Document Detail

TonB-dependent transporters and their occurrence in cyanobacteria.
Jump to Full Text
MedLine Citation:
PMID:  19821963     Owner:  NLM     Status:  MEDLINE    
BACKGROUND: Different iron transport systems evolved in Gram-negative bacteria during evolution. Most of the transport systems depend on outer membrane localized TonB-dependent transporters (TBDTs), a periplasma-facing TonB protein and a plasma membrane localized machinery (ExbBD). So far, iron chelators (siderophores), oligosaccharides and polypeptides have been identified as substrates of TBDTs. For iron transport, three uptake systems are defined: the lactoferrin/transferrin binding proteins, the porphyrin-dependent transporters and the siderophore-dependent transporters. However, for cyanobacteria almost nothing is known about possible TonB-dependent uptake systems for iron or other substrates.
RESULTS: We have screened all publicly available eubacterial genomes for sequences representing (putative) TBDTs. Based on sequence similarity, we identified 195 clusters, where elements of one cluster may possibly recognize similar substrates. For Anabaena sp. PCC 7120 we identified 22 genes as putative TBDTs covering almost all known TBDT subclasses. This is a high number of TBDTs compared to other cyanobacteria. The expression of the 22 putative TBDTs individually depends on the presence of iron, copper or nitrogen.
CONCLUSION: We exemplified on TBDTs the power of CLANS-based classification, which demonstrates its importance for future application in systems biology. In addition, the tentative substrate assignment based on characterized proteins will stimulate the research of TBDTs in different species. For cyanobacteria, the atypical dependence of TBDT gene expression on different nutrition points to a yet unknown regulatory mechanism. In addition, we were able to clarify a hypothesis of the absence of TonB in cyanobacteria by the identification of according sequences.
Oliver Mirus; Sascha Strauss; Kerstin Nicolaisen; Arndt von Haeseler; Enrico Schleiff
Related Documents :
3011753 - Escherichia coli k-12 envelope proteins specifically required for ferrienterobactin upt...
16753813 - Identification of a zinc transporter gene in strawberry.
2331993 - Isolation and characterization of a cdna encoding porcine gastric haptocorrin.
Publication Detail:
Type:  Journal Article; Research Support, Non-U.S. Gov't     Date:  2009-10-12
Journal Detail:
Title:  BMC biology     Volume:  7     ISSN:  1741-7007     ISO Abbreviation:  BMC Biol.     Publication Date:  2009  
Date Detail:
Created Date:  2009-11-03     Completed Date:  2009-11-23     Revised Date:  2013-05-31    
Medline Journal Info:
Nlm Unique ID:  101190720     Medline TA:  BMC Biol     Country:  England    
Other Details:
Languages:  eng     Pagination:  68     Citation Subset:  IM    
JWGU Frankfurt am Main, Cluster of Excellence Macromolecular Complexes, Centre of Membrane Proteomics, Department of Biosciences, Max-von-Laue Str. 9, 60438 Frankfurt, Germany.
Export Citation:
APA/MLA Format     Download EndNote     Download BibTex
MeSH Terms
Anabaena / genetics,  metabolism
Bacterial Outer Membrane Proteins / genetics,  metabolism
Bacterial Proteins / genetics*,  metabolism
Base Sequence
Biological Transport, Active / genetics
Cluster Analysis
Copper / metabolism
Culture Media / chemistry
Cyanobacteria / genetics*,  metabolism
Databases, Nucleic Acid
Gene Expression Regulation, Bacterial
Genome, Bacterial*
Ion Transport / genetics*
Iron / metabolism
Markov Chains
Membrane Proteins / genetics,  metabolism*
Membrane Transport Proteins / classification,  genetics*,  metabolism
Nitrogen / metabolism
Operon / genetics
Sequence Homology, Nucleic Acid
Systems Biology / methods
Reg. No./Substance:
0/Bacterial Outer Membrane Proteins; 0/Bacterial Proteins; 0/Culture Media; 0/Ligands; 0/Membrane Proteins; 0/Membrane Transport Proteins; 0/tonB protein, Bacteria; 7439-89-6/Iron; 7440-50-8/Copper; 7727-37-9/Nitrogen

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine

Full Text
Journal Information
Journal ID (nlm-ta): BMC Biol
ISSN: 1741-7007
Publisher: BioMed Central
Article Information
Download PDF
Copyright ? 2009 Mirus et al; licensee BioMed Central Ltd.
open-access: This is an Open Access article distributed under the terms of the Creative Commons Attribution License (), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Received Day: 29 Month: 5 Year: 2009
Accepted Day: 12 Month: 10 Year: 2009
collection publication date: Year: 2009
Electronic publication date: Day: 12 Month: 10 Year: 2009
Volume: 7First Page: 68 Last Page: 68
ID: 2771747
Publisher Id: 1741-7007-7-68
PubMed Id: 19821963
DOI: 10.1186/1741-7007-7-68

TonB-dependent transporters and their occurrence in cyanobacteria
Oliver Mirus1 Email:
Sascha Strauss2 Email:
Kerstin Nicolaisen1 Email:
Arndt von Haeseler2 Email:
Enrico Schleiff1 Email:
1JWGU Frankfurt am Main, Cluster of Excellence Macromolecular Complexes, Centre of Membrane Proteomics, Department of Biosciences, Max-von-Laue Str. 9, 60438 Frankfurt, Germany
2Center for Integrative Bioinformatics Vienna, Max F Perutz Laboratories, University of Vienna, Medical University of Vienna, Veterinary University of Vienna, Austria

Filamentous cyanobacteria contain molecular machines for oxygenic photosynthesis under all growth conditions [1]. These machines, as well as those involved in respiration and nitrogen metabolism, depend on non-proteinaceous cofactors such as iron [2,3]. The level of iron found in cyanobacteria is generally one order of magnitude higher than in non-photosynthetic bacteria [4] and represents about 0.1% of their biomass [5]. Even though iron and copper are required for the function of respiratory and photosynthetic complexes, their intracellular level has to be tightly controlled as these ions pose a risk of oxidation [3]. Therefore, the uptake of iron is highly regulated in order to avoid intoxication. On the other hand, it is hypothesized that iron limitation might have been one of the selective forces in the evolution of cyanobacteria [6], and one might speculate that those cyanobacteria with the most efficient iron uptake systems might have had an evolutionary advantage. To enhance iron uptake, eubacteria secrete low-molecular-weight iron chelators (siderophores) under iron-limiting conditions to complex environmental iron [7]. The siderophore-iron complexes are bound by receptor proteins (TonB-dependent transporters, TBDTs) in the outer membrane which are composed of a transmembrane ?-barrel domain, a so-called plug domain and a periplasmic exposed TonB box. The siderophore-iron is subsequently transferred to the cytoplasm by transport proteins in the cytoplasmic membrane [8,9]. This process is dependent on TonB which provides the energy required for the translocation of siderophore-iron complexes across the outer membrane [10]. In order to facilitate this translocation, the periplasmic domain of TonB interacts with the TonB box of the loaded TBDT. It is proposed that TonB exerts a pulling force on the TonB box and, thereby, partially unfolds the plug domain enabling the translocation of the siderophore into the periplasmic space [11]. Several TBDTs have been identified. Beside the ones for iron transport [12,13], TBDTs for nickel [14], disaccharides (for sucrose SuxA; [15], for maltose MalA; [16]), oligo- (CsuF; [17]), polysaccharides (SusC; [18]) or large degradation products of proteins (RagA; [19]) are described. The most intensively studied function of TBDTs is the iron uptake in Gram-negative bacteria. Three large classes are defined, namely transferrin-/lactoferrin-binding proteins, porphyrin and siderophore transporters [20]. In addition to the transport of iron across the outer membrane by TBDTs, an additional ferric iron uptake system is postulated, but the corresponding outer membrane receptor has not yet been identified [21]. The TBDTs TbpA (transferring-binding protein A) and LbpA (lactoferrin-binding protein A) facilitate the uptake of iron from transferrin/lactoferrin, respectively; the uptake is also assisted by the lipoproteins TbpB and LbpB which face the extracellular side [22]. The porphyrin-transporting TBDTs include HasR, HgbA, HmbR (heme; [12,22]) and BtuB which transports the cobalt-complexing vitamin B12 (cobalamin [23]). Heme uptake is especially important in bacterial pathogens, where various heme-containing compounds are utilized [13]. The siderophore TBDTs are further sub-classified according to their substrate - that is the chemical nature of the siderophore they bind. Siderophores belong inter alia to hydroxamates, catecholates, phenolates, citrates or combinations thereof [9]. For example, the siderophore transporters FepA, ViuA and IroN recognize catecholates, FhuA, FoxA and FhuE hydroxamate and FecA citrate.

The iron uptake system in cyanobacteria is not well understood. For the non-filamentous cyanobacterium Synechocystis sp. PCC 6803 the TBDTs encoded by sll1206, sll1406, sll1409 and slr1490 were partially characterized [24,25]. For filamentous cyanobacteria such as Anabaena sp. PCC 7120 (also termed Nostoc sp. PCC 7120) only siderophore secretion [26-28], and the influence of enhanced or reduced iron levels on the growth [29-32], were investigated. Anabaena sp. PCC 7120 secretes the hydroxamate-type siderophore schizokinen, allegedly the only siderophore secreted [26,27]. Only recently, a TBDT encoded by schT (alr0397) involved in the uptake of schizokinen was identified. The expression of the gene schT (alr0397) was mildly increased under a shortage of Fe3+. A schT knock-out mutant showed a moderate phenotype of iron starvation, and the characterization of its siderophore-dependent iron uptake demonstrated the function of schT as a TonB-dependent schizokinen transporter [33].

To learn more about iron transport systems in general and in cyanobacteria particularly we searched for genes coding for TBDTs based on previously experimentally characterized TBDTs. Subsequently, we assigned putative substrates for so far uncharacterized TBDTs, according to their sequence similarity to already known TBDTs. We observed a substantial difference in the number of TBDT genes in the analysed cyanobacteria. The expression pattern of the TBDT genes in Anabaena sp. PCC 7120 is analysed with respect to iron, copper and nitrogen availability.

Results and discussion
Classification of TonB-dependent transporters

Ninety-eight TBDTs and the (putative) substrates (for example, metallophores or sugars) were extracted from the published literature (see Additional file 1) [14-19,22,34-124]. In order to classify the TBDTs with unknown substrates, we first searched for putative TBDTs in 686 sequenced genomes. We identified 4600 putative TBDTs in 347 species (see Additional file 2). Compared to previously published bioinformatic analyses [15,125], we identified fewer sequences in the species which had been analysed in the past due to a more stringent cutoff (not shown). More specifically, within the species analysed by Koebnik, we selected seven sequences not previously identified, but did not consider 103 sequences [125]. A similar ratio was found when analysing the number of sequences selected by us from the species analysed by Blanvillain et al. (+22/-142; [15]), who selected 3020 sequences which resulted in a discrepancy of about 5%.

We subsequently performed a cluster analysis of the identified sequences of putative TBDTs (see Methods) leading to 195 clusters with at least two sequences. Figure 1A shows the consensus tree used to highlight 'regions' on the two-dimensional sequence landscape. A region is marked by roman numerals if the substrate for at least one TBDT in this region is experimentally verified (expTBDTs) or predicted (pTBDTs), and marked by upper case letters if no substrate TBDT in the region is known (Figure 1). Figure 1B shows the expTBDT regions I-VII, XI, XII and XIII and the pTBDTs regions VIII, IX and X together with the uncharacterized regions A-N. Figure 2 shows an enlarged version of the dashed rectangle in Figure 1B. The colours describe the substrate that binds to the corresponding TBDTs. Figure 2 (bottom) shows a magnification of the expTBDTs regions, where the numbers refer to sequences with a known substrate (Additional file 1, [14-19,22,34-124]). In the following, we characterize the regions according to the 98 TBDTs that have been experimentally verified or predicted (Additional file 1, [14-19,22,34-124]).

Region I

This consists of 19 clusters with at least five sequences and 10 of them have assigned functions which include porphyrin, lacto-/transferrin and nickel transporters (Figure 2). Cluster 11 contains the sequence of the copper chelate binding protein OprC (sequence 1, for references see Additional file 1, [14-19,22,34-124]). A group of clusters (15, 17, 18, 59, 86 and 107; sequences 11-28) are comprised of heme-transporting (HmbR) proteins. Remarkably, the two enterobactin (catecholate; see Additional file 1, [14-19,22,34-124]) transporters VctA (cluster 59; sequence 28) and FetA (cluster 15; sequence 27) are located within the porphyrin group. This finding corroborates the observation that VctA and FetA are, supposedly, involved in transporting porphyrin [126,127]. In cluster 16, the LbpA or TbpA proteins are found (sequences 29, 30). There is also a small cluster (112) which contains nickel-transporting TBDTs with a single expTBDT (sequence 31, FrpB4).

Region II

This contains 20 clusters, three of them represented by expTBDTs (cluster 4, 12, 40). In cluster 4 the experimentally confirmed cobalt-complexing vitamin B12 transporter BtuB (sequence 32) is present. However, in the same cluster, and in clusters 160 and 165, predicted BtuBs were identified (sequences 33-39). Cluster 12 contains IrgA, BfrA or IroN sequences (No. 2-10) transporting enterobactin, DHBS (catecholate) or salmochelin (glycosylated catecholate). In addition, a myxochelin (catecholate) transporter (sequence 40, cluster 40) occurs in region II.

Region III

Cluster 10 is defined by sequences of the aerobactin/rhizobactin (Citrate-hydroxamate; see Additional file 1, [14-19,22,34-124]) transporters IutA and RhtA (sequence 41 and 42).

Region IV

The largest cluster in region IV (No. 82) contains the sequences of the ferric rhizoferrin (carboxylate) transporter RumA and the diferric dicitrate transporter FecA (sequences 44 and 45).

Region V (sequences 46-71)

This consists of nine clusters with three (clusters 0, 6, 7) of them containing expTBDTs and two pTBDTs (clusters 9, 25). This region mainly contains transporters for hydroxamate-type siderophores, such as desferrioxamine (hydroxamate; cluster 0, sequences 50, 51, 56), ferrichrome (hydroxamate; cluster 0, sequence 55), pseudobactin A (citrate-catecholate-hydroxamate; cluster 6, sequences 62, 63), pyochelin (phenolate; cluster 6, sequence 66), or anguibactin (catecholate-hydroxamate; cluster 7, sequences 69-71). Interestingly, the proteins for which sequences are found in cluster 9 (sequence 67, 68) are predicted to transport thiamin, whereas proteins 46 and 47 (cluster 25) are predicted to transport vitamin B12. The latter appears to be a false prediction as judged from the large distance to cluster 4 containing the experimentally confirmed BtuB. Setting an even lower P-value (1E-100 instead of 1E-90) as the threshold for defining the clusters in CLANS leads to cluster 0 splitting up in the upper part with all hydroxamate-type TBDTs (including all cyanobacterial TBDTs of cluster 0) and the lower part containing phenolate-transporting TBDTs and VciA, which has been shown to transport neither heme, vibriobactin, enterobactin, ferrioxamine B, aerobactin nor shizokinen [77].

Region VI

This region represents transporters for phenolates, catecholates or hexylsulfate and contains several clusters. A hexylsulfate transporting TBDT (sequence 77) can be found in cluster 45, a vibriobactin (catecholate) transporter (sequence 74) in cluster 140 and proteins transporting yersiniabactin (phenolate; sequences 72, 73) in cluster 79. As already observed in region V, we also detected two sequences (75, 76) in cluster 118 that are putative thiamin transporters.

Region VII (cluster 67)

Cluster 67 contains SuxA (sequence 78), an experimentally verified sucrose transporter. Please note, that sequence 79 has been predicted to transport sucrose [15]. The prediction was based on the co-localization of the corresponding gene with the transcriptional regulator ScrR. Thus, our bioinformatic analysis provides additional evidence for the functional characterization.

Region VIII (cluster 52)

This region contains predicted nickel and cobalt TBDTs with unknown metallophore specificity and no representative of the expTBDTs.

Region IX

This consists of eight sequences in one cluster (No. 32), where two of the eight are putative thiamin transporters. However, proteins assigned as thiamin transporters were also found in regions V (sequences 67, 68, cluster 7) and VI (sequences 75 and 76, cluster 118). Their genes are co-localized on the genome with a cytoplasmic membrane transporter for thiamin (PnuT, [128]), however, the functional assignment remains to be proven.

Region X

This contains a TBDT predicted to transport cobalt-complexing vitamin B12 (sequence 43, cluster 166). However, it is far away from the BtuB cluster in region II (Figure 2). Hence, the assigned function should be experimentally confirmed.

Region XI

The region is clearly separated from the rest and contains cluster 26. The experimentally characterized TBDTs include oligosaccharide (CsuF, sequence 88), polysaccharide transporters (SusC, sequence 87) and transporters for degradation products of proteins (RagA, sequences 85-86). While many taxa are represented by sequences in the region I-X, region XI consists almost exclusively of bacteroidetes with the exception of one ?-proteobacterial sequence (gi|108757959, Myxococcus xanthus). Thus, sequences in this region may indicate a special adaptation of these organisms, which may be due to their lifestyle. Bacteroidetes are involved in food digestion in the intestinal tract of mammals. Hence a specific TBDT class for the uptake of substrates provided by the host seems plausible.

Region XII

This also appears as an outlier (Figure 2). It contains eight clusters (35, 62, 63, 72, 76, 88, 187 and 188) and only one expTBDT MalA (sequence 90, cluster 63) that transports maltodextrin. Seven pTBDTs are said to transport xylan, pectin or chito-oligosaccharides (No. 91-97; for references see Additional file 1, [14-19,22,34-124]), where sequences 91-96 belong to cluster 63 and sequence 97 to cluster 72. It appears that this region is composed of di- and oligosaccharide transporters. In line with this notion, the ?-proteobacterial TBDTs are from Myxobacteria (Myxococcus xanthus, Sorangium cellulosum), which are found on decaying plant material consuming their saccharides. Most of the sequences in this region stem from ?- and ?-proteobacteria (18.4%, 76%) and a few bacteroidetes, ?- and ?-proteobacteria taxa.

Region XIII

Positioned between region XI and the crowded area on the right side, this region is defined by a fibronectin-binding TBDT (sequence 98, cluster 41). As in most of the sequences in region XI, the sequences of this region consist almost exclusively of bacteroidetes. The close proximity of regions XI and XIII is consistent with the observed interaction of the TBDT with a glycoprotein.

Other regions

For regions I to XIII we were in the lucky position of being able to infer at least putative functions to ~3700 sequences. (The putative annotation can be viewed at .) However, from the 4600 sequences from GenBank ~900 sequences remain in regions A-N, where we were unable to assign any function (Figure 1). While we cannot discuss potential substrates for clusters in regions A-N, we can at least point to some regions that show a peculiar taxonomic composition. In regions A and B sequences from mostly ?- (74%) and ?-proteobacteria (19%), but also a few ?-proteobacterial (5%) and bacteroidetes (1.5%), are present. Region C contains exclusively ?-proteobacterial sequences.

Classification of TonB-dependent transporters in cyanobacteria

One of our aims was the identification and classification of cyanobacterial TBDTs. Hence we searched for sequences of putative TBDTs in 32 cyanobacterial genomes (proteins listed according to their accession code (Table 1, column 1). We additionally extracted the automated annotation from GenBank (Table 1, column 2). At present, this annotation is mostly limited to CirA, FhuE or BtuB. Hence, we analysed the location of cyanobacterial sequences on the CLANS plot (Figure 3 shows the section of Figure 1B indicated by a grey box). All cyanobacterial TBDTs belong to regions with experimentally characterized TBDTs (see Figure 2 and dashed frames in Figure 3). To further confirm the classification determined with CLANS we also constructed a phylogenetic tree for the cyanobacterial sequences (Figure 4). Seven 'subtrees' (a-f) were identified and mapped to regions I-X.

The six sequences in subtree 'a' belong to region I (Figure 3, 4) and show a relation to heme transporters such as HutA (Figures 1, 2, sequence 13). The sequences are found in Synechococcus sp., Acaryochloris marina and Anabaena sp. PCC 7120 (see new assignment in Table 1, column 3). Subtrees 'b' and 'c' contain only sequences from Gloeobacter violaceus. Subtree 'b' is within region I and is equidistant to enterobactin and heme transporters. Thereby, a clear assignment to a characterized TBDT family appears currently impossible. Subtree 'd' is close to the BtuB transporter cluster (region II) (Figure 1). In this region we find sequences from most of the analysed cyanobacteria (8 of 12), suggesting that transporters with similarity to BtuB are common. Subtree 'e' (Figure 3, 4) represents transporters, which can clearly be assigned as specific for aerobactin/rhizobactin (IutA-/RhtA-type). Subtree 'f' represents sequences of transporters with the closest relation to FhuA-type transporters of cluster 0. The sequences of subtree 'g' (cluster 1), closely related to ViuA, are probably transporters for catecholates. The sequences of subtree 'g' are also close to cluster 118, which contains putative thiamin transporters. Nevertheless, since the two putative thiamin transporters have not yet been experimentally confirmed, we consider these cyanobacterial TBDTs to be iron transporters of the ViuA-type.

Summarizing, the assignment of the cyanobacterial TBDTs to regions with functional characterization was successful with the exception of some TBDTs from Gloeobacter violaceus (subtrees 'b' and 'c'). Although BtuB-like transporters and hydroxamate-type metallophore transporters were found in cyanobacteria, we did not find FecA-type (diferric dicitrate) TBDTs, even though they occur in ?-, ?-, ?-, ?- and ?-proteobacteria, bacteroidetes and spirochaetes.

Identification of TBDTs in Anabaena sp. PCC 7120

In order to explore the cyanobacterial TBDTs in more detail we analysed the full genome of Anabaena sp. PCC 7120. We identified 21 TBDT genes carrying the plug domain and ?-barrel domain characteristic for TBDTs. In addition, we identified four genes (all2620, alr2179, all2578, alr4028) containing the plug domain of the TBDT, but an incomplete ?-barrel domain. Downstream of all2620 (Figure 5A) and alr4028 (Figure 5B) a gene coding for the 'missing part' of the ?-barrel domain is present (all2619 and alr4029, respectively). Consequently, we checked the stop codon separating the two gene pairs. We confirmed the stop codon between all2620 and all2619 (Figure 5A) and could not identify a frame shift in the sequence of the region 500 bp upstream or downstream of the stop codon. If All2620 is, indeed, part of a TBDT it has to form a heterodimer. A putative interaction partner would be All2619. It would, therefore, be interesting to investigate the existence of such complex and to understand whether it is just a remnant of a genetic accident which led to a split of the TBDT gene in all2620 and all2619. In contrast to all2620 and all2619, for alr4028 and alr4029 we found a T to C exchange in the sequence when comparing our results with that of the deposited sequence. Hence, we conclude that the stop codon does not exist and that the two genes alr4028 and alr4029 encode one protein. Therefore, 22 TBDTs exist in Anabaena sp. PCC 7120.

For 19 TBDTs the genomic organization suggests the integration of the gene in an operon (Figure 5C). Twelve TBDTs are directly positioned behind a gene coding for a (putative) transcriptional regulator (Figure 5C, violet), and most of the (putative) operon structures contain genes coding for proteins involved in iron transport. The gene coding for a ViuA-type transporter is in a putative operon with subunits of a cytochrome D ubiquinol oxidase, which is rather unexpected, because, to date, a relation between this oxidase and iron transport has not been reported (Figure 5C). Of the BtuB transporters one is a single gene (all3310), whereas the other (the gene which we confirmed and which is still annotated as alr4028/alr4029) is in a rather typical genomic environment, namely in front of three genes encoding the periplasmic and the plasma membrane localized iron transport machinery. The same holds true for the hutA-like gene alr3242. The other hutA-like gene (alr2153) is in a putative operon with a gene encoding a tetracenomycin C synthesis protein and a gene of unknown function. Again, the relation between the TBDT and the downstream genes are rather questionable.

Three genes are classified as iutA-like. alr0397 (schT) is single standing in the genome. Downstream of alr2581 we found two genes coding for an unknown protein and a dicitrate binding protein, respectively. Alr2209 is a component of a large genomic region (~14 kbp, alr2208-alr2215) containing upstream a transcription regulator and downstream a cluster with three genes coding for periplasmic dicitrate binding proteins and one fhuA-like gene (alr2211). Thirteen of the 14 fhuA-like genes are upstream of a gene coding for a protein annotated as dicitrate-binding. However, most of the genes found in the putative operons defined by the 14 fhuA-like genes encode for proteins of unknown function. Three of the fhuA-like genes (alr2588, alr2592, alr2596) are in the same chromosomal region. Upstream of these, a gene coding a transcription regulator and downstream a gene encoding a dicitrate binding protein are found. However, the phylogenetic analysis (Figure 4) argues against recent gene duplication.

Variations of the number of genes encoding TBDTs in cyanobacteria

The results presented in Figures 3, 4, 5 and Table 1 show that the number of TBDTs varies among cyanobacteria. We found 22 TBDTs in Anabaena sp. PCC 7120, 10 in Anabaena variabilis, six in Synechococcus sp. PCC 7002, four in Synechocystis sp. PCC 6803, 33 in Gloeobacter violaceus, but no TBDTs in the genomes of, for example, Prochlorococcus). This variation of the number of genes, however, does not reflect an elevated amount of outer membrane protein coding genes in Anabaena sp. PCC 7120, because such a variation is not found for other outer membrane proteins (Omp85, TolC, OstA and others; not shown). Furthermore, in a previous report, a correlation of the number of TBDTs to the number of open reading frames as, for example, for transporters in the cytoplasmic membrane [129] was not observed [128], which is supported by our analysis (not shown).

TBDTs are regulated by TonB proteins. Hence, the large number of TBDTs leads to the question of whether each TBDT is regulated individually or (at least a sub-population of the TBDTs) in concert by one TonB protein. We, therefore, screened the genomes for the presence of tonB (Table 2). One to three tonB genes were detected. Hence, the number of TBDTs largely exceeds the number of TonB proteins. Please note that we identified a TonB-like protein (Slr1484) in Synechocystis sp. PCC 6803, which corrects a previous statement excluding the presence of a TonB-like protein in this species [130].

Expression of genes in Anabaena sp. coding for TBDTs

We analysed the gene expression of the 22 TDBT genes and of all2620, which only codes for the N-terminal portion of a TBDT (Figure 5A) in Anabaena sp. PCC 7120 (Figure 6). To this end, Anabaena sp. PCC 7120 was grown in normal medium (BG11), medium without iron (BG11-Fe), medium without copper (BG11-Cu) or medium lacking both (BG11-Fe-Cu). The presence of transcript was then determined by non-quantitative reverse transcription polymerase chain reaction (RT-PCR; primers are listed in Table 3). Iron and copper were chosen, because iron is known to be involved in the regulation of the gene expression of TBDTs and copper was recently found to induce an expression of a gene cluster involved in siderophore synthesis [131]. Remarkably, 13 TBDT-gene transcripts were present under normal growth conditions in such amounts that they could be amplified and visualized by RT-PCR (Figure 6A, lane 2; Figure 6C, grey lines and black dashed line). It should be noted that the absence of a transcript for the other genes might only reflect low transcript abundance. For 19 genes, we detected transcripts under Fe minus or/Cu minus conditions (Figure 6A lane 4, 6B, lane 1, 2). The analysis of the detection pattern revealed the following: (1) the genes all2148 and all2236, both hydroxamate-type TBDTs, were down-regulated upon iron and/or copper starvation compared to transcript levels under normal conditions; (2) the expression of seven genes (iutA-like genes alr2209 and alr2581, the btuB-like gene alr4028, the hutA-like gene alr3242 and the fhuA-like genes all2674, all4924 and alr2592) not detected under normal growth conditions is increased in response to copper, but not iron, limitation in the BG11 medium (Figure 6B, lane 1). This is notable, because, for four of these seven genes, the expression in the absence of one metal-ion (either Cu or Fe) is higher than in the absence of both iron and copper. One viuA-like gene (all4026) is expressed at a low level in BG11, but not in BG11 deficient of iron. An exclusive dependence of (upregulation of) expression in BG11 medium on iron limitation was only observed for alr0397 (iutA-like) and all2610 (fhuA-like).

Finally, we investigated the expression pattern of TDBTs under conditions enforcing heterocyst formation by growth in medium without a nitrogen source (BG110). We again analysed the amount of transcript in the four different media. Strikingly, in BG110 medium 17 genes are expressed (Figure 6A, lane 6, Figure 6C, black hemicircle) but seven of them are not expressed in BG11. Moreover, we found four genes - alr2153 and alr3242 (hutA-like),alr2626 and alr2185 (fhuA-like) - for which a transcript was detected only under additional metal starvation (BG110 -Fe, -Cu or -Fe/-Cu). Remarkably, all2620 is expressed under all conditions without a nitrogen source, which suggests that all2620 is not a pseudogene. In general, one can conclude that not only metal starvation but also nitrogen starvation induces transcription of TBDT-encoding genes in Anabaena sp. PCC 7120.

As only all5036 encodes a TonB-like protein in Anabaena sp. PCC 7120 we analysed its expression under the conditions outlined (Figure 7). As expected, all5036 transcript can be detected under all conditions tested. Assuming that the function of all identified TBDTs in Anabaena sp. depends on TonB, All5036 is required for iron homeostasis in general.

By clustering ~4,600 TBDTs we found that they group by their substrate and not according to their taxonomy with the exception of regions IX, XI, XIII and C. The latter are specific for sequences from bacteroidetes and ?-proteobacteria, respectively. Hence, the transported molecule dominates the sequence variation among TBDTs. According to the occurrence of expTBDTs within clusters, we were able to assign a tentative substrate for almost two-thirds of the analysed sequences. We have developed a website for a further detailed inspection of the clustering of individual sequences . Here, the individual clusters or sequences can be highlighted based on the presentation in Figure 2. However, the current assignment has to be viewed with care as Schauer and colleagues pointed out that further substrates might be discovered in future [128], which will then be introduced into the web interface. We identified several clusters of TBDTs with putatively so far unknown substrates. Further research on a few candidate proteins of each of these clusters would be of great interest, as it would significantly advance the knowledge on substrate uptake by bacteria on the protein level and it might also reveal new potential drug targets.

Large differences to previously suggested classifications were not observed for iron-transporting TBDTs. Generally, our approach resembles previous classifications of TBDTs according to their substrates based on a smaller number of sequences and a phylogenetic tree reconstruction [53,80,82,111,112], but the positioning of the IutA and of the ViuA sequences differs with respect to distances previously proposed [82,112]. In contrast to the report by LeVier and Guerinot who placed ViuA between the lactoferrin and transferrin recognizing transporters [82], we found that ViuA (sequence 74, Region VI) clearly clusters with FyuA (sequence 72) sequences. This discrepancy might reflect the fact that: (i) more sequences of TBDTs are available nowadays; and (ii) the methodology to analyse sequence relationships has improved.

A deviation from this general picture was found for the predicted BtuBs, which are spread over a long stripe from regions II to V. Hence, BtuBs might show a similar diffuse distribution pattern like the heme and hydroxamate transporters (regions I and V, respectively). The predicted BtuBs might, therefore, transport substrates only structurally related to cobalt-complexing vitamin B12.

TBDTs in Anabaena sp

Based on database searches, we have identified 25 sequences with TonB-box signature [39] leading to 22 sequences coding for putative TBDTs in Anabaena sp. PCC 7120 (Figures 3, 4, 5). Strikingly, at least five different types of transporters are identified (FhuA, ViuA, IutA, BtuB and HutA type) and this number greatly exceeds the number of genes coding for TBDTs of almost all other (sequenced) cyanobacteria with the exception of Gloeobacter violaceus. In turn, this is the only species for which some of the TBDTs could not be functionally assigned. As already discussed, it has been hypothesized that iron limitation might have been one of the selective forces in evolution of cyanobacteria. Gloeobacter violaceus (33 TBDTs) was isolated in 1972 from a calcareous rock near the Vierwaldst?ttersee in Switzerland, whereas Anabaena variablis (previously Anabaena flos-aquae strain A-37; 10 TBDTs) was isolated in 1964 from fresh water of the Mississippi, USA. Both strains are considered non-symbiotic. G. violaceus is rather unique with respect to the absence of thylakoid structure and does not form filaments [132] like Synechocystis sp. PCC 6803 (4 TBDTs), which was isolated from fresh water in California and deposited in the Pasteur collection in 1968 . Hence, the number of TBDTs does not correlate with filament or heterocyst formation. It might, however, correlate with the habitat from which the species were isolated, with respect to either species competition for iron or iron limitations in the environment per se. Therefore, symbiotic cyanobacteria such as Nostoc punctiforme may possibly contain a rather low number of TBDTs because iron is provided by the host. Unfortunately, to the best of our knowledge, the source of Anabaena sp. strain PCC 7120 - formerly named Nostoc muscorum ISU ([133]; further synonyms are Anabaena sp. ATCC 27893, Nostoc sp. strain PCC 7120) - is unknown and it is considered to be a 'free living cyanobacterium'. The observation that this cyanobacterium is susceptible to viruses isolated from the Lake Mendota, Dane County, Wisconsin, USA, [133] might suggest that a similar environment was its place of isolation. This would be in line with an original natural habitat of Anabaena sp. PCC 7120 that contained rather limited iron sources, because it has been reported that the iron concentration in rivers is higher than in lakes ([134]). The variety of TBDT classes found in Anabaena sp. rather agrees with iron limited environmental conditions. The only TBDT type which could not be identified in the analysed cyanobacterial species, in general, and, thereby, also in Anabaena sp. PCC 7120, is the FecA-type (diferric dicitrate) which can be found in many other bacteria. To date, schizokinen is the only confirmed siderophore which is secreted by Anabaena sp. PCC 7120 [27] and, recently, its transporter was identified [33]. However, additional siderophores are secreted by Anabaena sp. [33,131], but they have not yet been characterized. Nevertheless, other interpretations for the variable number of TBDTs might still be possible.

The environment influences the expression of TBDT genes in Anabaena sp

In line with iron limitation in the native environment, several differential expression regulation regimes have been observed. For instance, six out of 14 genes encoding hydroxamate recognizing FhuA-like transporters are expressed under (almost) all tested conditions (Figure 6C, grey and grey dashed line, Table 1). The same holds true for one BtuB-like transporter encoded by all3310, which is in accordance with its identification in a proteome analysis of cells grown under standard conditions [135,136]. Interestingly, the other BtuB-like transporter encoded by the joint gene all4028/all4029 is only expressed under iron-limiting conditions (Figure 6C, black dotted line). Furthermore, the iutA-like genes are always expressed under nitrogen-limiting conditions, whereas hutA-like genes are only expressed upon metal starvation (Figure 6C, black dashed dotted line). Also, for the gene encoding the schizokinen transporter SchT (Alr0397) only a moderate and intermediate influence of iron starvation on expression was observed [33]. The gene encoding the only putative catecholate transporter (All4026) appears to be expressed under non-limiting conditions as well as after nitrogen starvation. To our surprise, we did not observe a transcript under iron limitation but under copper limitation in BG11 or in the absence of both metals in BG11 and BG110. Such a clear relation to copper starvation was detected for four FhuA-type transporters as well (Figure 6C). The relation between the expression of genes encoding for TBDTs in Anabaena sp. and copper agrees with the recent observation that genes involved in siderophore production are also induced by copper starvation [131]. Nevertheless, the components of the network regulating the expression of TBDT encoding genes still need to be identified. Even though a complex network of TBDTs was discovered, only a single TonB protein was found in 58% of Gram-negative bacteria [137]. The gene is expressed under all tested conditions and, hence, it has to be considered as a master 'regulator' of the large group of TBDTs.

Identification of TonB-dependent transporters

Ninety-eight TBDT sequences were extracted from the NCBI database after extensive literature search. For 67 of them, experimental data is available, but for four of them the substrate is still unknown. Information on predicted substrates for the remaining 27 is available (see Additional file 1, [14-19,22,34-124]). These predictions are based on co-localization with genes of a specific metabolic pathway or on co-regulation by either transcription factors or a riboswitch [128]. Moreover, we downloaded 686 completely sequenced eubacterial genomes from the NCBI ftp server that were available in June 2008. In order to locate putative TBDTs in the genomes, we searched for open reading frames containing the TBDT ?-barrel domain and the plug domain. To this end, we used hmmsearch (hidden Markov model search) from the hmmer package and the profile hidden Markov models PF00593 and PF07715 provided by the PFAM database [138,139]. The hmmsearch output-files were parsed considering only hits with an E-value < 10-10. We used only sequences for further analysis that resulted in a significant hit for both domains.

Phylogenetic analysis and clustering

The 97 cyanobacterial TBDT sequences were aligned with MAFFT [140] and a maximum likelihood tree was constructed with IQPNNI v3.3.b4 [141]. As a substitution model we selected VT [142] with gamma-distributed rate heterogeneity. Support values were calculated from 1000 bootstrap replicates. The consensus tree was reconstructed with Tree-Puzzle v5.2 [143] applying the majority consensus rule. The program CLANS [144] was used to cluster the 4648 putative TBDTs detected in the complete genomes, and to visualize their degree of similarity. In CLANS we set the cut off such that only P-values < 10-10 obtained by pairwise BLASTs were used for the CLANS-clustering. In the context of this manuscript, we use the term 'cluster' to refer to an aggregation of sequences. Each sequence in a cluster has at least one correspondent within the cluster with a BLAST p-value < 10-90 leading to 195 clusters with at least two elements.

To further elucidate the relationship of the 195 clusters, we ran CLANS 100 times with a random initial configuration of the sequences in 3d space. In each run we determined the cluster centres and computed pair-wise distances between the centres. With the PHYLIP package v3.68 [145] we constructed a neighbour-joining tree for the resulting 100 distance matrices and we inferred the majority rule consensus tree with support values for the splits in the consensus tree.

Genome loci of TonB-dependent transporters in Anabaena sp. PCC 7120

The annotations of genes upstream and downstream of the TBDT loci, shown in Figure 5, were done manually.

Analysis of the operon structure

Genomic DNA of Anabaena sp. was isolated as described [146]. The intergenic sequences between all2619 and all2620 and between alr4028 and alr4029, respectively, and additional ~250 bp inside each flanking gene were amplified with 5' Prime PCR Extender Polymerase (5' Prime, Hamburg, Germany) according to the manufacturer's protocol. The PCR product was cloned into pCR2.1 (Invitrogen, Karlsruhe, Germany), transformed into DH5? (GibcoBRL, Eggenstein, Deutschland) and the resulting plasmids purified for sequencing.

RNA isolation and analysis

Total RNA was isolated from 50 ml cells of log phase cultures (OD750 ? 2) as described [147]. RT-PCRs were performed according to the protocol of the Invitrogen SuperScript? III First-Strand Synthesis System for Random Hexamer Primers (Invitrogen, Carlsbad, USA). The used oligonucleotides are listed in Table 3.

Hmmsearch: hidden Markov model search; LbpA: lactoferrin-binding protein A; RT-PCR: reverse transcription polymerase chain reaction; TbpA: transferrin-binding protein A; TBDT: TonB-dependent transporter; expTBDT: experimentally characterized TBDT; pTBDT: TBDT with predicted substrate.

Authors' contributions

The idea and strategy were developed by ES and AvH. OM and SS performed database searches and bioinformatic analyses. Laboratory experiments were performed by KN. ES drafted the manuscript, which was finalized by AvH and ES. All authors read and approved the final manuscript.

Supplementary Material Additional file 1

List of experimentally characterized TBDTs and of TBDTs with predicted substrate used for classification.

Click here for additional data file (1741-7007-7-68-S1.PDF)

Additional file 2

Number of TBDTs detected in analyzed genomes.

Click here for additional data file (1741-7007-7-68-S2.PDF)

Financial support from the Deutsche Forschungsgemeinschaft (DFG, SFBTR1-C7, SFBTR1-A10) and the Volkswagenstiftung to ES, from Wiener Wissenschafts-, Forschung- und Technologiefonds (WWTF) and Deutsche Forschungsgemeinschaft (DFG, SPP 1174) to AvH is acknowledged.

Adams DG,Duggan PS. Heterocyst and akinete differentiation in cyanobacteriaNew Phytol 1999;144:3–33.
Kustka A,Carpenter EJ,Sanudo-Wilhelmy SA. Iron and marine nitrogen fixation: progress and future directionsRes Microbiol 2002;153:255–262. [pmid: 12160315]
Shcolnick S,Keren N. Metal homeostasis in cyanobacteria and chloroplasts. Balancing benefits and risks to the photosynthetic apparatusPlant Physiol 2006;141:805–810. [pmid: 16825338]
Keren N,Aurora R,Pakrasi HB. Critical roles of bacterioferritins in iron storage and proliferation of cyanobacteriaPlant Physiol 2004;135:1666–1673. [pmid: 15247377]
Roger PA,Tirol A,Ardales S,Watanabe I. Chemical composition of cultures and natural samples of N2-fixing blue-green algae from rice fieldsBiol Fertil Solis 1986;2:131–146.
Ting CS,Rocap G,King J,Chisholm SW. Cyanobacterial photosynthesis in the oceans: the origins and significance of divergent light-harvesting strategiesTrends Microbiol 2002;10:134–142. [pmid: 11864823]
Ferreira F,Straus NA. Iron deprivation in cyanobacteriaJ Appl Phyc 1994;6:199–210.
Wandersman C,Delepelaire P. Bacterial iron sources: from siderophores to hemophoresAnnu Rev Microbiol 2004;58:611–647. [pmid: 15487950]
Miethke M,Marahiel MA. Siderophore-based iron acquisition and pathogen controlMicrobiol Mol Biol Rev 2007;71:413–451. [pmid: 17804665]
Andrews SC,Robinson AK,Rodriguez-Quinones F. Bacterial iron homeostasisFEMS Microbiol Rev 2003;27:215–237. [pmid: 12829269]
Gumbart J,Wiener MC,Tajkhorshid E. Mechanics of FORCE PROPAGATION in TonB-dependent outer membrane transportBiophys J 2007;93:496–504. [pmid: 17449669]
Clarke TE,Tari LW,Vogel HJ. Structural biology of bacterial iron uptake systemsCurr Top Med Chem 2001;1:7–30. [pmid: 11895294]
Lee BC. Quelling the red menace: haem capture by bacteriaMol Microbiol 1995;18:383–390. [pmid: 8748023]
Schauer K,Gouget B,Carri?re M,Labigne A,de Reuse H. Novel nickel transport mechanism across the bacterial outer membrane energized by the TonB/ExbB/ExbD machineryMol Microbiol 2007;63:1054–1068. [pmid: 17238922]
Blanvillain S,Meyer D,Boulanger A,Lautier M,Guynet C,Denanc? N,Vasse J,Lauber E,Arlat M. Plant carbohydrate scavenging through tonb-dependent receptors: a feature shared by phytopathogenic and aquatic bacteriaPLoS ONE 2007;2:e224. [pmid: 17311090]
Neugebauer H,Herrmann C,Kammer W,Schwarz G,Nordheim A,Braun V. ExbBD-dependent transport of maltodextrins through the novel MalA protein across the outer membrane of Caulobacter crescentusJ Bacteriol 2005;187:8300–8311. [pmid: 16321934]
Cheng Q,Yu MC,Reeves AR,Salyers AA. Identification and characterization of a Bacteroides gene, csuF, which encodes an outer membrane protein that is essential for growth on chondroitin sulfateJ Bacteriol 1995;177:3721–3727. [pmid: 7601836]
Reeves AR,D'Elia JN,Frias J,Salyers AA. A Bacteroides thetaiotaomicron outer membrane protein that is essential for utilization of maltooligosaccharides and starchJ Bacteriol 1996;178:823–830. [pmid: 8550519]
Nagano K,Murakami Y,Nishikawa K,Sakakibara J,Shimozato K,Yoshimura F. Characterization of RagA and RagB in Porphyromonas gingivalis: study using gene-deletion mutantsJ Med Microbiol 2007;56:1536–1548. [pmid: 17965357]
Braun V,Killmann H. Bacterial solutions to the iron-supply problemTrends Biochem Sci 1999;24:104–109. [pmid: 10203757]
Cartron ML,Maddocks S,Gillingham P,Craven CJ,Andrews SC. Feo-transport of ferrous iron into bacteriaBiometals 2006;19:143–157. [pmid: 16718600]
Perkins-Balding D,Ratliff-Griffin M,Stojiljkovic I. Iron transport systems in Neisseria meningitidisMicrobiol Mol Biol Rev 2004;68:154–171. [pmid: 15007100]
Ferguson AD,Deisenhofer J. TonB-dependent receptors-structural perspectivesBiochim Biophys Acta 2002;1565:318–332. [pmid: 12409204]
Katoh H,Hagino N,Grossman AR,Ogawa T. Genes essential to iron transport in the cyanobacterium Synechocystis sp. strain PCC 6803J Bacteriol 2001;183:2779–2784. [pmid: 11292796]
Singh AK,McIntyre LM,Sherman LA. Microarray analysis of the genome-wide response to iron deficiency and iron reconstitution in the cyanobacterium Synechocystis sp. PCC 6803Plant Physiol 2003;132:1825–1839. [pmid: 12913140]
Simpson FB,Neilands JB. Siderochromes in cyanophyceae: isolation and characterization of schizokinen from Anabaena spJ Phycol 1976;12:44–48.
Goldman SJ,Lammers PJ,Berman MS,Sanders-Loehr J. Siderophore-mediated iron uptake in different strains of Anabaena spJ Bacteriol 1983;156:1144–1150. [pmid: 6227608]
Clarke SE,Stuart J,Sanders-Loehr J. Induction of siderophore activity in Anabaena spp. and its moderation of copper toxicityAppl Environ Microbiol 1987;53:917–922. [pmid: 2955743]
Massalski A,Laube VM,Kushner DJ. Effects of cadmium and copper on the ultrastructure of Ankistrodesmus braunii and Anabaena 7120Microbial Ecol 1981;7:183–189.
Guikema JA,Sherman LA. Organization and function of chlorophyll in membranes of cyanobacteria during iron starvationPlant Physiol 1983;73:250–256. [pmid: 16663203]
Hutber GN,Hutson KG,Rogers LJ. Effect of iron deficiency on levels of two ferredoxins and flavodoxin in a cyanobacteriumFEMS Microbiol Lett 1977;1:193–196.
Latifi A,Jeanjean R,Lemeille S,Havaux M,Zhang CC. Iron starvation leads to oxidative stress in Anabaena sp. strain PCC 7120J Bacteriol 2005;187:6596–6598. [pmid: 16159797]
Nicolaisen K,Moslavac S,Samborski A,Valdebenito M,Hantke K,Maldener I,Muro-Pastor AM,Flores E,Schleiff E. Alr0397 is an outer membrane transporter for the siderophore schizokinen in Anabaena sp. strain PCC 7120J Bacteriol 2008;190:7500–7507. [pmid: 18805987]
Yoneyama H,Nakae T. Protein C (OprC) of the outer membrane of Pseudomonas aeruginosa is a copper-regulated channel proteinMicrobiol 1996;142:2137–2144.
Beall B,Sanden GN. A Bordetella pertussis fepA homologue required for utilization of exogenous ferric enterobactinMicrobiol 1995;141:3193–3205.
Pollack JR,Neilands JB. Enterobactin, an iron transport compound from Salmonella typhimuriumBiochem Biophys Res Commun 1970;38:989–992. [pmid: 4908541]
Ochsner UA,Johnson Z,Vasil ML. Genetics and regulation of two distinct haem-uptake systems, phu and has, in Pseudomonas aeruginosaMicrobiol 2000;146:185–198.
Dean CR,Poole K. Cloning and characterization of the ferric enterobactin receptor gene (pfeA) of Pseudomonas aeruginosaJ Bacteriol 1993;175:317–324. [pmid: 8419284]
Lundrigan MD,Kadner RJ. Nucleotide sequence of the gene for the ferrienterochelin receptor FepA in Escherichia coli. Homology among outer membrane receptors that interact with TonBJ Biol Chem 1986;261:10797–10801. [pmid: 3015941]
Hantke K,Nicholson G,Rabsch W,Winkelmann G. Salmochelins, siderophores of Salmonella enterica and uropathogenic Escherichia coli strains, are recognized by the outer membrane receptor IroNProc Natl Acad Sci USA 2003;100:3677–3682. [pmid: 12655053]
Bister B,Bischoff D,Nicholson GJ,Valdebenito M,Schneider K,Winkelmann G,Hantke K,S?ssmuth RD. The structure of salmochelins: C-glucosylated enterobactins of Salmonella entericaBiometals 2004;17:471–481. [pmid: 15259369]
Carswell CL,Rigden MD,Baenziger JE. Expression, purification, and structural characterization of CfrA, a putative iron transporter from Campylobacter jejuniJ Bacteriol 2008;190:5650–5662. [pmid: 18556796]
Nau CD,Konisky J. Evolutionary relationship between the TonB-dependent outer membrane transport proteins: nucleotide and amino acid sequences of the Escherichia coli colicin I receptor geneJ Bacteriol 1989;171:1041–1047. [pmid: 2644220]
Hantke K. Dihydroxybenzoylserine - a siderophore for E. coliFEMS Microbiol Lett 1990;67:5–8. [pmid: 2139424]
Goldberg MB,Boyko SA,Butterton JR,Stoebner JA,Payne SM,Calderwood SB. Characterization of a Vibrio cholerae virulence factor homologous to the family of TonB-dependent proteinsMol Microbiol 1992;6:2407–2418. [pmid: 1406279]
Beall B,Hoenes T. An iron-regulated outer-membrane protein specific to Bordetella bronchiseptica and homologous to ferric siderophore receptorsMicrobiol 1997;143:135–145.
Mey AR,Payne SM. Haem utilization in Vibrio cholerae involves multiple TonB-dependent haem receptorsMol Microbiol 2001;42:835–849. [pmid: 11722746]
Henderson DP,Payne SM. Characterization of the Vibrio cholerae outer membrane heme transport protein HutA: sequence of the gene, regulation of expression, and homology to the family of TonB-dependent proteinsJ Bacteriol 1994;176:3269–3277. [pmid: 8195082]
Mazoy R,Osorio CR,Toranzo AE,Lemos ML. Isolation of mutants of Vibrio anguillarum defective in haeme utilisation and cloning of huvA, a gene coding for an outer membrane protein involved in the use of haeme as iron sourceArch Microbiol 2003;179:329–338. [pmid: 12647036]
Lewis LA,Gray E,Wang YP,Roe BA,Dyer DW. Molecular characterization of hpuAB, the haemoglobin-haptoglobin-utilization operon of Neisseria meningitidisMol Microbiol 1997;23:737–749. [pmid: 9157245]
Stojiljkovic I,Hwa V,de Saint Martin L,O'Gaora P,Nassif X,Heffron F,So M. The Neisseria meningitidis haemoglobin receptor: its role in iron utilization and virulenceMol Microbiol 1995;15:531–541. [pmid: 7783623]
Srikumar R,Mikael LG,Pawelek PD,Khamessan A,Gibbs BF,Jacques M,Coulton JW. Molecular cloning of haemoglobin-binding protein HgbA in the outer membrane of Actinobacillus pleuropneumoniaeMicrobiol 2004;150:1723–1734.
Stojiljkovic I,Hantke K. Hemin uptake system of Yersinia enterocolitica : similarities with other TonB-dependent systems in gram-negative bacteriaEMBO J 1992;11:4359–4367. [pmid: 1425573]
Hornung JM,Jones HA,Perry RD. The hmu locus of Yersinia pestis is essential for utilization of free haemin and haem-protein complexes as iron sourcesMol Microbiol 1996;20:725–739. [pmid: 9026634]
Torres AG,Payne SM. Haem iron-transport system in enterohaemorrhagic Escherichia coli O157:H7Mol Microbiol 1997;23:825–833. [pmid: 9157252]
Mills M,Payne SM. Identification of shuA, the gene encoding the heme receptor of Shigella dysenteriae, and analysis of invasion and intracellular multiplication of a shuA mutantInfect Immun 1997;65:5358–5363. [pmid: 9393841]
Cope LD,Yogev R,M?ller-Eberhard U,Hansen EJ. A gene cluster involved in the utilization of both free heme and heme:hemopexin by Haemophilus influenzae type bJ Bacteriol 1995;177:2644–2653. [pmid: 7751272]
Thomas CE,Olsen B,Elkins C. Cloning and characterization of tdhA, a locus encoding a TonB-dependent heme receptor from Haemophilus ducreyiInfect Immun 1998;66:4254–4262. [pmid: 9712775]
Letoffe S,Ghigo JM,Wandersman C. Iron acquisition from heme and hemoglobin by a Serratia marcescens extracellular proteinProc Natl Acad Sci USA 1994;91:9876–9880. [pmid: 7937909]
Furano K,Luke NR,Howlett AJ,Campagnari AA. Identification of a conserved Moraxella catarrhalis haemoglobin-utilization protein, MhuAMicrobiol 2005;151:1151–1158.
Carson SD,Klebba PE,Newton SM,Sparling PF. Ferric enterobactin binding and utilization by Neisseria gonorrhoeaeJ Bacteriol 1999;181:2895–2901. [pmid: 10217784]
Mey AR,Wyckoff EE,Oglesby AG,Rab E,Taylor RK,Payne SM. Identification of the Vibrio cholerae enterobactin receptors VctA and IrgA: IrgA is not required for virulenceInfect Immun 2002;70:3419–3426. [pmid: 12065481]
Biswas GD,Sparling PF. Characterization of lbpA, the structural gene for a lactoferrin receptor in Neisseria gonorrhoeaeInfect Immun 1995;63:2958–2967. [pmid: 7622218]
Cornelissen CN,Biswas GD,Tsai J,Paruchuri DK,Thompson SA,Sparling PF. Gonococcal transferrin-binding protein 1 is required for transferrin utilization and is homologous to TonB-dependent outer membrane receptorsJ Bacteriol 1992;174:5788–5797. [pmid: 1325963]
Heller K,Kadner RJ. Nucleotide sequence of the gene for the vitamin B12 receptor protein in the outer membrane of Escherichia coliJ Bacteriol 1985;161:904–908. [pmid: 3882670]
Rodionov DA,Vitreschak AG,Mironov AA,Gelfand MS. Comparative genomics of the vitamin B12 metabolism and regulation in prokaryotesJ Biol Chem 2003;278:41148–41159. [pmid: 12869542]
Silakowski B,Kunze B,Nordsiek G,Bl?cker H,H?fle G,M?ller R. The myxochelin iron transport regulon of the myxobacterium Stigmatella aurantiaca Sg a15Eur J Biochem 2000;267:6476–6485. [pmid: 11029592]
Kunze B,Bedorf N,Kohl W,H?fle G,Reichenbach H. Myxochelin A, a new iron-chelating compound from Angiococcus disciformis (Myxobacterales). Production, isolation, physico-chemical and biological propertiesJ Antibiot (Tokyo) 1989;42:14–17. [pmid: 2493439]
Krone WJA,Stegehuis F,Koningstein G,van Doorn C,Roosendaal B,de Graaf FK,Oudega B. Characterization of the pColV-K30 encoded cloacin DF13/aerobactin outer membrane receptor protein of Escherichia coli ; isolation and purification of the protein and analysis of its nucleotide sequence and primary structureFEMS Microbiol Lett 1985;26:153–161.
Gibson F,Magrath DI. The isolation and characterization of a hydroxamic acid (aerobactin) formed by Aerobacter aerogenes 62-IBiochim Biophys Acta 1969;192:175–184. [pmid: 4313071]
Lynch D,O'Brien J,Welch T,Clarke P,Cuiv PO,Crosa JH,O'Connell M. Genetic organization of the region encoding regulation, biosynthesis, and transport of rhizobactin 1021, a siderophore produced by Sinorhizobium melilotiJ Bacteriol 2001;183:2576–2585. [pmid: 11274118]
Persmark M,Pittman P,Buyer JS,Schwyn B,Gill PR,Neilands JB. Isolation and structure of rhizobactin 1021, a siderophore from the alfalfa symbiont Rhizobium meliloti 1021J Am Chem Soc 1993;115:3950–3956.
K?hn S,Braun V,K?ster W. Ferric rhizoferrin uptake into Morganella morganii : characterization of genes involved in the uptake of a polyhydroxycarboxylate siderophoreJ Bacteriol 1996;178:496–504. [pmid: 8550472]
Drechsel H,Metzger J,Freund S,Jung G,Boelaert JR,Winkelmann G. Rhizoferrin -- a novel siderophore from the fungus Rhizopus microsporus var. rhizopodiformisBioMetals 1991;4:238–243.
Pressler U,Staudenmaier H,Zimmermann L,Braun V. Genetics of the iron dicitrate transport system of Escherichia coliJ Bacteriol 1988;170:2716–2724. [pmid: 2836368]
Ferguson AD,Chakraborty R,Smith BS,Esser L,Helm D van der,Deisenhofer J. Structural basis of gating by the outer membrane transporter FecAScience 2002;295:1715–1719. [pmid: 11872840]
Mey AR,Wyckoff EE,Hoover LA,Fisher CR,Payne SM. Vibrio cholerae VciB promotes iron uptake via ferrous iron transportersJ Bacteriol 2008;190:5953–5962. [pmid: 18586940]
Ochsner UA,Vasil ML. Gene repression by the ferric uptake regulator in Pseudomonas aeruginosa : cycle selection of iron-regulated genesProc Natl Acad Sci USA 1996;93:4409–4414. [pmid: 8633080]
Cox CD,Rinehart KL Jr,Moore ML,Cook JC Jr. Pyochelin: novel structure of an iron-chelating growth promoter for Pseudomonas aeruginosaProc Natl Acad Sci USA 1981;78:4256–4260. [pmid: 6794030]
B?umler AJ,Hantke K. Ferrioxamine uptake in Yersinia enterocolitica : characterization of the receptor protein FoxAMol Microbiol 1992;6:1309–1321. [pmid: 1640832]
Keller-Schierlein W,Prelog V. Stoffwechselprodukte von Actinomyceten. 29. Mitteilung. Die Konstitution des Ferrioxamins D1Helv Chim Acta 1961;44:709–713.
LeVier K,Guerinot ML. The Bradyrhizobium japonicum fegA gene encodes an iron-regulated outer membrane protein with similarity to hydroxamate-type siderophore receptorsJ Bacteriol 1996;178:7265–7275. [pmid: 8955412]
Sauvage C,Franza T,Expert D. Analysis of the Erwinia chrysanthemi ferrichrysobactin receptor gene: resemblance to the Escherichia coli fepA-fes bidirectional promoter region and homology with hydroxamate receptorsJ Bacteriol 1996;178:1227–1231. [pmid: 8576065]
Persmark M,Expert D,Neilands JB. Isolation, characterization, and synthesis of chrysobactin, a compound with siderophore activity from Erwinia chrysanthemiJ Biol Chem 1989;264:3187–3193. [pmid: 2914949]
Alice AF,L?pez CS,Lowe CA,Ledesma MA,Crosa JH. Genetic and transcriptional analysis of the siderophore malleobactin biosynthesis and transport genes in the human pathogen Burkholderia pseudomallei K96243J Bacteriol 2006;188:1551–1566. [pmid: 16452439]
Yang HM,Chaowagul W,Sokol PA. Siderophore production by Pseudomonas pseudomalleiInfect Immun 1991;59:776–780. [pmid: 1825486]
Sokol PA,Darling P,Lewenza S,Corbett CR,Kooi CD. Identification of a siderophore receptor required for ferric ornibactin uptake in Burkholderia cepaciaInfect Immun 2000;68:6554–6560. [pmid: 11083764]
Stephan H,Freund S,Beck W,Jung G,Meyer JM,Winkelmann G. Ornibactins--a new family of siderophores from pseudomonasBiometals 1993;6:93–100. [pmid: 7689374]
Coulton JW,Mason P,Cameron DR,Carmel G,Jean R,Rode HN. Protein fusions of beta-galactosidase to the ferrichrome-iron receptor of Escherichia coli K-12J Bacteriol 1986;165:181–192. [pmid: 3079747]
Zalkin A,Forrester JD,Templeton DH. Crystal and molecular structure of ferrichrome AScience 1964;146:261–263. [pmid: 17743711]
Llamas MA,Sparrius M,Kloet R,Jim?nez CR,Vandenbroucke-Grauls C,Bitter W. The heterologous siderophores ferrioxamine B and ferrichrome activate signaling pathways in Pseudomonas aeruginosaJ Bacteriol 2006;188:1882–1891. [pmid: 16484199]
Pradel E,Locht C. Expression of the putative siderophore receptor gene bfrZ is controlled by the extracytoplasmic-function sigma factor BupI in Bordetella bronchisepticaJ Bacteriol 2001;183:2910–2917. [pmid: 11292812]
Brito B,Aldon D,Barberis P,Boucher C,Genin S. A signal transfer system through three compartments transduces the plant cell contact-dependent signal controlling Ralstonia solanacearum hrp genesMol Plant Microbe Interact 2002;15:109–119. [pmid: 11876423]
Morris J,Donnelly DF,O'Neill E,McConnell F,O'Gara F. Nucleotide sequence analysis and potential environmental distribution of a ferric pseudobactin receptor gene of Pseudomonas sp. strain M114Mol Gen Genet 1994;242:9–16. [pmid: 8277948]
Teintze M,Leong J. Structure of pseudobactin A, a second siderophore from plant growth promoting Pseudomonas B10Biochemistry 1981;20:6457–6462. [pmid: 7306519]
Poole K,Neshat S,Krebes K,Heinrichs DE. Cloning and nucleotide sequence analysis of the ferripyoverdine receptor gene fpvA of Pseudomonas aeruginosaJ Bacteriol 1993;175:4597–4604. [pmid: 8335619]
Philson SB,Llin?s M. Siderochromes from Pseudomonas fluorescens. II. Structural homology as revealed by NMR spectroscopyJ Biol Chem 1982;257:8086–8090. [pmid: 6211451]
Bitter W,Marugg JD,de Weger LA,Tommassen J,Weisbeek PJ. The ferric-pseudobactin receptor PupA of Pseudomonas putida WCS358: homology to TonB-dependent Escherichia coli receptors and specificity of the proteinMol Microbiol 1991;5:647–655. [pmid: 1646376]
Koster M,Vossenberg J van de,Leong J,Weisbeek PJ. Identification and characterization of the pupB gene encoding an inducible ferric-pseudobactin receptor of Pseudomonas putida WCS358Mol Microbiol 1993;8:591–601. [pmid: 8392140]
Brickman TJ,Armstrong SK. Essential role of the iron-regulated outer membrane receptor FauA in alcaligin siderophore-mediated iron uptake in Bordetella speciesJ Bacteriol 1999;181:5958–5966. [pmid: 10498707]
Nishio T,Tanaka N,Hiratake J,Katsube Y,Ishida Y,Oda J. Isolation and structure of the novel dihydroxamate siderophore alcaliginJ Am Chem Soc 1988;110:8733–8734.
Sauer M,Hantke K,Braun V. Sequence of the fhuE outer-membrane receptor gene of Escherichia coli K12 and properties of mutantsMol Microbiol 1990;4:427–437. [pmid: 2162465]
Atkin CL,Neilands JB. Rhodotorulic acid, a diketopiperazine dihydroxamic acid with growth-factor activity. I. Isolation and characterizationBiochemistry 1968;7:3734–3739. [pmid: 4971459]
Charlang G,Ng B,Horowitz NH,Horowitz RM. Cellular and extracellular siderophores of Aspergillus nidulans and Penicillium chrysogenumMol Cell Biol 1981;1:94–100. [pmid: 6242827]
Dhungana S,White PS,Crumbliss AL. Crystal structure of ferrioxamine B: a comparative analysis and implications for molecular recognitionJ Biol Inorg Chem 2001;6:810–818. [pmid: 11713688]
Ankenbauer RG,Quan HN. FptA, the Fe(III)-pyochelin receptor of Pseudomonas aeruginosa : a phenolate siderophore receptor homologous to hydroxamate siderophore receptorsJ Bacteriol 1994;176:307–319. [pmid: 8288523]
Rodionov DA,Vitreschak AG,Mironov AA,Gelfand MS. Comparative genomics of thiamin biosynthesis in procaryotes. New genes and regulatory mechanismsJ Biol Chem 2002;277:48949–48959. [pmid: 12376536]
Actis LA,Tolmasky ME,Farrell DH,Crosa JH. Genetic and molecular characterization of essential components of the Vibrio anguillarum plasmid-mediated iron-transport systemJ Biol Chem 1988;263:2853–2860. [pmid: 2830268]
Wuest WM,Sattely ES,Walsh CT. Three siderophores from one bacterial enzymatic assembly lineJ Am Chem Soc 2009;131:5056–5057. [pmid: 19320483]
Dorsey CW,Tomaras AP,Connerly PL,Tolmasky ME,Crosa JH,Actis LA. The siderophore-mediated iron acquisition systems of Acinetobacter baumannii ATCC 19606 and Vibrio anguillarum 775 are structurally and functionally relatedMicrobiol 2004;150:3657–3667.
Koebnik R,Hantke K,Braun V. The TonB-dependent ferrichrome receptor FcuA of Yersinia enterocolitica : evidence against a strict co-evolution of receptor structure and substrate specificityMol Microbiol 1993;7:383–393. [pmid: 8384682]
Rakin A,Saken E,Harmsen D,Heesemann J. The pesticin receptor of Yersinia enterocolitica : a novel virulence factor with dual functionMol Microbiol 1994;13:253–263. [pmid: 7984105]
Drechsel H,Stephan H,Lotz R,Haag H,Z?hner H,Hantke K,Jung G. Structure elucidation of yersiniabactin, a siderophore from highly virulent Yersinia strainsLiebigs Annalen 1995;10:1727–1733.
Fetherston JD,Lillard JW Jr,Perry RD. Analysis of the pesticin receptor from Yersinia pestis : role in iron-deficient growth and possible regulation by its siderophoreJ Bacteriol 1995;177:1824–1833. [pmid: 7896707]
Butterton JR,Stoebner JA,Payne SM,Calderwood SB. Cloning, sequencing, and transcriptional regulation of viuA, the gene encoding the ferric vibriobactin receptor of Vibrio choleraeJ Bacteriol 1992;174:3729–3738. [pmid: 1317381]
Griffiths GL,Sigel SP,Payne SM,Neilands JB. Vibriobactin, a siderophore from Vibrio choleraeJ Biol Chem 1984;259:383–385. [pmid: 6706943]
Kahnert A,Kertesz MA. Characterization of a sulfur-regulated oxygenative alkylsulfatase from Pseudomonas putida S-313J Biol Chem 2000;275:31661–31667. [pmid: 10913158]
Rodionov DA,Hebbeln P,Gelfand MS,Eitinger T. Comparative and functional genomic analysis of prokaryotic nickel and cobalt uptake transporters: evidence for a novel group of ATP-binding cassette transportersJ Bacteriol 2006;188:317–327. [pmid: 16352848]
Hoffman P,Linker A,Lippman V,Meyer K. The structure of chondroitin sulfate B from studies with Flavobacterium enzymesJ Biol Chem 1960;235:3066–3069. [pmid: 13715032]
Atkins ED,Sheehan JK. The molecular structure of hyaluronic acidBiochem J 1971;125:92.
Wei B,Dalwadi H,Gordon LK,Landers C,Bruckner D,Targan SR,Braun J. Molecular cloning of a Bacteroides caccae TonB-linked outer membrane protein identified by an inflammatory bowel disease marker antibodyInfect Immun 2001;69:6044–6054. [pmid: 11553542]
Yang C,Rodionov DA,Li X,Laikova ON,Gelfand MS,Zagnitko OP,Romine MF,Obraztsova AY,Nealson KH,Osterman AL. Comparative genomics and experimental characterization of N-acetylglucosamine utilization pathway of Shewanella oneidensisJ Biol Chem 2006;281:29872–29885. [pmid: 16857666]
Karlsen S,Hough E. Crystal structures of three complexes between chito-oligosaccharides and lysozyme from the rainbow trout. How distorted is the NAG sugar in site D?Acta Crystallogr D Biol Crystallogr 1995;51:962–978. [pmid: 15299765]
Pauer H,Ferreira Ede O,dos Santos-Filho J,Portela MB,Zingali RB,Soares RM,Domingues RM. A TonB-dependent outer membrane protein as a Bacteroides fragilis fibronectin-binding moleculeFEMS Immunol Med Microbiol 2009;55:388–395. [pmid: 19187219]
Koebnik R. TonB-dependent trans-envelope signalling: the exception or the rule?Trends Microbiol 2005;13:343–347. [pmid: 15993072]
Beucher M,Sparling PF. Cloning, sequencing, and characterization of the gene encoding FrpB, a major iron-regulated, outer membrane protein of Neisseria gonorrhoeaeJ Bacteriol 1995;177:2041–2049. [pmid: 7721696]
Mey AR,Payne SM. Haem utilization in Vibrio cholerae involves multiple TonB-dependent haem receptorsMol Microbiol 2001;42:835–849. [pmid: 11722746]
Schauer K,Rodionov DA,de Reuse H. New substrates for TonB-dependent transport: do we only see the 'tip of the iceberg'?Trends Biochem Sci 2008;33:330–338. [pmid: 18539464]
Ren Q,Paulsen IT. Comparative analyses of fundamental differences in membrane transport capabilities in prokaryotes and eukaryotesPLoS Comput Biol 2005;1:e27. [pmid: 16118665]
Huang F,Parmryd I,Nilsson F,Persson AL,Pakrasi HB,Andersson B,Norling B. Proteomics of Synechocystis sp. strain PCC 6803: identification of plasma membrane proteinsMol Cell Proteomics 2002;1:956–966. [pmid: 12543932]
Jeanjean R,Talla E,Latifi A,Havaux M,Janicki A,Zhang CC. A large gene cluster encoding peptide synthetases and polyketide synthases is involved in production of siderophores and oxidative stress response in the cyanobacterium Anabaena sp. strain PCC 7120Environ Microbiol 2008;10:2574–2585. [pmid: 18557768]
Guglielmi G,Cohen-Bazire G,Bryant DA. The structure of Gloeobacter violaceus and its phycobilisomesArch Microbiol 1981;129:181–189.
Adolph KW,Haselkorn R. Isolation and characterization of a virus infecting the blue-green alga Nostoc muscorumVirology 1971;46:200–208. [pmid: 4108613]
Dean WE,Neff BP,Rosenberry DO,Winter TC,Parkhurst R. The significance of ground water to the accumulation of iron and manganese in the sediments of two hydrologically distinct lakes in North-Central Minnesota: A geological perspectiveGround Water 2003;41:951–963.
Moslavac S,Bredemeier R,Mirus O,Granvogl B,Eichacker LA,Schleiff E. Proteomic analysis of the outer membrane of Anabaena sp. strain PCC 7120J Proteome Res 2005;4:1330–1338. [pmid: 16083284]
Moslavac S,Reisinger V,Berg M,Mirus O,Vosyka O,Pl?scher M,Flores E,Eichacker LA,Schleiff E. The proteome of the heterocyst cell wall in Anabaena sp. PCC 7120Biol Chem 2007;388:823–829. [pmid: 17655501]
Chu BC,Peacock RS,Vogel HJ. Bioinformatic analysis of the TonB protein familyBiometals 2007;20:467–483. [pmid: 17225063]
Finn RD,Tate J,Mistry J,Coggill PC,Sammut JS,Hotz HR,Ceric G,Forslund K,Eddy SR,Sonnhammer EL,Bateman A. The Pfam protein families databaseNucleic Acids Res 2008;36:D281–288. [pmid: 18039703]
Mistry J,Finn R. Pfam: a domain-centric method for analyzing proteins and proteomesMethods Mol Biol 2007;396:43–58. [pmid: 18025685]
Katoh K,Kuma K,Toh H,Miyata T. MAFFT version 5: improvement and accuracy of multiple sequence alignmentNucleic Acids Res 2005;33:511–518. [pmid: 15661851]
Minh BQ,Vinh LS,von Haeseler A,Schmidt HA. pIQPNNI -- Parallel reconstruction of large maximum likelihood phylogeniesBioinformatics 2005;21:3794–3796. [pmid: 16046495]
M?ller T,Vingron M. Modeling amino acid replacementJ Comput Biol 2000;7:761–776. [pmid: 11382360]
Schmidt HA,Strimmer K,Vingron M,von Haeseler A. Tree-Puzzle: maximum likelihood phylogenetic analysis using quartets and parallel computingBioinformatics 2002;18:502–504. [pmid: 11934758]
Frickey T,Lupas A. CLANS: a Java application for visualizing protein families based on pairwise similarityBioinformatics 2004;20:3702–3704. [pmid: 15284097]
Felsenstein J. PHYLIP - Phylogeny Inference Package (Version 3.2)Cladistics 1989;5:164–166.
Cai YP,Wolk CP. Use of a conditionally lethal gene in Anabaena sp. strain PCC 7120 to select for double recombinants and to entrap insertion sequencesJ Bacteriol 1990;172:3138–3145. [pmid: 2160938]
Valladares A,Muro-Pastor AM,Fillat MF,Herrero A,Flores E. Constitutive and nitrogen-regulated promoters of the petH gene encoding ferredoxin:NADP+ reductase in the heterocyst-forming cyanobacterium Anabaena spFEBS Lett 1999;449:159–164. [pmid: 10338123]
Kaneko T,Nakamura Y,Wolk CP,Kuritz T,Sasamoto S,Watanabe A,Iriguchi M,Ishikawa A,Kawashima K,Kimura T,Kishida Y,Kohara M,Matsumoto M,Matsuno A,Muraki A,Nakazaki N,Shimpo S,Sugimoto M,Takazawa M,Yamada M,Yasuda M,Tabata S. Complete genomic sequence of the filamentous nitrogen-fixing cyanobacterium Anabaena sp. strain PCC 7120DNA Res 2001;8:205–213. 227-253 [pmid: 11759840]

[Figure ID: F1]
Figure 1 

Clustering of the sequences of putative TonB-dependent transporters (TBDTs). The sequences found by the described genome-wide searches were analysed by CLANs as depicted. (A) shows the consensus tree of the pair-wise mean cluster distances. The branches are coloured according to their respective bootstrap value in shades of grey as indicated by the legend in the middle of the tree. The numbers at each leaf are of the format 'x_y', where 'x' is the cluster number and 'y' the number of sequences belonging to this cluster. We have further indicated the transported substrates and the regions as shown in Figure 1B are marked by I to XII and A to N. Brackets indicate that the metal ion is known, but the metallophore has not yet been identified. An asterisk marks predicted substrates. (B) shows the result of two-dimensional clustering in CLANS. The regions from Figure 1A are marked by red polygons (containing at least a single exp/pTBDT) and red circles (no functionally characterized TBDT). Sequences with a high similarity (P-value < 10-90) are connected by lines coloured in shades of grey (the darker the smaller the P-value). The regions shown in Figure 2 (grey dashed line) and Figure 3 (grey dashed-dotted line) are highlighted.

[Figure ID: F2]
Figure 2 

Distribution of the sequences of characterized (experimental/predicted) TonB-dependent transporters (TBDTs). The grey dashed frame from Figure 1B is shown here containing expTBDTs and pTBDTs, which are marked by colored symbols and a number, which corresponds to the numbering in column 1 (see Additional file 1, [14-19,22,34-124]). Symbols are used to enhance the readability of the figures and are explained on the bottom right. The dashed frames are shown in a magnified view on the bottom. Circles define regions without functionally characterized TBDTs. For regions XI and XII the substrates are indicated on the left. The region numbering is explained in the text.

[Figure ID: F3]
Figure 3 

Distribution of TonB-dependent transporters (TBDTs) found in genomes of cyanobacteria. Cyanobacterial sequences of TBDTs are highlighted and the containing frames are enlarged at the bottom. Dashed boxes indicate the dimensions shown in Figure 1. The colour code shows the different species as indicated in the right corner. The numbers are according to Table 1.

[Figure ID: F4]
Figure 4 

Distribution of cyanobacterial sequences. An alignment of sequences of TonB-dependent transporters listed in Table 1 was used to reconstruct a maximum likelihood phylogeny. Bootstrap values were calculated from 1000 phylogenetic trees. To indicate the probability of occurrence of an edge in these trees the edges are shown in shades of grey.

[Figure ID: F5]
Figure 5 

The genomic structure of the loci coding for TonB-dependent transporters (TBDTs) in Anabaena sp. PCC 7120. For A-C, the genomic structure was excised from Cyanobase ([148]) and the nomenclature of the colour code is given in C. White boxes indicate genes for which the name is given in the figure. (A) Shows the genomic orientation surrounding all2620 (top) and the sequencing profile of the region coding for the stop codon (in reverse orientation, bottom). (B) Shows the genomic orientation surrounding alr4028 (top) and the sequencing profile of the region coding for the stop codon (in reverse orientation, bottom). (C) The genomic organization surrounding the 22 other genes coding for TBDTs.

[Figure ID: F6]
Figure 6 

Iron-dependent expression of TonB-dependent transporters (TBDTs) of Anabaena sp. PCC 7120. (A) Anabaena sp. PCC 7120 were grown in media with (lane 1, 2, 5 and 6) and without a source of ferric ammonium citrate and copper (-Fe/-Cu, lane 3, 4, 7 and 8) as well as with (BG11, lane 1-4) and without a source of nitrogen (BG110, lane 5-8). RNA was isolated and RT-PCR was performed to visualize expression with (+) and without (-) addition of reverse transcriptase using primers listed in Table 3. The transcript of rnpB was amplified as control. (B)Anabaena sp. PCC 7120 were grown in media with (BG11, lane 1, 2) or without nitrogen source (BG110, lane 3, 4) in the absence of either copper sulfate (lane 1, 3) or ferric ammonium citrate (lane 2, 4) and RNA isolated from 50 ml cells of log phase cultures as described. RT-PCR was performed to visualize expression with and without addition of reverse transcriptase using primers listed in Table 3. (C) The results from A and B are visualized as bar code where black stands for detected expression, and white for no expression detected under conditions used. The order is given on the right (C stands for: pointing to the centre). The black outer circle marks all genes expressed in BG110, the black dashed line all genes expressed in BG11, the black dashed dotted line all genes not expressed without starvation and the dotted line the gene only weakly expressed upon copper limitation in BG11. The grey line on the outer rim indicates all genes always expressed, the grey dashed line on the outer rim all genes where expression was not detected under one condition and the grey dashed dotted line on the outer rim all genes which are expressed in BG11 and BG110, but not in all other media.

[Figure ID: F7]
Figure 7 

Expression of all5036 encoding the only TonB in Anabaena sp. PCC 7120. Anabaena sp. PCC 7120 were grown as for experiments shown in Figure 6 in BG11 (lane 1-4) or BG110 (lane 5-8) with and without a source of ferric ammonium citrate and/or copper and reverse transcription (RT) polymerase chain reaction was performed in the absence (-RT) or presence of reverse transcriptase on isolated RNA using primers for rnpB and all5036 (listed in Table 3) to visualize expression.

[TableWrap ID: T1] Table 1 

Sequences used for the phylogenetic analysis of cyanobacteria

Code Old New Spot Database code Species
Am1 B0127 BtuB BtuB 26 gi|158339996 Acaryochloris marina MBIC11017

Am1 3407 CirA HutA 3 gi|158336543

Am1 3358 CirA IutA 38 gi|158336494

Am1 A0170 CirA ViuA 50 gi|158339820

Am1 3383 CirA ViuA 49 gi|158336519

Am1 A0184 Fiu FhuA 58 gi|158339834

Am1 A0274 FhuE FhuA 57 gi|158339535

Am1 A0198 - FhuA 71 gi|158339845

Am1 A0157 FhuE FhuA 59 gi|158339807

Am1 3393 FhuE FhuA 72 gi|158336529

Am1 3398 - FhuA 65 gi|158336534

Am1 3403 Fiu FhuA 62 gi|158336539

Ava_B0148 FhuE FhuA 89 gi|75812430 Anabaena variabilis ATCC 29413

Ava_B0150 CirA FhuA 88 gi|75812432

Ava_B0159 BtuB FhuA 82 gi|75812441

Ava_B0185 CirA ViuA 46 gi|75812467

Ava_B0217 Fiu BtuB 23 gi|75812499

Ava_B0218 CirA IutA 42 gi|75812500

Ava_C0010 FhuE BtuB 27 gi|75812671

Ava_1672 CirA ViuA 47 gi|75907894

Ava_2840 CirA FhuA 83 gi|75909052

Ava_4967 BtuB FhuA 84 gi|75911163

cce3039 CirA FhuA 54 gi|172037952 Cyanothece sp. CCY0110

glr0280 CirA ? 7 gi|37519849 Gloeobacter violaceus PCC7421

gll0302 CirA IutA 41 gi|37519871

gll0311 - FhuA 81 gi|37519880

gll0313 - FhuA 56 gi|37519882

gll0319 - FhuA 63 gi|37519888

glr0327 CirA ViuA 48 gi|37519896

gll0331 FecA FhuA 69 gi|37519900

gll0343 CirA IutA 36 gi|37519912

glr0349 FhuE FhuA 95 gi|37519918

glr0353 - FhuA 76 gi|37519922

gll0361 FhuE FhuA 78 gi|37519930

gll0896 FepA BtuB 22 gi|37520465

gll1276 OMC BtuB 20 gi|37520845

glr1304 OMC BtuB 17 gi|37520873

glr1380 - - - gi|37520949

glr1385 - BtuB 18 gi|37520954

glr1386 CirA BtuB 15 gi|37520955

gll1452 BtuB BtuB 25 gi|37521021

glr1488 - BtuB 12 gi|37521057

glr1610 - ? 8 gi|37521179

glr1909 FhuE FhuA 73 gi|37521478

gll1962 - BtuB 16 gi|37521531

glr1973 BtuB BtuB 29 gi|37521542

gll1978 Fiu FhuA 93 gi|37521547

glr2051 FepA ? 10 gi|37521620

glr2116 BtuB BtuB 24 gi|37521685

gll3103 BtuB BtuB 11 gi|37522672

glr3352 OMCa BtuB 19 gi|37522921

gll3601 BtuB BtuB 14 gi|37523170

gll3680 BtuB ? 9 gi|37523249

gll3974 FhuE FhuA 77 gi|37523543

gll3976 CirA FhuA 75 gi|37523545

glr4296 CirA BtuB 13 gi|37523865

NpunF1172 - BtuB 33 gi|186681644 Nostoc punctiforme PCC73102

NpunF3454 - FhuA 94 gi|186683610

all1101 - FhuA 52 gi|17228596 Anabaena sp. PCC 7120

all2148 FhuE FhuA 66 gi|17229640

all2158 FhuE FhuA 53 gi|17229650

all2236 Fiu FhuA 87 gi|17229728

all2610 CirA FhuA 67 gi|17230102

all2674 Fiu FhuA 70 gi|17230166

all3310 BtuB BtuB 21 gi|17230802

all4026 CirA ViuA 45 gi|17231518

all4924 FhuE FhuA 61 gi|17232416

alr0397 CirA IutA 40 gi|17227893

alr2153 CirA HutA 4 gi|17229645

alr2175 - FhuA 69 gi|17229667

alr2185 Fiu FhuA 51 gi|17229677

alr2209 CirA IutA 44 gi|17229701

alr2211 CirA FhuA 90 gi|17229703

alr2581 CirA IutA 43 gi|17230073

alr2588 CirA FhuA 74 gi|17230080

alr2592 FhuE FhuA 91 gi|17230084

alr2596 FhuE FhuA 64 gi|17230088

alr2626 - FhuA 79 gi|17230118

alr3242 CirA HutA 5 gi|17230734

- BtuB 32 gi|17231520

sll1206 IutA IutA 39 gi|16329186 Synechocystis sp. PCC6803

sll1409 FhuA FhuA 80 gi|16329191

sll1406 FhuA FhuA 85 gi|16329194

slr1490 FhuA FhuA 68 gi|16329201

CYA_1108 BtuB BtuB 31 gi|86605797 Synechococcus sp.

CYA_2031 CirA HutA 1 gi|86606671

CYB_1330 BtuB BtuB 28 gi|86608804 Synechococcus sp.

CYB_2727 CirA HutA 2 gi|86610153

SynpA0637 BtuB BtuB 30 gi|170077260 Synechococcus sp. PCC 7002

SynpG0081 CirA HutA 6 gi|170076551

SynpG0006 CirA IutA 35 gi|170076476

SynpG0138 CirA IutA 37 gi|170076608

SynPG0089 FhuE FhuA 55 gi|170076568

SynpG0103 FhuA FhuA 86 gi|170076573

Nspu20875 CirA FhuA 92 gi|119508873 Nodularia spumigena

Nspu21611 CirA IutA 43 gi|119509643

Cwat6206* - FhuA 1 gi|67920343 Crocosphaera watsonii WH8501

The annotation of the sequences is indicated in column 1, the spot number according to Figure 3 is indicated in column 4; the initial annotation in the database is given in column 2; the classification according to Figure 3 using the name of a representative transporter of the related category is given in column 3; the accession code in column 5; and the source organism column 6.

a(OMC, outer membrane channel; '*', incomplete sequence; '?', no clear assignment possible).

[TableWrap ID: T2] Table 2 

TonB-like genes in cyanobacteria

species No. TonBs Locus tag
Acaryochloris marina MBIC11017 2 AM1_A0167, AM1_3413

Anabaena variabilis ATCC 29413 1 Ava_2295

Crocosphaera watsonii WH 8501 1 CwatDRAFT_6356

Cyanothece sp. CCY0110 2 CY0110_08196, CY0110_24616

Gloeobacter violaceus PCC 7421 3 glr1389, glr1815, glr2404

Nodularia spumigena CCY9414 1 N9414_10453

Nostoc punctiforme PCC 73102 1 Npun_F0783

Anabaena sp. PCC 7120 1 all5036

Synechococcus sp. PCC 7002 2 SYNPCC7002_G0090, SYNPCC7002_A2465

Synechococcus sp. JA-3-3Ab 1 CYA_2030

Synechococcus sp. JA-2-3B'a(2-13) 1 CYB_2726

Synechocystis sp. PCC 6803 1 slr1484

[TableWrap ID: T3] Table 3 

Primers used for reverse transcription polymerase chain reaction analysis and sequence confirmation.

Use Primer Oligonucleotide sequence

Sequence confirmation all2619-20 F CTCCCATTTCTCCGAAGCTG

Article Categories:
  • Research Article

Previous Document:  Increased fluid intake does not augment capacity to lay down new collagen in nursing home residents ...
Next Document:  Promoting chlamydia screening with posters and leaflets in general practice--a qualitative study.