detect natural infections by L. (L.) infantum in Lu. longipalpis captured in Barcarena, state of Pará (PA), Brazil, and to compare the PCR amplification rate of three markers: kDNA, the mini-exon gene and the 18S small subunit ribosomal RNA (SSU-rRNA) gene, with no previous dissection of the phlebotomine.


MATERIALS AND METHODS

Study area - The investigation was performed in northern Brazil in Santana do Cafezal (0º3’38.38”S 47º39’3.36”W), 7 km from the municipality of Barcarena (Fig. 1). According to the Köppen climate classification categories, Barcarena has a warm humid equatorial climate corresponding to the Amazon type of climate. The average annual temperature is approximately 27ºC. Abundant rainfall (> 2,500 mm/year) occurs more intensely in the first six months of the year (SEPOF-PA 2009). Approximately 80% of the population of Santana do Cafezal lives in wooden houses, with the remainder living in brick houses, next to vegetation and with domestic animal shelters nearby. The town has electricity, but has no basic sanitation and untreated water is commonly consumed.

Sandfly collections and species identification - Sandflies were captured between November 2003-February 2004, using CDC light traps placed overnight in peridomicile areas. The selection of the houses was based on previous entomological data as well as on the prevalence and incidence of human and canine cases of VL. The taxonomic identification of each specimen was determined according to Young and Duran (1994). In all, 280 female Lu. longipalpis were selected for molecular analysis.

DNA extraction - Total genomic DNA was extracted from sandflies following the Ready et al. (1997) method. Sandflies were macerated individually with a sterile tip in 1.5 mL tubes containing 100 µL of grinding solution [0.1 M Tris-HCl pH 7.5, 0.6 M NaCl, 0.1 M ethylenediamine tetraacetic acid (EDTA), 20 x spermine/spermidine mL, 10% sucrose], 10 µL of lysis buffer (10% sodium dodecyl sulfate, 10% sucrose, 17 µL diethylpyrocarbonate) and 30 µL of 8 M potassium acetate for protein precipitation. The DNA was precipitated with 96% ethanol and resuspended in 20 µL of Tris-EDTA solution (10 mM Tris-HCl pH 8.0, 1 mM EDTA).

PCR assays - As a positive control for DNA extraction and to guarantee that all sandflies were correctly identified as Lu. longipalpis, all sandflies were amplified by PCR using the primers Lu1 (5’-TGAGCTTGACTCTAGTTTGGCAC-3’) and Lu2 (5’-AGATGTACCGCCCCAGTCAAA-3’) that amplify a specific fragment for the 28S rRNA gene of Lu. longipalpis. The PCR, performed according to Cabrera et al. (2002), amplified a fragment of approximately 370 bp. For the identification of L. (L.) infantum, all positive samples were amplified with different primer pairs: D1/D2 for kDNA, S1629/S1630 for the mini-exon gene and R221/R332 for 18S SSU-rRNA gene. These primer pairs amplify fragments of 780 bp, 400 bp and 603 bp, respectively. PCR assays were performed as shown in Table I.

Sensitivity of PCR for different molecular targets - To analyse the amplification capacity of the three targets (kDNA, SSU-rRNA and mini-exon), serial dilutions (1 fg to 100 ng) of L. (L.) infantum DNA (MCER/BR/1996/M15677), extracted from culture, were tested singly and in the presence of sandfly DNA [the same serial dilutions of L. (L.) infantum DNA were added to each uninfected Lu. longipalpis DNA preparation (30 ng/µL) in triplicate assays]. The specificity test was performed to check the possibility of nonspecific fragments and consisted of amplifying Leishmania (Viannia) braziliensis and Leishmania (Leishmania) amazonensis DNA with the same PCR conditions used to amplify L. (L.) infantum DNA in Lu. longipalpis with kDNA, SSU-rRNA and mini-exon primers.

The PCR products were separated by horizontal electrophoresis on 1% agarose gel containing ethidium bromide (0.5 µg/mL) for 1 h at 100 V. The amplification products were visualised under ultraviolet light.


RESULTS

In the initial step, the effectiveness of genomic DNA extraction of sandflies was confirmed by the presence of a 370 bp band (fragment of 28S rRNA of Lu. longipalpis) in all infected and non-infected sandfly samples (Fig. 2). The specificity test using primers D1/D2, S1629/S1630 and R221/R332 for different Leishmania strains [L. (V.) braziliensis, L. (L.) amazonensis and L. (L.) infantum] showed that all primer pairs are highly specific.

The sensitivity assay using serial dilutions of L. (L.) infantum DNA derived from culture showed an amplification of up to 10 pg for kDNA, 100 pg for the mini-exon and 10 ng for SSU-rRNA (Fig. 3). However, if L. (L.) infantum DNA derived from culture was mixed with sandfly genomic DNA (1:1), a significant decrease was observed in the sensitivity of two pairs of primers: the primer D1/D2 was able to detect 1 ng of DNA, and R221/R332 was only able to detect up to 52.6 ng. The mini-exon primer showed no change in the ability to detect L. (L.) infantum, amplifying up to 100 pg even in the presence of Lu. longipalpis DNA (Fig. 4).

The PCR results for the Lu. longipalpis samples from Santana do Cafezal showed an infection rate of 8.6% using the D1/D2 primer, with the DNA from 24 of 280 female sandflies amplifying a fragment of 780 bp. In contrast, the DNA from 20 sandflies amplified a fragment of 400 bp with the S1629/S1630 primer and the DNA from only 15 sandflies amplified a fragment of 603 bp with the R221/R332 primer, resulting in infection rates of 7.1% and 5.3%, respectively (Fig. 5, Table II). When the PCR tests were combined, the following results were observed: 15/280 (5.4%) infected sandflies were detected using the three markers, 20/280 (7.1%) were detected using the 400 bp and 780 bp fragments, 15/280 (5.4%) were detected using the 400 bp and 603 bp fragments and 15/280 (5.4%) were detected using the 603 bp and 780 bp fragments.


DISCUSSION

In this study, we evaluated the applicability of three PCR markers to the detection of Leishmania within sandflies, with no previous dissection of the phlebotomine. The primers used for the detection of the parasite with PCR for the mini-exon gene (S1629/S1630), the 18S rRNA gene (R221/R332) and kDNA (D1/D2) are well known and have been used in several studies to diagnose Leishmania infection in clinical specimens as well as in the identification of culture isolates, material from animals and infected sandflies (Aransay et al. 2000, Quinnell et al. 2001, Kaouech et al. 2008).

The marker for kDNA clearly showed higher sensitivity when tested on culture samples (10 pg). In contrast, primers R211/R332 and S1629/S1630 were only able to detect up to 100 pg DNA. These results agree with previous studies that showed that the kDNA marker is able to detect as little as 1 fg of DNA (de Bruijin & Barker 1992, Smyth et al. 1992).

Despite its low sensitivity in comparison with kDNA, the primer for the mini-exon gene has the advantage that in a single assay, it is possible to distinguish infection caused by L. (V.) braziliensis, L. (L.) amazonensis and L. (L.) infantum based only on the size of the fragment produced by PCR. The low sensitivity of the mini-exon gene primer is due to the number of DNA copies (Degrave et al. 1994) found inside the parasite.

When we tested the material extracted from sandflies captured in Santana do Cafezal, we observed that the frequency of infection detected in sandflies was 8.6% with the use of the primer D1/D2, a much higher rate than that found from the use of the S1629/S1630 and R221/R332 primers, whose sensitivity was 83.3% and 63%, respectively. This difference may be related to the low number of parasites in each cell and the influence of possible inhibitors on the amplification process. All infections detected by the 400 bp (n = 20) and 603 bp (n = 15) fragments were also identified by the 780 bp fragment, with no false positive samples for these markers.

Paiva et al. (2006) found a rate of 3.9% of natural infection by L. (L.) infantum in the municipality of Antônio João, state of Mato Grosso do Sul, using the primer for the mini-exon gene. In a similar study in the same state, Silva et al. (2008) found an infection rate of 1.9% for VL in Campo Grande. Soares et al. (2010) observed rates of 1.25% for an old colonisation and 0.25% for a recent colonisation on São Luís Island (state of Maranhão) using primers for kDNA. Independent of the primer used, the infection rate observed in the present study, 8.6% for the kDNA gene, was greater than those reported from these previous studies in Brazil. Cimerman and Cimerman (2003) and Missawa et al. (2010) state that the infection ratio of Leishmania is usually low, even in endemic areas, with average values below 3%. According to Cimerman and Cimerman (2003), transmission depends on the presence of high densities of Lu. longipalpis, as observed during outbreaks of the disease.

However, an infection rate of 19% (4/21) has been detected in Belo Horizonte (state of Minas Gerais) (Saraiva et al. 2010) based on the use of PCR for kDNA. The high rate observed might result from three factors: (i) the majority of samples were collected from the peridomicile, where several cases of VL occurred an year before the sampling, (ii) environmental conditions were favourable for the development of vectors, e.g., the high prevalence of canine infection, which is the most important source of infection for phlebotomines, and (iii) the molecular methods are sensitive and specific compared with traditional techniques of parasite visualisation.

de Oliveira et al. (2011) dissected 1,451 Lu. longipalpis females to evaluate the natural infection rate in Barcarena and found no infected flies. In contrast, Saraiva et al. (2010) found that the number of positive results based on the primer for kDNA was 500% greater than the value based on the intestinal dissection and microscopy of sandflies. This finding supports the reliability of kDNA in vectorial studies. Several authors, e.g., Degrave et al. (1994), Rodríguez et al. (1999) and Miranda et al. (2002), have also stated that molecular techniques are more sensitive and have greater specificity than the dissection method. The choice of techniques to investigate infection in sandflies is important because the different techniques can produce differing estimates of the true rates of natural infection.

Although research on individual samples may be more laborious, especially in large quantities, the great advantage over pooled samples is that a more realistic understanding of the frequency of infected sandflies occurring in peridomicile areas can be achieved, especially in areas where new cases are beginning to emerge in dogs and humans. The improved understanding that results from research on individual samples is informative for assessing the risk to the population. If the number of captured sandflies is high, the investigation should undoubtedly use pools of specimens and evaluate the minimum infection rate (MR = nº of positive groups x 100/total number of species).

These data show the importance of PCR as a tool for investigating the molecular epidemiology of VL and estimating the risk of disease transmission in endemic areas, with the primer for kDNA showing greater reliability as a marker for the parasite.


Notes

Financial support: IEC, UFPA, FAPESPA, CNPq, CAPES (032/2010 - National Incentive Program for Basic Research in Parasitology)

ACKNOWLEDGEMENTS

To Dr Adelson Alcimar Almeida de Souza (in memoriam) and to the technicians of the Instituto Evandro Chagas, for assisting our laboratory work.


REFERENCES
Alvar J,Velez ID,Bern C,Herrero M,Desjeux P,Cano J,Jannin J,den Boer M,the WHO Leishmaniasis Control TeamYear: 2012Leishmaniasis worldwide and global estimates of its incidencePLoS ONE7e35671
Aransay AM,Scoulica E,Tselentis Y. Year: 2000Detection and identification of Leishmania within naturally infected sand flies by PCR on minicircle kinetoplastic DNAAppl Environ Microbiol661933193810788363
Cabrera OL,Munsterman LE,Cárdenas R,Gutiérrez R,Ferro C. Year: 2002Definition of appropriate temperature and storage conditions in the detection of Leishmania DNA with PCR in phlebotomine fliesBiomedica2229630212404930
Castilho TM,Shaw JJ,Floeter-Winter LM. Year: 2003New PCR assay using glucose-6-phosphate dehydrogenase for identification of Leishmania speciesJ Clin Microbiol4154054612574243
Cimerman S,Cimerman B. Year: 2003Medicina tropical1stAtheneuSão Paulo690
Bruijin MHL,Barker DC. Year: 1992Diagnosis of New World leishmaniasis: specific detection of species of the Leishmania braziliensis complex by amplification of kinetoplast DNAActa Trop5245581359760
Oliveira DMS,Saraiva EM,Ishikawa EAY,Sousa AAA,Silva EO,Silva IM. Year: 2011Distribution of phlebotomine fauna (Diptera: Psychodidae) across an urban-rural gradient in an area of endemic visceral leishmaniasis in northern BrazilMem Inst Oswaldo Cruz1061039104422241130
Degrave W,Fernandes O,Campbell D,Bozza M,Lopes U. Year: 1994Use of molecular probes and PCR for detection and typing of Leishmania - a mini-reviewMem Inst Oswaldo Cruz894634697476234
Fernandes O,Murthy VK,Kurah U,Degrave W,Campbell DA. Year: 1994Mini-exon gene variation in human pathogenic Leishmania speciesMol Biochem Parasitol662612717808476
Freitas A Junior,Chatelain E,Kim HA,Siqueira JL Neto. Year: 2012Visceral leishmaniasis treatment: what do we have, what do we need and how to deliver it?Int J Parasitol Drugs Drug Resist2111924533267
Kaouech E,Kallel K,Toumi NH,Belhadj S,Anane S,Babba H,Chaker E. Year: 2008Pediatric visceral leishmaniasis diagnosis in Tunisia: comparative study between optimised PCR assays and parasitological methodsParasite1514315018642507
Kato H,Uezato H,Gomez EA,Terayama Y,Calvopiña M,Iwata H,Hashiguchi Y. Year: 2007Establishment of a mass screening method of sand fly vectors for Leishmania infection by molecular biological methodsAm J Trop Med Hyg7732432917690406
Kuhls K,Alam MZ,Cupolillo E,Ferreira GEMF,Mauricio IL,Oddone R,Feliciangeli MD,Wirth T,Miles MA,Schönian G. Year: 2011Comparative microsatellite typing of New World Leishmania infantum reveals low heterogeneity among populations and its recent Old World originPLoS Negl Trop Dis5e1155
Lainson R,Rangel EF. Year: 2005Lutzomyia longipalpis and the eco-epidemiology of American visceral leishmaniasis, with particular reference to Brazil - A ReviewMem Inst Oswaldo Cruz10081182716444411
Miranda JC,Reis E,Schriefer A,Gonçalves M,Reis MG,Carvalho L,Fernades O,Barral-Netto M,Barral A. Year: 2002Frequency of infection of Lutzomyia phlebotomines with Leishmania braziliensis in a Brazilian endemic area as assessed by pinpoint capture and polymerase chain reactionMem Inst Oswaldo Cruz9718518812016439
Missawa NA,Michalsky EM,Fortes-Dias CL,Dias ES. Year: 2010Lutzomyia longipalpis naturally infected by Leishmania (L.) chagasi in Várzea Grande, Mato Grosso state, Brazil, an area of intense transmission of visceral leishmaniasisCad Saude Publica262414241921243236
Missawa NA,Veloso MA,Maciel GB,Michalsky EM,Dias ES. Year: 2011Evidence of transmission of visceral leishmaniasis by Lutzomyia cruzi in the municipality of Jaciara, state of Mato Grosso, BrazilRev Soc Bras Med Trop44767821340413
MS/SVS/DVE - Ministério da Saúde/Secretaria de Vigilância em Saúde/Departamento de Vigilância EpidemiológicaYear: 2006Manual de vigilância e controle da leishmaniose visceralMSBrasília182
Paiva BR,Secundino NFC,Nascimento JC,Pimenta PFP,Galati EAB,Andrade HF Junior,Malafronte RS. Year: 2006Detection and identification of Leishmania species in field-captured phlebotomine sandflies based on mini-exon gene PCRActa Trop9925225917055444
Perez JE,Veland N,Espinosa D,Torres K,Ogusuku E,Llanos-Cuentas A,Gamboa D,Arévalo J. Year: 2007Isolation and molecular identification of Leishmania (Viannia) peruviana from naturally infected Lutzomyia peruensis (Diptera: Psychodidae) in the Peruvian AndesMem Inst Oswaldo Cruz10265565817710315
Quinnell RJ,Courtenay O,Davidson S,Garcez L,Lambson B,Ramos P,Shaw JJ,Shaw M-A,Dye C. Year: 2001Detection of Leishmania infantum by PCR, serology and cellular immune response in a cohort study of Brazilian dogsParasitology12225326111289062
Ready DP,Day JC,Souza AA,Rangel EF,Davies CR. Year: 1997Mitochondrial DNA characterization of populations of Lutzomyia whitmani (Diptera, Psychodidae) incriminated in the peri-domestic and silvatic transmission in the of Leishmania species in Brazil.Bull Entomol Res87187195
Rodríguez N,Aguilar CM,Barrios MA,Barker DC. Year: 1999Detection of Leishmania braziliensis in naturally infected individual sandflies by the polymerase chain reactionTrans R Soc Trop Med Hyg93474910492789
Santos SO,Arias JR,Hoffmann MP,Furlan MBG,Ferreira WF,Pereira C,Ferreira L. Year: 2003The presence of Lutzomyia longipalpis in a focus of American visceral leishmaniasis where the only proven vector is Lutzomyia cruzi, Corumbá, Mato Grosso do Sul stateRev Soc Bras Med Trop3663363414576882
Saraiva L,Andrade JD Filho,Silva SO,Andrade ASR,Melo MN. Year: 2010The molecular detection of different Leishmania species within sand flies from a cutaneous and visceral leishmaniasis sympatric area in southeastern BrazilMem Inst Oswaldo Cruz1051033103921225201
SEPOF-PA - Secretaria de Estado de Planejamento, Orçamento e Finanças/Instituto de Desenvolvimento Econômico, Social e Ambiental do ParáYear: 2009Estatística municipal: Barcarena, 2009iah.iec.pa.gov.br/iah/fulltext/georeferenciamento/barcarena.pdf
Silva EA,Andreotti R,Dias ES,Barros JC,Brazuna JCM. Year: 2008Detection of Leishmania DNA in phlebotomines captured in Campo Grande, Mato Grosso do Sul, BrazilExp Parasitol11934334818456262
Smyth AJ,Gghosh A,Hassan MDQ,Basu D,Bruijn M,Adhya S,Mallik KK,Barker DC. Year: 1992Rapid and sensitive detection of Leishmania kinetoplast DNA from spleen and blood samples of kala-azar patientsParasitology1051831921333582
Soares MRA,Carvalho CC,Silva LA,Lima MSCS,Barral AMP,Rebêlo JMM,Pereira SRF. Year: 2010Análise molecular da infecção natural de Lutzomyia longipalpis em área endêmica de leishmaniose visceral no BrasilCad Saude Publica262409241321243235
Van Eys GJJM,Schoone GJ,Kroon CCM,Ebeling SB. Year: 1992Sequence analysis of small subunit ribosomal RNA genes and its use for detection and identification of Leishmania parasitesMol Biochem Parasitol511331421565128
WHO - World Health OrganizationYear: 2010Control of the leishmaniasis: report of a meeting of the WHO Expert Committee on the Control of Leishmaniaseswhqlibdoc.who.int/trs/WHO_TRS_949_eng.pdf
Young DG,Duran MA. Year: 1994Guide to the identification and geographic distribution of Lutzomyia sand flies in Mexico, the West Indies, Central and South America (Diptera: Psychodidae)Memoirs Am Ent Inst541881

Figures

[Figure ID: f01]
Fig. 1  : map of the state of Pará and the municipality of Barcarena.

[Figure ID: f02]
Fig. 2  : polymerase chain reaction electrophoresis with amplified DNA of Lutzomyia longipalpis using primer for 28S rRNA gene. Lane 1: 50 bp DNA Ladder (Uniscience); 2-5: uninfected Lu. longipalpis; 6-9: infected Lu. longipalpis; 10: negative control.

[Figure ID: f03]
Fig. 3  : polymerase chain reaction electrophoresis to evaluate the primer sensitivity using serial dilutions of Leishmania infantum DNA. A: primer D1/D2 [kinetoplast DNA (kDNA)] [Lane 1: 100 bp DNA Ladder (Kasvi); 2: negative control; 3-10: L. (L.) infantum DNA dilutions, respectively, of 100 ng/µL, 10 ng/µL, 1 ng/µL, 100 pg/µL, 10 pg/µL, 1 pg/µL, 100 fg/µL and 10 fg/µL]; B: primer R221/R332 [small subunit ribosomal RNA (SSU rRNA)] [Lane 1: 100 bp DNA Ladder (Kasvi); 2: negative control; 3-10: L. (L.) infantum DNA dilutions, respectively, of 100 ng/µL, 10 ng/µL, 1 ng/µL, 100 pg/µL, 10 pg/µL, 1 pg/µL, 100 fg/µL and 10 fg/µL]; C: primer S1629/S1630 (mini-exon) [Lane 1: 100 bp DNA Ladder (Invitrogen); 2: negative control; 3-10: L. (L.) infantum DNA dilutions, respectively, of 100 ng/µL, 10 ng/µL, 1 ng/µL, 100 pg/µL, 10 pg/µL, 1 pg/µL, 100 fg/µL, 10 fg/µL and 1 fg/µL].

[Figure ID: f04]
Fig. 4  : polymerase chain reaction electrophoresis to evaluate the primer sensitivity using serial dilutions of Leishmania infantum DNA with Lutzomyia longipalpis DNA. A: primer D1/D2 [kinetoplast DNA (kDNA)] [Lane 1: negative control; 2-9 L. (L.) infantum DNA dilutions, respectively, of 52.6 ng/µL, 10 ng/µL, 1 ng/µL, 100 pg/µL, 10 pg/µL, 1 pg/µL, 100 fg/µL and 10 fg/µL; 10: 100 bp DNA Ladder (Kasvi)]; B: primer R221/R332 [small subunit ribosomal RNA (SSU rRNA)] [Lane 1: 100 bp DNA Ladder (Kasvi); 2-9 L. (L.) infantum DNA dilutions, respectively, of 52.6 ng/µL, 10 ng/µL, 1 ng/µL, 100 pg/µL, 10 pg/µL, 1 pg/µL, 100 fg/µL and 10 fg/µL; 10: negative control]; C: primer S1629/S1630 (mini-exon) [Lane 1: 100 bp øX174/Hae III (Invitrogen); 2-11: L. (L.) infantum DNA dilutions, respectively, of 100 ng/µL, 10 ng/µL, 1 ng/µL, 100 pg/µL, 10 pg/µL, 1 pg/µL, 100 fg/µL, 10 fg/µL and 1 fg/µL; 12: negative control].

[Figure ID: f05]
Fig. 5  : detection of Leishmania (Leishmania) infantum in Lutzomyia longipalpis with kinetoplast DNA (kDNA), mini-exon and small subunit ribosomal RNA (SSU rRNA) targets. A: primer D1/D2 (kDNA) {Lane 1: positive control [L. (L.) infantum DNA from culture]; 2-5: Lu. longipalpis infected; 6-9: Lu. longipalpis non-infected; 10: negative control}; B: primer R221/R332 (SSU rRNA) {Lane 1: positive control [L. (L.) infantum DNA from culture]; 2-5: Lu. longipalpis infected; 6-9: Lu. longipalpis non-infected; 10: negative control}; C: primer S1629/S1630 (mini-exon) {Lane 1: positive control [L. (L.) infantum DNA from culture]; 2-5: Lu. longipalpis infected; 6-9: Lu. longipalpis non-infected; 10: negative control}.

Tables
[TableWrap ID: t01] TABLE I  Genes and primer sequences used for the detection of Leishmania (Leishmania) infantum
Gene Primer sequence (5’-3’) Fragment (bp) Reference
kDNA D1/D2 CCAGTTTCCCGCCCCG GGGGTTGGTGGTGTAAAATAG 780 Smyth et al. (1992)
Mini-exon S1629/S1630 GGAATTCAATAWAGTACAGAAACTG GGGAAGCTTCTGTACTWTATTGGTA 400 Degrave et al. (1994), Fernandes et al. (1994)
SSU-rRNA R221/R332 GGTTCCTTTCCTTGATTTAGC GGCCGGTAAAGGCCGAATAG 603 Van Eyes et al. (1992)

TFN01t01kDNA: kinetoplast DNA; SSU-rRNA: small subunit ribosomal RNA.


[TableWrap ID: t02] TABLE II  Infection natural rate to mini-exon, kinetoplast DNA (kDNA) and small subunit ribosomal RNA (SSU-rRNA) genes
Targets PCR+ PCR- Infection rate (%)
kDNA 24 256 8.6
Mini-exon 20 260 7.1
SSU-rRNA 15 265 5.3


Article Categories:
  • Articles

Keywords: visceral leishmaniasis, Leishmania (Leishmania) infantum, Lutzomyia longipalpis.

Previous Document:  Triatominae species of Suriname (Heteroptera: Reduviidae) and their role as vectors of Chagas diseas...
Next Document:  The mazEF toxin-antitoxin system as a novel antibacterial target in Acinetobacter baumannii.