Document Detail

Ubiquinol decreases monocytic expression and DNA methylation of the pro-inflammatory chemokine ligand 2 gene in humans.
Jump to Full Text
MedLine Citation:
PMID:  23021568     Owner:  NLM     Status:  Publisher    
Abstract/OtherAbstract:
ABSTRACT: BACKGROUND: Coenzyme Q10 is an essential cofactor in the respiratory chain and serves in its reduced form, ubiquinol, as a potent antioxidant. Studies in vitro and in vivo provide evidence that ubiquinol reduces inflammatory processes via gene expression. Here we investigate the putative link between expression and DNA methylation of ubiquinol sensitive genes in monocytes obtained from human volunteers supplemented with 150 mg/ day ubiquinol for 14 days. FINDINGS: Ubiquinol decreases the expression of the pro-inflammatory chemokine (C-X-C motif) ligand 2 gene (CXCL2) more than 10-fold. Bisulfite-/ MALDI-TOF-based analysis of regulatory regions of the CXCL2 gene identified six adjacent CpG islands which showed a 3.4-fold decrease of methylation status after ubiquinol supplementation. This effect seems to be rather gene specific, because ubiquinol reduced the expression of two other pro-inflammatory genes (PMAIP1, MMD) without changing the methylation pattern of the respective gene. CONCLUSION: In conclusion, ubiquinol decreases monocytic expression and DNA methylation of the pro-inflammatory CXCL2 gene in humans. Current Controlled Trials ISRCTN26780329.
Authors:
Alexandra Fischer; Simone Onur; Constance Schmelzer; Frank Döring
Related Documents :
18971308 - Targeted screening of cis-regulatory variation in human haplotypes.
23394478 - Multiple consensus trees: a method to separate divergent genes.
23212948 - A chromatin link to caste identity in the carpenter ant camponotus floridanus.
18462018 - Allele-specific up-regulation of fgfr2 increases susceptibility to breast cancer.
19032498 - Evidence of restoration cost in the annual gynodioecious phacelia dubia.
12032298 - A core-braf35 complex containing histone deacetylase mediates repression of neuronal-sp...
Publication Detail:
Type:  JOURNAL ARTICLE     Date:  2012-10-1
Journal Detail:
Title:  BMC research notes     Volume:  5     ISSN:  1756-0500     ISO Abbreviation:  BMC Res Notes     Publication Date:  2012 Oct 
Date Detail:
Created Date:  2012-10-1     Completed Date:  -     Revised Date:  -    
Medline Journal Info:
Nlm Unique ID:  101462768     Medline TA:  BMC Res Notes     Country:  -    
Other Details:
Languages:  ENG     Pagination:  2101791285670483     Citation Subset:  -    
Export Citation:
APA/MLA Format     Download EndNote     Download BibTex
MeSH Terms
Descriptor/Qualifier:

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine

Full Text
Journal Information
Journal ID (nlm-ta): BMC Res Notes
Journal ID (iso-abbrev): BMC Res Notes
ISSN: 1756-0500
Publisher: BioMed Central
Article Information
Download PDF
Copyright ©2012 Fischer et al.; licensee BioMed Central Ltd.
open-access:
Received Day: 3 Month: 4 Year: 2012
Accepted Day: 20 Month: 9 Year: 2012
collection publication date: Year: 2012
Electronic publication date: Day: 1 Month: 10 Year: 2012
Volume: 5First Page: 540 Last Page: 540
PubMed Id: 23021568
ID: 3542089
Publisher Id: 1756-0500-5-540
DOI: 10.1186/1756-0500-5-540

Ubiquinol decreases monocytic expression and DNA methylation of the pro-inflammatory chemokine ligand 2 gene in humans
Alexandra Fischer1 Email: fischer@molprev.uni-kiel.de
Simone Onur1 Email: onur@molprev.uni-kiel.de
Constance Schmelzer2 Email: schmelzer@fbn-dummerstorf.de
Frank Döring1 Email: sek@molprev.uni-kiel.de
1Institute for Human Nutrition and Food Science, Department of Molecular Prevention, Christian Albrechts University, Kiel, Germany
2Research Unit Nutritional Physiology “Oskar Kellner”, Leibniz Institute for Farm Animal Biology (FBN), Dummerstorf, Germany

Background

Coenzyme Q10 (CoQ10) is a key component of the mitochondrial respiratory chain where it is mainly known for its role in oxidative phosphorylation. The reduced form of CoQ10, ubiquinol, serves as a potent antioxidant in mitochondria, lipid membranes and plasma lipoproteins [1,2] as well as a regenerator of other lipid soluble antioxidants (e.g. vitamin E) [3,4]. Several studies in vitro[5-7], in SAMP1 mice [8] and in humans [9] indicate that ubiquinol is involved in inflammatory processes and lipid metabolism via gene expression.

Gene expression as well as DNA methylation processes are affected by various dietary supplements and food nutrients [10-13]. Furthermore, DNA methylation is one of the epigenetic modifications that per se is able to determine the gene expression by regulating the chromatin organization [10,14]. During methylation of mammalian DNA a methyl group is attached at the 5-position of the cytosine residue within the cytosine-guanine dinucleotides (CpG) resulting in the formation of 5-methylcytosine, which is designated as the fifth base of DNA [15]. Although most genomic DNA in mammals is deficient in CpG sites, clusters of CpG dinucleotides (CpG islands) were described to be primarily located at promoter regions of genes [16]. Here we investigated the effect of ubiquinol on the expression and methylation of CpG island promoter regions of pro-inflammatory genes in humans.

Materials and methods
Participants and study design

Sample characteristics of subjects and study design have been described lately [9]. Briefly: fifty-three healthy male volunteers, 21–48 years of age, received 150 mg of the reduced form of CoQ10 (Q10H2, ubiquinol, KANEKA Corporation, Japan) daily in form of three capsules with each principal meal for 14 days. Fasting blood samples were taken before (T0) and after (T14) supplementation. The participants had an average Body Mass Index (BMI) of 24.1 ± 2.5 kg/m2, no history of gastrointestinal, hepatic, cardiovascular or renal diseases, a habit of non- or occasional smoking and maintenance of usual nutrition habits. The study was approved by the ethics committee of the Medical Faculty of Kiel University, Germany, and was conformed to Helsinki Declaration. All volunteers gave written informed consent.

Microarray-based gene expression analysis and qRT-PCR

Microarray experiment using the Affymetrix human genome U133 plus 2.0 GeneChip® were performed as described previously [5] with RNA samples from CD14-positive monocytes obtained from three volunteers before (T0) and after (T14) supplementation with ubiquinol. Based on microarray data, expression levels of selected genes including the CXCL2, MMD and PMAIP1 gene were verified by real-time qRT-PCR. Primer sequences for real-time qRT-PCR experiments were designed with Primer Express® Software 3.0 (Applied Biosystems, Darmstadt, Germany). Primer pairs were obtained from MWG Biotech AG (Ebersberg, Germany). cDNA synthesis with subsequent PCR amplification procedure has been described before [9].

Methylation analysis of genomic regions of CXCL2, MMD and PMAIP1 gene

The presence of CpG islands within the CXCL2, MMD and PMAIP1 genes was predicted using the European Molecular Biology Open Software Suite CpGplot, respectively. Quantitative methylation analysis was performed on the MassARRAY® system (Sequenom, Hamburg, Germany) at BioGlobe (Hamburg, Germany) applying the MassCLEAVETM (hMC) biochemistry after bisulfit treatment of DNA samples and MALDI-TOF mass spectrometry for analyte detection. All reactions were performed according to the standard protocols recommended by the supplier. Genomic DNA was extracted from human monocytes obtained from five volunteers (H1/H1_1 to H5/H5_1) before (T0, H1-H5) and after (T14, H1_1-H5_5) using the DNeasy Tissue Kit (Quiagen). Analysis was carried out from both, forward and reverse strand.

The protocol starts with a bisulfit treatment of provided genomic DNA sample, which converts native cytosine (“C”) nucleotides into uracil (“U”), whereas 5-methyl-protected cytosine residues remain as “C”. The resulting artificial sequence variation is conserved during PCR amplification using methylation independent primers. One primer for each PCR is tagged with T7 RNA polymerase promoter sequence facilitating the transformation of double stranded PCR product into single stranded RNA together with a second level of amplification. The in vitro transcription product is “U-specific” cleaved with RNase A. The generated fragments represent unique portions of the amplified region of interest and are displayed based on their molecular weight in the mass spectrum, which is acquired after sample conditioning with a MassARRAY® Analyzer Compact. Automated data analysis was performed with EpiTyper Software.


Findings
Results and discussion
Ubiquinol supplementation reduces the expression of low and high abundant mRNA steady-state levels of pro-inflammatory genes in human monocytes

Several studies in vitro and in rodents indicate that Coenzyme Q10 or rather its reduced form, ubiquinol, reduces inflammatory processes via gene expression. To study the putative link between ubiquinol dependent gene expression and DNA methylation we used probes from our human study [9]. In this study, we found a significant decrease of LDL-cholesterol and erythropoiesis after a 14 day supplementation period with 150 mg/ day ubiquinol. Microarray-based gene expression analysis and qRT-PCR verification of selected genes identified 272 genes regulated by ubiquinol supplementation in monocytes. This gene list was used to select pro-inflammatory genes which differ in their expression levels at baseline (T0) and showed markedly differences in ubiquinol dependent regulation. Therefore, three genes encoding the chemokine (C-X-C motif) ligand 2 (CXCL2), the phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1) and the monocyte to macrophage differentiation-associated protein (MMD) were selected. CXCL2 as well as PMAIP1 and MMD are involved in differentiation processes of blood monocytes to macrophages [17-20]. Furthermore, CXCL2 and PMAIP1 are key players in apoptosis induction and inflammatory responses, respectively [21-23]. The MMD gene is highly expressed in mature macrophages but its exact biological function is not clear so far [24]. As shown in Table 1, PMAIP1 and CXCL2 showed about 8.7 to 7.9-fold higher expression levels than MMD gene at baseline (T0) in human monocytes. Ubiquinol supplementation leads to a down regulation of the low expressing MMD gene by a factor of 1.7. The expression of the high abundant transcript of the PMAIP gene is 2.2-fold reduced by ubiquinol. Remarkably, ubiquinol decreases the expression of the high expressing CXCL2 gene more than 10-fold. Together, ubiquinol reduces the expression of the pro-inflammatory genes CXCL2, PMAIP1 and MMD.

Ubiquinol supplementation reduces the methylation status of six adjacent CpG islands within the promoter of the CXCL2 gene

There is evidence that difference in gene expression correlates with CpG island variation [25]. In order to evaluate whether the ubiquinol dependent reduction in the expression of the CXCL2, PMAIP1 and MMD gene are linked to variation in methylation patterns, bisulfit-based and matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF) mass spectrometry was used for analysing CpG islands within promoter regions of the respective genes. As shown in Table 2 and Figure 1A/ Additional file 1: Figure S1A/ Additional file 2: Figure S2A, we analysed in total 656 CpG islands which covered the promoter regions and the adjacent exon 1 of the CXCL2 (146 CpG islands), PMAIP1 (347) and MMD (163) gene. There was only weak methylation detected in the analysed CpG islands of the genes PMAIP1 and MMD before and after supplementation with ubiquinol (Additional file 1: Figure S1B-H, Additional file 2: Figure S2B/C). Most CpG islands of the CXCL2 gene were also unaffected by ubiquinol (Figure 1B/D/E). As shown in Figure 1C, the methylation status of six adjacent CpG islands (39 to 44) was reduced under ubiquinol treatment. Methylation pattern of CpG islands which are located in close proximity to this region showed no alteration before and after ubiquinol supplementation. Quantitative analysis revealed that ubiquinol reduced the methylation of CpG islands 39–44 (Figure 2) of the CXCL2 gene by a factor of 3.4.

The effect of ubiquinol on DNA methylation seems to be rather gene specific and might depend on the extent of ubiquinol induced alteration of gene expression

Our study provides a first hint towards a modifying effect of ubiquinol on DNA methylation in humans. This effect is in line with another human study demonstrating that a supplementation with a mixture of CoQ10, niacin and riboflavin reduces DNA methylation of the tumor suppressor gene RASSF1A in breast cancer patients undergoing tamoxifen therapy [26]. Moreover, literature indicates that global methylation patterns are affected by several other dietary supplements and micronutrients [27-32]. The effect of ubiquinol on DNA methylation seems be rather gene specific because we identified two genes (PMAIP1, MMD) which are regulated by ubiquinol without changing DNA methylation. A recent SAMP-mice study from our group [33] found that ubiquinol alters hepatic expression of PPARα target genes without influencing DNA methylation in the respective gene promoters.

The effect of ubiquinol on DNA methylation might be linked to the extent of ubiquinol dependent alteration of gene expression. In the case of the CXCL2 gene, ubiquinol reduces its expression more than 10-fold accompanied by a reduced methylation status within certain CpG islands. This finding seems to be contradictory to common models of gene expression, because increased DNA methylation of a gene leads to reduced expression levels [34], whereas demethylation correlates with the transcription of the gene [35]. On the other hand there is evidence, especially in cancer cells, that DNA methylation status does not correlate with gene expression [36,37]. However, the mechanism regarding effects of ubiquinol on DNA methylation and expression remains unclear and has to be studied in the future. The reduced expression of pro-inflammatory genes under ubiquinol supplementation supports recent findings from our lab [5,6,8,9,38-41] and other groups [42,43] suggesting that CoQ10 displays anti-inflammatory properties. As a summary, we found in a human intervention study that ubiquinol decreases expression and DNA methylation of the pro-inflammatory CXCL2 gene in monocytes. Further studies will be necessary to investigate the mechanistic link between ubiquinol dependent gene expression, DNA methylation and inflammation.


Competing interest

All authors declare that they have no competing interests.


Authors’ contribution

AF and CS carried out the experiments and collected the data. SO analysed the data and wrote the manuscript. FD designed the study and drafted the manuscript. All authors read and approved the final manuscript.


Supplementary Material Additional file 1

Figure S1. Position of amplicons within the analysed genomic region (A) and methylation status of CpG islands (B-H) of the human PMAIP gene. A, The genomic region of the PMAIP gene is located from −390 to +1153 relative to the gene start. This refers to position 57566802–57568344 of the NCBI’s human genome build 37.1. The gene is shown in its transcripted orientation and locates on the sense strand of chromosome 18. Colors illustrate position of the gene (blue), mRNA (green), region for amplicon design (orange), amplicons (yellow) and annotated (Ensembl) regulatory region (pink). B-H, Colored dots indicate the methylation ratio (%) at each analyzed CpG-unit within each amplicon. Samples are indicated as H-1 to H-5 (time point T0) and H-1_1 to H-5_1 (T14). Base count (upper ruler scale) and CpG-site numbering (lower ruler scale) refers to the analyzed strand in 5’→3’ orientation of the analyzed amplicon sequence. Sample “nc_001” represents the reaction negative control (water) and “con42” a control DNA.


Click here for additional data file (1756-0500-5-540-S1.doc)

Additional file 2

Figure S2. Position of amplicons with in the analysed genomic region (A) and methylation status of CpG islands (B, C) of the human MMD gene. A, The genomic region of the MMD gene is located from −564 to +470 relative to the gene start. This refers to position 53498872–53499905 of the NCBI’s human genome build 37.1. The gene is shown in its transcripted orientation and locates on the sense strand of chromosome 17. Colors illustrate position of the gene (blue), mRNA (green), region for amplicon design (orange), amplicons (yellow) and annotated (Ensembl) regulatory region (pink). B and C, Colored dots indicate the methylation ratio (%) at each analyzed CpG-unit within each amplicon. Samples are indicated as H-1 to H-5 (time point T0) and H-1_1 to H-5_1 (T14). Base count (upper ruler scale) and CpG-site numbering (lower ruler scale) refers to the analyzed strand in 5’→3’ orientation of the analyzed amplicon sequence. Sample “nc_001” represents the reaction negative control (water) and “con42” a control DNA.


Click here for additional data file (1756-0500-5-540-S2.doc)


References
Littarru GP,Tiano L,Bioenergetic and antioxidant properties of coenzyme Q10: recent developmentsMol BiotechnolYear: 2007371313710.1007/s12033-007-0052-y17914161
Littarru GP,Tiano L,Clinical aspects of coenzyme Q10: an updateNutritionYear: 201026325025410.1016/j.nut.2009.08.00819932599
Mukai K,Itoh S,Morimoto H,Stopped-flow kinetic study of vitamin E regeneration reaction with biological hydroquinones (reduced forms of ubiquinone, vitamin K, and tocopherolquinone) in solutionJ Biol ChemYear: 19922673122277222811429580
Crane FL,Navas P,The diversity of coenzyme Q functionMol Aspects MedYear: 199718SupplS1S69266500
Schmelzer C,Doring F,Identification of LPS-inducible genes downregulated by ubiquinone in human THP-1 monocytesBiofactorsYear: 201036322222810.1002/biof.9320533395
Schmelzer C,Kohl C,Rimbach G,Doring F,The reduced form of coenzyme Q10 decreases the expression of lipopolysaccharide-sensitive genes in human THP-1 cellsJ Med FoodYear: 201114439139710.1089/jmf.2010.008021370964
Groneberg DA,Kindermann B,Althammer M,Klapper M,Vormann J,Littarru GP,Doring F,Coenzyme Q10 affects expression of genes involved in cell signalling, metabolism and transport in human CaCo-2 cellsInt J Biochem Cell BiolYear: 20053761208121810.1016/j.biocel.2004.11.01715778085
Schmelzer C,Kubo H,Mori M,Sawashita J,Kitano M,Hosoe K,Boomgaarden I,Doring F,Higuchi K,Supplementation with the reduced form of Coenzyme Q10 decelerates phenotypic characteristics of senescence and induces a peroxisome proliferator-activated receptor-alpha gene expression signature in SAMP1 miceMol Nutr Food ResYear: 201054680581519960455
Schmelzer C,Niklowitz P,Okun JG,Haas D,Menke T,Doring F,Ubiquinol-induced gene expression signatures are translated into altered parameters of erythropoiesis and reduced low density lipoprotein cholesterol levels in humansIUBMB LifeYear: 2011631424810.1002/iub.41321280176
Vucetic Z,Kimmel J,Totoki K,Hollenbeck E,Reyes TM,Maternal high-fat diet alters methylation and gene expression of dopamine and opioid-related genesEndocrinologyYear: 2010151104756476410.1210/en.2010-050520685869
Yubero-Serrano EM,Gonzalez-Guardia L,Rangel-Zuniga O,Delgado-Lista J,Gutierrez-Mariscal FM,Perez-Martinez P,Delgado-Casado N,Cruz-Teno C,Tinahones FJ,Villalba JM,et al. Mediterranean diet supplemented with coenzyme Q10 modifies the expression of proinflammatory and endoplasmic reticulum stress-related genes in elderly men and womenJ Gerontol A: Biol Sci Med SciYear: 201267131022016358
van den Donk M,van Engeland M,Pellis L,Witteman BJ,Kok FJ,Keijer J,Kampman E,Dietary folate intake in combination with MTHFR C677T genotype and promoter methylation of tumor suppressor and DNA repair genes in sporadic colorectal adenomasCancer epidemiology, biomarkers & prevention: a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive OncologyYear: 200716232733310.1158/1055-9965.EPI-06-0810
van Engeland M,Weijenberg MP,Roemen GM,Brink M,de Bruine AP,Goldbohm RA,van den Brandt PA,Baylin SB,de Goeij AF,Herman JG,Effects of dietary folate and alcohol intake on promoter methylation in sporadic colorectal cancer: the Netherlands cohort study on diet and cancerCancer ResYear: 200363123133313712810640
Silahtaroglu A,Stenvang J,MicroRNAs, epigenetics and diseaseEssays BiochemYear: 201048116518510.1042/bse048016520822493
Delaval K,Feil R,Epigenetic regulation of mammalian genomic imprintingCurr Opin Genet DevYear: 200414218819510.1016/j.gde.2004.01.00515196466
Takai D,Jones PA,Comprehensive analysis of CpG islands in human chromosomes 21 and 22Proc Natl Acad Sci USAYear: 20029963740374510.1073/pnas.05241009911891299
Bender AT,Beavo JA,PDE1B2 regulates cGMP and a subset of the phenotypic characteristics acquired upon macrophage differentiation from a monocyteProc Natl Acad Sci USAYear: 2006103246046510.1073/pnas.050997210216407168
Bourdonnay E,Morzadec C,Sparfel L,Galibert MD,Jouneau S,Martin-Chouly C,Fardel O,Vernhet L,Global effects of inorganic arsenic on gene expression profile in human macrophagesMol ImmunolYear: 200946464965610.1016/j.molimm.2008.08.26819128835
Liang F,Seyrantepe V,Landry K,Ahmad R,Ahmad A,Stamatos NM,Pshezhetsky AV,Monocyte differentiation up-regulates the expression of the lysosomal sialidase, Neu1, and triggers its targeting to the plasma membrane via major histocompatibility complex class II-positive compartmentsJ Biol ChemYear: 200628137275262753810.1074/jbc.M60563320016835219
Liu Q,Zheng J,Yin DD,Xiang J,He F,Wang YC,Liang L,Qin HY,Liu L,Liang YM,Han H,Monocyte to macrophage differentiation-associated (MMD) positively regulates ERK and Akt activation and TNF-alpha and NO production in macrophagesMol Biol RepYear: 20123955643565010.1007/s11033-011-1370-522203480
Yu J,Zhang L,The transcriptional targets of p53 in apoptosis controlBiochem Biophys Res CommunYear: 2005331385185810.1016/j.bbrc.2005.03.18915865941
Kim HY,Kim HS,Upregulation of MIP-2 (CXCL2) expression by 15-deoxy-Delta(12,14)-prostaglandin J(2) in mouse peritoneal macrophagesImmunol Cell BiolYear: 2007851606710.1038/sj.icb.710000117130903
Lkhagvaa B,Tani K,Sato K,Toyoda Y,Suzuka C,Sone S,Bestatin, an inhibitor for aminopeptidases, modulates the production of cytokines and chemokines by activated monocytes and macrophagesCytokineYear: 200844338639110.1016/j.cyto.2008.10.01119036603
Rehli M,Krause SW,Schwarzfischer L,Kreutz M,Andreesen R,Molecular cloning of a novel macrophage maturation-associated transcript encoding a protein with several potential transmembrane domainsBiochem Biophys Res CommunYear: 1995217266166710.1006/bbrc.1995.28257503749
Shen L,Kondo Y,Guo Y,Zhang J,Zhang L,Ahmed S,Shu J,Chen X,Waterland RA,Issa JP,Genome-wide profiling of DNA methylation reveals a class of normally methylated CpG island promotersPLoS GenetYear: 20073102023203617967063
Premkumar VG,Yuvaraj S,Shanthi P,Sachdanandam P,Co-enzyme Q10, riboflavin and niacin supplementation on alteration of DNA repair enzyme and DNA methylation in breast cancer patients undergoing tamoxifen therapyBr J NutrYear: 200810061179118210.1017/S000711450896827618377693
Brunaud L,Alberto JM,Ayav A,Gerard P,Namour F,Antunes L,Braun M,Bronowicki JP,Bresler L,Gueant JL,Effects of vitamin B12 and folate deficiencies on DNA methylation and carcinogenesis in rat liverClin Chem Lab Med: CCLM / FESCCYear: 200341810121019
Fischer A,Gaedicke S,Frank J,Doring F,Rimbach G,Dietary vitamin E deficiency does not affect global and specific DNA methylation patterns in rat liverBr J NutrYear: 2010104793594010.1017/S000711451000164920447326
Ly A,Hoyt L,Crowell J,Kim YI,Folate and DNA MethylationAntioxid Redox SignalYear: 2012
Uekawa A,Katsushima K,Ogata A,Kawata T,Maeda N,Kobayashi K,Maekawa A,Tadokoro T,Yamamoto Y,Change of epigenetic control of cystathionine beta-synthase gene expression through dietary vitamin B12 is not recovered by methionine supplementationJ Nutrigenet NutrigenomicsYear: 200921293610.1159/00016537419776636
Waterland RA,Assessing the effects of high methionine intake on DNA methylationJ NutrYear: 20061366 Suppl1706S1710S16702343
Wolff GL,Kodell RL,Moore SR,Cooney CA,Maternal epigenetics and methyl supplements affect agouti gene expression in Avy/a miceFASEB J: Off Publ Fed Am Soc Exp BiolYear: 19981211949957
Schmelzer C,Okun JG,Haas D,Higuchi K,Sawashita J,Mori M,Doring F,The reduced form of coenzyme Q10 mediates distinct effects on cholesterol metabolism at the transcriptional and metabolite level in SAMP1 miceIUBMB LifeYear: 2010621181281810.1002/iub.38821086475
Ehrlich M,Expression of various genes is controlled by DNA methylation during mammalian developmentJ Cell BiochemYear: 200388589991010.1002/jcb.1046412616529
De Smet C,Lurquin C,Lethe B,Martelange V,Boon T,DNA methylation is the primary silencing mechanism for a set of germ line- and tumor-specific genes with a CpG-rich promoterMol Cell BiolYear: 199919117327733510523621
Gama-Sosa MA,Slagel VA,Trewyn RW,Oxenhandler R,Kuo KC,Gehrke CW,Ehrlich M,The 5-methylcytosine content of DNA from human tumorsNucleic Acids ResYear: 198311196883689410.1093/nar/11.19.68836314264
Baylin SB,Herman JG,Graff JR,Vertino PM,Issa JP,Alterations in DNA methylation: a fundamental aspect of neoplasiaAdv Cancer ResYear: 1998721411969338076
Schmelzer C,Kitano M,Rimbach G,Niklowitz P,Menke T,Hosoe K,Doring F,Effects of ubiquinol-10 on microRNA-146a expression in vitro and in vivoMediators InflammYear: 2009200941543719390647
Schmelzer C,Lindner I,Rimbach G,Niklowitz P,Menke T,Doring F,Functions of coenzyme Q10 in inflammation and gene expressionBiofactorsYear: 2008321–417918319096114
Schmelzer C,Lindner I,Vock C,Fujii K,Doring F,Functional connections and pathways of coenzyme Q10-inducible genes: an in-silico studyIUBMB LifeYear: 2007591062863310.1080/1521654070154599117852568
Schmelzer C,Lorenz G,Lindner I,Rimbach G,Niklowitz P,Menke T,Doring F,Effects of Coenzyme Q10 on TNF-alpha secretion in human and murine monocytic cell linesBiofactorsYear: 2007311354110.1002/biof.552031010418806307
Dominguez PM,Ardavin C,Differentiation and function of mouse monocyte-derived dendritic cells in steady state and inflammationImmunol RevYear: 201023419010410.1111/j.0105-2896.2009.00876.x20193014
Sohet FM,Neyrinck AM,Pachikian BD,de Backer FC,Bindels LB,Niklowitz P,Menke T,Cani PD,Delzenne NM,Coenzyme Q10 supplementation lowers hepatic oxidative stress and inflammation associated with diet-induced obesity in miceBiochem PharmacolYear: 200978111391140010.1016/j.bcp.2009.07.00819632207

Figures

[Figure ID: F1]
Figure 1 

Position of amplicons within the analysed genomic region (A) and methylation status of CpG islands (B-E) of the human CXCL2 gene. A, The genomic region of the CXCL2 gene is located from −365 to +450 relative to the gene start. This refers to position 74964548–74965362 of the NCBI’s human genome build 37.1. The gene is shown in its transcripted orientation and locates on the sense strand of chromosome 4. Colors illustrate position of the gene (blue), mRNA (green), region for amplicon design (orange), amplicons (yellow) and annotated (Ensembl) regulatory region (pink). B-E, Colored dots indicate the methylation ratio (%) at each analyzed CpG-unit within each amplicon. Samples are indicated as H-1 to H-5 (time point T0) and H-1_1 to H-5_1 (T14). Base count (upper ruler scale) and CpG-site numbering (lower ruler scale) refers to the analyzed strand in 5’→3’ orientation of the analyzed amplicon sequence. Sample “nc_001” represents the reaction negative control (water) and “con42” a control DNA.



[Figure ID: F2]
Figure 2 

Methylation status of CpG islands of the CXCL2 gene in monocytes of human volunteers before (T0) and after (T14) a 14 day supplementation period with ubiquinol. The extent of methylation (%, mean ± SD) of CpG islands 33, 39–44 and 45 within amplicon 2 of the CXCL2 gene (see Figure 1C) is shown.



Tables
[TableWrap ID: T1] Table 1 

Normalized steady-state mRNA expression levels (AU) of the CXCL2, PMAIP1 and MMD gene in monocytes of human volunteers before (T0) and after (T14) supplementation with ubiquinol


Gene
T0
T14
Fold change
      (T0 vs. T14)
PMAIP1
1271 ± 35
578 ± 106
-2,2
MMD
147 ± 30
85 ± 19
-1,7
CXCL2 1150 ± 865 93 ± 30 -12,4

T0, expression levels before supplementation (baseline); T14, expression levels after a 14 day supplementation period with 150 mg/ d ubiquinol; fold change, relative change from time point T0 to T14; AU, arbitrary units; Data are given as mean ± SEM.


[TableWrap ID: T2] Table 2 

Position, length and number of CpG islands of amplicons covering the analysed genomic regions of the human CXCL2, PMAIP1 and MMD gene


  start end length CpGs left primer (+Tag) right primer (+Tag)
gene/amplicon
 
 
 
 
 
 
PMAIP1_amp01 f
3
565
563
57
ATTGTTAAGGTTTTTGGTTTTTTTT
CTCAACCTCCAACTAAAACACCTC
PMAIP1_amp02 f
485
1068
584
49
TTTTAGTATTTTTGTTTGTAGGATTGTT
AAACTCTCTCCTACCCCTTCTACC
PMAIP1_amp03 f
1113
1529
417
13
AGGGTTTTTGTGTTTAGGAGTTTAGA
AAATAAACAAAACTTTTTCCATCCC
PMAIP1_amp07 f
-23
565
587
57
TTTGGGTTTGTTTATTTAAGTTTTT
CTCAACCTCCAACTAAAACACCTC
PMAIP1_amp04 r
3
512
510
53
AATAGTTTTGTAGGTAGGGATGTTGG
ATTACCAAAACCTCTAATCTCTCCC
PMAIP1_amp05 r
374
954
581
53
AGGAGGAAAGGAGTTTTTTGTTTTT
TCACCAAAAAAATTCTCACTAAACA
PMAIP1_amp06 r
930
1481
552
22
TTGTTATTAATTTAGGTATGGTTATATTTG
AAAAACAAAAAACTCCTTTCCTCCT
PMAIP1_amp08 r
-9
399
409
43
TTGTTTAGTGAGAATTTTTTTGGTG
CCCAAATCTCTAATTACCAAAACCT
MMD_amp01 f
236
986
751
81
AGGTAGGGTTGTTTGTTTGTTGTTA
AATCCACCCAAAATAAATCCAAAT
MMD_amp02 r
274
1015
742
82
TAGGGAATTGATTTTTGGTTAAGGT
ACTTTTAAAATTTCCTAATCCATCTCC
CXCL2_amp01 f
2
427
426
30
AGGATSGSTAAGATATGTTGTAGTTTTTG
CTTTTATACATAATTAAAACTAAAAAACCC
CXCL2_amp02 f
228
780
553
48
GGGGTAGAAAGAGAATATTTTATAGTTGG
AAATTCCCTACAAAATCTACAAACAC
CXCL2_amp03 r
45
491
447
34
GAGGAGAGTTGGTAAGGAGTTGTTT
CCCAACAACTAAAATATCTTCCAAAA
CXCL2_amp04 r 399 794 396 34 GATGTTTTTGAGGTGAATTTTTTGT AACTTTCCAACCCCAACCATACATA

The start and end positions of amplicons refer to the genomic regions as illustrated in Figure 1 (CXCL2 gene) and Additional file 1: Figure S1 (PMAIP1) and Additional file 2: Figure S2 (MMD). Primer sequences shown in 5´ to 3´ direction are complementary to sequences obtained after bisulfite treatment and differ from the original genomic target by exchanging each “C” with “T”. f, forward direction of the amplicon; r, reverse direction of the amplicon.



Article Categories:
  • Short Report

Keywords: Coenzyme Q10, Ubiquinol, Gene expression, DNA methylation, Inflammation.

Previous Document:  Brain-derived neurotrophic factor serum levels in cocaine-dependent patients during early abstinence...
Next Document:  The importance of controlling for the acute-phase response in the population-based assessment of vit...