Document Detail

Regulation of p53 expression, phosphorylation and subcellular localization by a G-protein-coupled receptor.
Jump to Full Text
MedLine Citation:
PMID:  19648965     Owner:  NLM     Status:  MEDLINE    
Abstract/OtherAbstract:
G-protein-coupled receptors (GPCRs) have been extremely successful drug targets for a multitude of diseases from heart failure to depression. This superfamily of cell surface receptors have not, however, been widely considered as a viable target in cancer treatment. In this study we show that a classical G(q/11)-coupled GPCR, the M(3)-muscarinic receptor, was able to regulate apoptosis through receptors that are endogenously expressed in the human neuroblastoma cell line, SH-SY5Y, and when ectopically expressed in Chinese hamster ovary (CHO) cells. Stimulation of the M(3)-muscarinic receptor was shown to inhibit the ability of the DNA-damaging chemotherapeutic agent, etoposide, from mediating apoptosis. This protective response in CHO cells correlated with the ability of the receptor to regulate the expression levels of p53. In contrast, stimulation of endogenous muscarinic receptors in SH-SY5Y cells did not regulate p53 expression but rather was able to inhibit p53 translocation to the mitochondria and p53 phosphorylation at serine 15 and 37. This study suggests the possibility that a GPCR can regulate the apoptotic properties of a chemotherapeutic DNA-damaging agent by regulating the expression, subcellular trafficking and modification of p53 in a manner that is, in part, dependent on the cell type.
Authors:
L Solyakov; E Sayan; J Riley; A Pointon; A B Tobin
Related Documents :
21265555 - Cycloartane triterpenes isolated from combretum quadrangulare in a screening program fo...
20457145 - Functional characterization of bursicon receptor and genome-wide analysis for identific...
18193175 - The orphanin fq/nociceptin (ofq/n) system.
20566865 - Identification of rl-tgr, a coreceptor involved in aversive chemical signaling.
9920655 - Lectin-induced inhibition of desensitization of the kainate receptor glur6 depends on t...
16464405 - Targeted molecular therapy of malignant gliomas.
Publication Detail:
Type:  Journal Article; Research Support, Non-U.S. Gov't     Date:  2009-08-03
Journal Detail:
Title:  Oncogene     Volume:  28     ISSN:  1476-5594     ISO Abbreviation:  Oncogene     Publication Date:  2009 Oct 
Date Detail:
Created Date:  2009-10-15     Completed Date:  2009-11-05     Revised Date:  2010-09-27    
Medline Journal Info:
Nlm Unique ID:  8711562     Medline TA:  Oncogene     Country:  England    
Other Details:
Languages:  eng     Pagination:  3619-30     Citation Subset:  IM    
Affiliation:
Department of Cell Physiology and Pharmacology, University of Leicester, Leicester, UK.
Export Citation:
APA/MLA Format     Download EndNote     Download BibTex
MeSH Terms
Descriptor/Qualifier:
Animals
Apoptosis
CHO Cells
Caspases / metabolism
Cell Line, Tumor
Cricetinae
Cricetulus
Enzyme Activation / drug effects
Etoposide / pharmacology
Gene Expression Regulation*
Humans
Intracellular Space / metabolism*
Mitochondria / metabolism
Phosphorylation
Protein Transport
Receptor, Muscarinic M3 / metabolism*
Transfection
Tumor Suppressor Protein p53 / genetics*,  metabolism*
Grant Support
ID/Acronym/Agency:
047600//Wellcome Trust; 073480//Wellcome Trust; 073480//Wellcome Trust
Chemical
Reg. No./Substance:
0/Receptor, Muscarinic M3; 0/Tumor Suppressor Protein p53; 33419-42-0/Etoposide; EC 3.4.22.-/Caspases
Comments/Corrections

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine

Full Text
Journal Information
Journal ID (nlm-journal-id): 8711562
Journal ID (pubmed-jr-id): 6325
Journal ID (nlm-ta): Oncogene
Journal ID (iso-abbrev): Oncogene
ISSN: 0950-9232
ISSN: 1476-5594
Article Information
Download PDF

nihms-submitted publication date: Day: 15 Month: 6 Year: 2009
Electronic publication date: Day: 03 Month: 8 Year: 2009
Print publication date: Day: 15 Month: 10 Year: 2009
pmc-release publication date: Day: 24 Month: 5 Year: 2010
Volume: 28 Issue: 41
First Page: 3619 Last Page: 3630
PubMed Id: 19648965
ID: 2875175
DOI: 10.1038/onc.2009.225
ID: UKMS5201

Regulation of p53 expression, phosphorylation and sub-cellular localisation by a G-protein coupled receptor
Lev Solyakov1*
Emre Sayan2*
Joan Riley#
Amy Pointon#
Andrew B Tobin1
1Department of Cell Physiology and Pharmacology, University of Leicester, Hodgkin Building, Lancaster Road, Leicester, LE1 9HN, UK
2Department of Cancer Studies and Molecular Medicine, University of Leicester, Hodgkin Building, Lancaster Road, Leicester, LE1 9HN, UK
#MRC Toxicology Unit, Hodgkin Building, Lancaster Road, Leicester, LE1 9HN
Correspondence: Corresponding author: Prof. Andrew B. Tobin, Tel: 0116 2522935, Fax: 0116 2231405, Email: tba@le.ac.uk
*Authors contributed equally

Introduction

The wide involvement of G-protein coupled receptors (GPCRs) in biological responses coupled to the fact that these receptors show very distinct tissue distributions and are activated by specific ligands have made this receptor super-family an ideal candidate for pharmacological intervention in a large number of diseases (Klabunde and Hessler, 2002). Despite this success, targeting GPCRs in diseases where programmed cell death (apoptosis) is a feature has been largely over looked. Prevalent among such diseases is cancer where apoptosis is suppressed, primarily by liaisons in the p53 pathway (Vousden and Lu, 2002), and where chemotherapeutic intervention is often directed to inducing apoptosis in the cancerous cells .

It has been known for some time that GPCRs can influence apoptosis in both a positive and negative manner depending on the cell type and receptor subtype being investigated (Chen et al., 1999; De Sarno et al., 2005; DeFea et al., 2000; Diao et al., 2000; Fang et al., 2000; Murga et al., 1998; Tobin and Budd, 2003; Vichalkovski et al., 2005; Zhu et al., 2001). The ability of GPCRs to regulate apoptosis is likely due to the plethora of signalling pathways activated by these receptors, many of which are known to converge on apoptotic pathways (Dorsam and Gutkind, 2007; Marinissen and Gutkind, 2001). Thus, GPCRs are able to potently activate the PI-3 kinase/Akt pathway as well as the mitogen-activated protein (MAP) kinase pathways, ERK-1/2, Jun-kinase and p38, and thereby influence apoptosis (Fang et al., 2000; Murga et al., 1998; Zhou et al., 2002; Zhu et al., 2001). Similarly, receptors coupled to calcium mobilisation, protein kinase C (PKC) activation and cyclic-AMP production have all been shown to either promote or inhibit apoptosis (Dale et al., 2000; Diao et al., 2000; Kwon et al., 2001; Tobin and Budd, 2003).

In terms of cancer treatment many laboratories have focused on the role played by the transcription factor p53 which appears to mediate apoptosis induced by many of the commonly used DNA-damaging chemotherapeutic agents (for discussion see (Brown and Attardi, 2005)). Furthermore, in approximately 50% of human tumours p53 inactivating mutations are found and in those tumours where there is no mutation at the p53 locus there is often a lesion in the pathways that regulate p53 expression or sub-cellular localisation (Haupt and Haupt, 2006; Vogelstein et al., 2000). In light of the ability of GPCRs to regulate the apoptotic process we wanted to test if the signalling potential of these receptors could extend to the regulation of p53 under conditions where apoptosis was induced by a chemotherapeutic DNA damaging agent.

Our work has centred on the M3-muscarinic receptor which is a classical Gq/11-coupled GPCR that activates the PLC/calcium mobilisation pathway (van Koppen and Kaiser, 2003). We and others have established that the M3-muscarinic receptor is able to protect cells from apoptosis in transfected cell lines (Budd et al., 2003; Tobin and Budd, 2003), the human neuroblastoma cell line SH-SY5Y (De Sarno et al., 2003; De Sarno et al., 2005), cortical neurons (Koh et al., 1991) and cerebellar granule neurons (Yan et al., 1995). Here we use the fact that the M3-muscarinic receptor is a GPCR subtype able to regulate the process of apoptosis seen in response to DNA-damage (Budd et al., 2003; Tobin and Budd, 2003) to test the notion that GPCRs were able to influence the cellular function of p53. To do this we use two cell lines a Chinese hamster ovary cell line transfected with the human M3-muscarinic receptor (CHO-m3 cells) and the human neuroblastoma cell line, SH-SY5Y, that endogenously expresses the M3-muscarinic receptor.


Results
The M3-muscarinic receptor regulates the expression of p53 protein in CHO-m3 cells

Treatment of CHO-m3 cells with etoposide for 16 hours resulted in a ~2.5-fold increase in caspase activity over control levels. Stimulation of the M3-muscarinic receptor using the full agonist methylcholine significantly reduced caspase activation by 69.4 ±8.9% (p<0.01, n=6) (Fig.1A); an observation consistent with previous studies (Budd et al., 2004; Tobin and Budd, 2003). The effect of methylcholine was blocked by the muscarinic specific antagonist, atropine (Fig 1A). The ability of M3-muscarinic receptor stimulation to reduce etoposide-mediated caspase activation correlated with changes in the expression levels of p53. Levels of p53 increased in CHO-m3 cells challenged with etoposide and this was attenuated by the stimulation of the M3-muscarinic receptor (Fig 1B).

In our studies p53 appears as a double band in Western blots (Fig 1B). Although the reason for this is unclear it is possible that it either reflects differential phosphorylation status of p53 (Hu et al., 1999; Ullrich et al., 1992) or different p53 isoforms resulting from differential splicing, polymorphisms or alternative promoter usage (Bourdon, 2007; Courtois et al., 2004; Dumont et al., 2003).

si-RNA specific to p53 reduced the induction of p53 expression following etoposide treatment by ~50% (Fig. 1C). This correlated with a similar reduction in etoposide-induced caspase 3 activity (Fig 1C). Thus, indicating that caspase 3 activation following etoposide treatment was mediated via an increase in p53 expression levels.

The ability of the M3-muscarinic receptor to down regulate p53 and protect cells from apoptosis correlated with the ability of the receptor to prevent the activation of p53 responsive genes. RT-PCR analysis demonstrated that transcription of the p53 responsive genes Bax, Mdm2 and NOXA were significantly increased following etoposide treatment (Fig 1D). Stimulation of the M3-muscarinic receptor reduced transcription of these genes to basal levels (Fig 1D) in a manner that correlated with the ability of the receptor to protect from apoptosis.

We tested whether a short period of muscarinic receptor treatment would be sufficient to down-regulate p53 levels in CHO-m3 cells resulting from prolonged treatment with etoposide. In control experiments we found that four hours treatment with etoposide resulted in an increase in p53 expression levels and that this was attenuated by a simultaneous four hour treatment with methylcholine (Fig. 1E). If methylcholine stimulation was stopped after four hours with the antagonist atropine (10μM; a concentration sufficient to completely block muscarinic receptor signalling (Budd et al., 2004)) and the treatment with etoposide continued for a further 12 hours the attenuation of p53 levels was still evident (Fig. 1E). These data indicate that transient receptor stimulation was sufficient to suppress etoposide mediated p53 expression levels. Interestingly, the suppression of p53 levels by the muscarinic receptor was not due to the ability of the receptor to enhance p53 degradation. This was demonstrated by inhibiting new protein synthesis using cyclohexamide and monitoring the loss of p53 over time. Here etoposide treatment significantly decreased the rate of p53 degradation in a manner that was not affected by the presence of methacholine (Fig 1F).

Further RT-PCR studies revealed that the ability of the M3-muscarinic receptor to decrease p53 protein expression levels in CHO-m3 cells was not due to an ability to decrease transcription of p53 (supplementary Fig.S1). Since, DNA-damage had previously been reported to both stabilisation and activate p53 through a process that is in part due to phosphorylation of specific serine residues at the N-terminus of p53 (Chao et al., 2000; Chehab et al., 1999; Meek, 1999; Shieh et al., 1997; Siliciano et al., 1997; Unger et al., 1999) the phosphorylation status of p53 was investigated. Of particular importance is serine-15 where phosphorylated has been reported to increase p53 stability via disruption of Mdm2 binding (Shieh et al., 1997; Siliciano et al., 1997). We tested here if muscarinic receptor stimulation was able to regulate the level of p53 phosphorylation at serine-15 using a phospho-specific antibody. Treatment with etoposide resulted in a robust phosphorylation of p53 on serine-15 (Fig. 1G). Stimulation with methylcholine resulted in a decrease in serine-15 phosphorylation which correlated closely with the decrease in total p53 levels (Fig. 1G). Hence, in these experiments we found no evidence that p53 de-phosphorylation at serine-15 preceded p53 down-regulation. Similarly we tested the possibility that phosphorylation at serine-392 (Fig. 1H) was changed by M3-muscarinic receptor stimulation. However, although levels of phosphorylation did decrease, this correlated with decreases in total p53 levels. Hence, it was again not possible to conclude whether p53 de-phosphorylation preceded receptor mediated p53 degradation.

Stimulation of the M3-muscarinic receptor protects SH-SY5Y cells against etoposide-induced caspase activation

Consistent with previous reports (De Sarno et al., 2003; De Sarno et al., 2005) we show here that the M3-muscarinic receptor endogenously expressed in the human neuroblastoma cell line SH-SY5Y was able to protect cells from etoposide induced cell death. Treatment with etoposide (25μM) for 4 and 8 hours resulted in 6-8 fold increase in caspase activity which was significantly reduced by methylcholine (90.2 ± 0.1% (P<0.001, n=5) and 59.3 ± 0.7% (P<0.05, n=3), respectively (Fig 2A)). Furthermore, muscarinic receptor stimulation was able to attenuate caspase-mediated PARP cleavage in response to etoposide treatment (Fig 2B), caspase 3 and caspase 9 processing together and cytochrome C release into the cytoplasm (Fig 2C). We did not, however, observe any changes in caspase 8 processing nor cleavage of the caspase 8 substrate Bid (Fig 2C).

Time course studies were conducted where M3-muscarinic receptor stimulation was stopped by addition of the antagonist atropine (10μM) at various times during the 4 hour challenge with etoposide. These studies revealed that caspase activation measured after 4 hours treatment with etoposide was reduced by 66.7 ± 0.3% (P<0.05, n=4) after a 30 min stimulation of M3-muscarinic receptors initiated at the start of the etoposide treatment (Fig 2D). These data suggest that a transient stimulation of M3-muscarinic receptor signalling has is sufficient to protect SHSY5Y cells from a prolonged exposure to etoposide.

Pharmacological inhibitors to the PLC/calcium mobilisation pathway (U73122 and dantrolene), PKC (Ro31-8220) and MEK (PD98059) had no affect on the ability of methylcholine to inhibit caspase activation (supplementary Fig S2). Furthermore, a number of other inhibitors including the CK1 inhibitor D-4476 (supplementary Fig S3A) JNK inhibitor I (5μM), the CaM-kinase II inhibitor KN-93 (10μM), selective PKA inhibitors KT 5720 (1μM) and H-89 (1μM) similarly had no affect on the M3-muscarinic anti-apoptotic response in SH-SY5H cells (supplementary Fig3B). In addition, the PI3-kinase inhibitors LY294002 (10μM) and wortmannin (100nM) and the inhibitor of mTOR, rapamycin, were unable to affect M3-muscarinic receptor-mediated protection of SH-SY5Y cells (supplementary Fig S4). However, the broad spectrum protein kinase inhibitor HA1077 was able to inhibit the action of methylcholine (supplementary Fig. S5). This has been previously attributed to the ability of this compound to inhibit Rho-kinase (De Sarno et al., 2005). However, the Rho-kinase specific inhibitor, Y-27632 (Chitaley et al., 2001), was unable to affect the muscarinic response when used at a concentration of 10μM (supplementary Fig S5). This would suggest that the Rho-kinase pathway is not directly involved in the M3-muscarinic receptor-mediated protection mechanism but that protein phosphorylation is important.

M3-muscarinic receptors inhibit apoptosis in SH-SY5Y cells but do not change the level of p53 expression

In light of the ability of the M3-muscarinic receptor to regulate the expression levels of p53 following a challenge with etoposide in CHO-m3 cells we tested if muscarinic receptor stimulation could change the expression levels of p53 in SH-SY5Y cells. Etoposide treatment of SH-SY5Y cells for two, four and eight hours resulted in a substantial increase in p53 expression that was not significantly affected by co-stimulation with methylcholine (Fig 3A). Hence, in contrast to CHO-m3 cells, M3-muscarinic receptors do not appear to regulate the expression levels of p53 in SH-SY5Y cells.

We next confirmed that the apoptotic response observed in SH-SY5Y cells following etoposide treatment was mediated by elevated levels of p53. SH-SY5Y cells were transfected with siRNA duplex directed against p53 or with scrambled control. The cells were then challenged with etoposide. In control cells etoposide treatment resulted in an increase in the expression levels of p53 that correlated with an increase in caspase 3 processing and the cleavage of the caspase 3 substrate PARP (lane 2, Fig 3B). In siRNA treated cells the induction of p53 was significantly reduced (by ~50%). In these cells caspase 3 processing and PARP cleavage were similarly reduced (lane 6, Fig 3B). These data are consistent with p53 mediating etoposide-induced apoptosis in SH-SY5Y cells.

A large body of work from other laboratories have established that p53-mediate apoptosis is primarily attributable to the ability of p53 to transcriptionally regulate pro-apoptotic genes such as Puma, NOXA and Bax (Nakano and Vousden, 2001; Oda et al., 2000; Yu et al., 1999). In the current study a four hour treatment with etoposide did increase the transcription of the p53 responsive genes Bax and Mdm2 (Fig. 4A). However, Western blots of the proteins demonstrated that there was a small increase in the expression of Mdm2 and no significant increase in the level of Bax protein (Fig 4B). Thus, despite evidence that p53 was responsible for etoposide-induced apoptosis (Fig 3B) this did not appear to be linked with a substantial change in the expression of pro-apoptotic p53 responsive genes (Fig 4B). Furthermore, the ability of muscarinic receptor stimulation to protect from etoposide-induced apoptosis was not correlated with a change in the transcription of p53-reponsive genes (Fig 4A). It seems likely, therefore, that although p53 is the mediator of apoptosis induced by etoposide this is not through an up regulation of p53 responsive gene expression. Consistent with this conclusion was the fact that the pharmacological inhibitor of p53-mediated transactivation, pifithrin-α (Komarov et al., 1999) had no affect on etoposide-mediated caspase activity (Fig 4C).

That p53 was the mediator of the increase in caspase activity following etoposide treatment of SH-SY5Y cells was, however, evident firstly by the effects of p53 siRNA (see; Fig 3B) and secondly by the fact that suppression of p53 activity using pifithrin-μ (Strom et al., 2006), prevented etoposide-mediated caspase activation (Fig 4D). Pifithrin-μ has been reported to inhibit p53 translocation to the mitochondria and in this way prevent apoptosis resulting from the direct action of p53 on the mitochondria (Strom et al., 2006). In our hands pifithrin-μ prevented the elevation of total p53 in response to DNA-damage and this correlated with a total protection from etoposide induced apoptosis (Fig 4D-insert).

M3-muscarinic receptors inhibit translocation of p53 to the mitochondria

Based on reports demonstrating that rapid apoptosis induced within the first few hours of DNA-damage can be mediated by the direct action of p53 on the mitochondria (Erster et al., 2004; Marchenko et al., 2000) we tested the possibility that the muscarinic receptor protective response might correlate with changes in p53 translocation to the mitochondria. We found that etoposide treatment resulted in a rapid rise in the expression levels of p53 in the nuclear, cytosolic and mitochondrial fractions in SH-SY5Y cells (Fig 5). M3-muscarinic receptor stimulation had no significant affect on the levels of etoposide-induced p53 levels in the nucleus or cytoplasm but did significantly decrease the levels of p53 in the mitochondria (Fig 5).

M3-muscarinic receptors regulate the phosphorylation status of p53

It is well documented that the phosphorylation status of p53 is up-regulated following DNA damage and that this modification contributes to the stabilisation and activation of p53 (Chao et al., 2000; Chehab et al., 1999; Meek, 1999; Shieh et al., 1997; Siliciano et al., 1997; Unger et al., 1999). To test if GPCR activity could regulate the phosphorylation status of p53 in SH-SY5Y cells, phospho-specific antibodies were used in Western blots of p53 contained in the nuclear, cytoplasmic and mitochondrial fractions. Following a 4 hour treatment with etoposide the phosphorylation of p53 at residues 6, 9, 15, 20, 37 and 392 increased in the nuclear, cytoplasmic and mitochondrial fractions (Fig 6A). Muscarinic receptor stimulation did not affect the phosphorylation of p53 in nuclear fractions (Fig6A). Similarly, mitochondrial p53 phosphorylation did not appear to be affected by muscarinic receptor stimulation since the apparent decrease in the phosphorylation status of p53 following receptor activation observed in Fig 6A could be accounted for by the decrease in total mitochondrial p53. However, muscarinic receptor stimulation did significantly reduce the phosphorylation status of cytoplasmic p53 at residues 15 and 37 (Fig 6A orange boxes and Fig 6B).


Discussion

Our study demonstrates the ability of a Gq/11-coupled GPCR to regulate caspase activation following DNA-damage. In CHO-m3 cells, where apoptosis proceeds following a prolonged exposure to etoposide, the muscarinic anti-apoptotic response correlates with a decrease in p53 expression levels. In contrast, etoposide-mediated caspase activation in SH-SY5Y cells is rapid and the muscarinic protective response does not correlate with a change in the overall level of p53 expression but rather is associated with a decrease in the translocation of p53 to the mitochondria. Furthermore, muscarinic receptor stimulation regulates the phosphorylation status of p53 in the cytoplasm of SH-SY5Y cells. This study, therefore, demonstrates the previously unknown capacity of a GPCR to regulate p53 at a number of different levels and in a cell type dependent manner.

Decreasing p53 expression levels in CHO-m3 cells, via siRNA, results in a reduction in etoposide-mediated caspase activation thus supporting the conclusion that etopoisde promotes apoptosis in CHO-m3 cells by elevating p53 expression. In light of this it is likely that the mechanism by which M3-muscarinic receptors protect CHO-m3 cells from apoptosis is via the ability of this receptor to decrease p53 expression levels. This is important in the context of previous studies where the anti-apoptotic response of this receptor subtype was shown to correlate with an up-regulation of Bcl-2 protein (Tobin and Budd, 2003) a gene that is under negative control by p53 (Miyashita et al., 1994). This provides a further explanation for the anti-apoptotic properties of the M3-muscarinic receptor subtype in CHO-m3 cells which both decreases p53 levels (this study) and correspondingly increases Bcl-2 levels (Tobin and Budd, 2003). The mechanism by which the M3-muscarinic receptor is able to regulate p53 expression in CHO-m3 cells is, however, unknown. Previous studies have eliminated a role for PLC/calcium signalling, the MAP kinase pathways as well as the PI3-kinase pathway (Budd et al., 2003; Tobin and Budd, 2003). However, a polybasic motif contained at the C-terminal tail of the receptor has been shown to be essential for the ability of the receptor to couple to the anti-apoptotic pathway in this cell type (Budd et al., 2003; Tobin and Budd, 2003). In the current study the possibility that the receptor was able to regulate the phosphorylation of p53 at serine-15 and thereby regulate p53 stability was investigated. However, it appears that changes in p53 serine-15 and serine-392 phosphorylation did not precede p53 down regulation. It is possible that M3-muscarinic receptor signalling is able to regulate p53 phosphorylation in CHO-m3 cells but the resolution of the Western blot techniques used here is not sufficiently high to detect these changes. Clearly further studies are required to define the mechanism by which GPCRs can regulate p53 expression.

In contrast to the situation in CHO-m3 cells, the mechanism by which M3-muscarinic receptors reduce caspase activity in the human neuroblastoma cell line SH-SY5Y appears not to be centred on the control of p53 expression. In this cell line caspase activity in response to DNA-damage is rapid and does not correlate with a change in pro-apoptotic p53 target genes. Previous studies have determined that caspase activation in SH-SY5Y cells in response to etoposide is mediated by the action of p53 (Cui et al., 2002). Consistent with this we find here the p53 inhibitor, pifithrin-μ, blocked the ability of etoposide to mediate caspase activation. Pifithrin-μ has been reported to prevent p53 mitochondrial translocation (Strom et al., 2006) but in our hands this inhibitor prevents etoposide-mediated increases in total p53 levels. Furthermore, knock down of p53 expression levels using siRNA correspondingly reduced the apoptotic response to etoposide confirming that p53 was the mediator of the apoptotic response in SH-SY5Y cells.

Importantly, pifithrin-α, an inhibitor of p53 transactivation (Komarov et al., 1999), did not prevent etoposide-mediated caspase activation. Furthermore, although etoposide did induce p53-mediated transcription of pro-apoptotic proteins this was not reflected in an increase in protein expression levels seen at the short time points of incubation used (i.e. 4 hours). Thus, although DNA-damage induces caspase activation in SH-SY5Y cells via a p53-dependent mechanism, this does not appear to require an increase in the expression levels of p53 responsive genes. One possibility is that p53 is able to mediate its affects via a direct action on the mitochondria. This phenomenon has been reported previously to account for etoposide-mediated apoptosis in SH-SY5Y cells (Sayan et al., 2006) and has also been reported in a number of other model cell lines (Chipuk and Green, 2003; Moll et al., 2005) where it has been suggested to account for the first wave of p53-mediated apoptosis which precedes a later sustained period of apoptosis mediated by p53 gene transcription (Erster et al., 2004).

The importance of the fact that etoposide-mediated apoptosis in SH-SY5Y cells may be a direct action of p53 on mitochondria is borne out in the observations that muscarinic receptor stimulation prevents cytochrome C release into the cytoplasm, prevents caspase 3 and 9 processing and reduces the translocation of p53 to the mitochondria. In the context of these findings it is likely that the ability of the M3-muscarinic receptor to protect SH-SY5Y cells from etoposide-induced apoptosis is centred on the ability of the receptor to prevent the translocation of p53 to the mitochondria.

As is the case for muscarinic receptor mediated effects on p53 in CHO-m3 cells, the signalling pathway employed by the muscarinic receptor to regulate p53 function in SH-SY5Y cells is unclear. Inhibitors of Rho-kinase did not provide evidence for the involvement of this pathway since the specific Rho-kinase inhibitor Y-27632 (Chitaley et al., 2001), did not prevent the muscarinic anti-apoptotic response. Similarly, pharmacological inhibitors of PI-3 kinase, PLC/calcium signalling, MAP kinases, CK1, mTOR, PKA and PKC did not identify any candidate pathways.

Cellular stress results in hyper-phosphorylation of p53 which is known to contribute to the both stabilisation and transcriptional activity of p53 (Bode and Dong, 2004; Brooks and Gu, 2003). Consistent with this we show here that etoposide treatment resulted in increased phosphorylation at serine residues 6, 9, 15, 20, 37 and 392 on p53. Moreover, muscarinic receptor stimulation decreased the phosphorylation status of p53 only at positions 15 and 37 and only in p53 located in the cytoplasmic fraction. This is the first demonstration of a GPCR regulating the phosphorylation status of p53 and may provide an explanation for the anti-apoptotic properties of the M3-muscarinic receptor since phosphorylation at these residues has been shown to be important for p53-mediated apoptosis (Li et al., 2006; Shieh et al., 1997).

Both functionally and mechanistically phosphorylation at serine 15 and 37 appear to be linked. Phosphorylation at serine 15 and 37 disrupts MDM2 binding and thereby stabilises p53 in response to DNA damage (Bean and Stark, 2001; Shieh et al., 1997). Furthermore, phosphorylation at these two sites contributes to increasing p53 transcriptional activity by promoting the interaction with histone acyltransferases (CBP/p300, PCAF/p300) resulting in C-terminal acetylation of p53 and thereby specific DNA binding (Lambert et al., 1998; Sakaguchi et al., 1998). In vitro studies have determined that p53 is phosphorylated at serine 15 and 37 by the same protein kinases, DNA-dependent protein kinase (Shieh et al., 1997) and ATR (Tibbetts et al., 1999), both of which respond to DNA damage. In recent studies it has been suggested that phosphorylation at these sites may be regulated by the action of the protein phosphatase, PP-1, which can promote cell survival by dephosphorylation of serine 15 and 37 (Li et al., 2006). It is therefore of considerable interest that M3-muscarinic receptor stimulation can regulate the level of phosphorylation of p53 at these two key phospho-acceptor sites.

It is tempting to speculate that the phosphorylation status of cytoplasmic p53 may contribute to the translocation of p53 to the mitochondria. Recent studies have suggested that serine 15 phosphorylation can promote p53 mitochondrial translocation and interaction with Bcl-2 and Bcl-XL (Park et al., 2005). However, other studies have not been able to correlate phosphorylation and acetylation of p53 with mitochondrial targeting (Nemajerova et al., 2005). Hence, it is not currently possible to determine if the ability of the receptor to reduce serine 15 and 37 phosphorylation of cytoplasmic p53 observed in this study is linked with the ability of muscarinic receptor stimulation to reduce p53 translocation to the mitochondria.

Our studies suggest the possibility that a GPCR can regulate apoptosis induced by DNA damage through direct action on p53. We would predict that this principle can be extended to GPCRs other than the M3-muscarinic receptor, particularly in light of the fact that a large number of GPCRs can regulate the apoptotic process (Budd et al., 2003; Budd et al., 2004; Chen et al., 1999; Dale et al., 2000; De Sarno et al., 2003; De Sarno et al., 2005; DeFea et al., 2000; Diao et al., 2000; Fang et al., 2000; Koh et al., 1991; Murga et al., 1998; Tobin and Budd, 2003; Vichalkovski et al., 2005; Yan et al., 1995; Zhu et al., 2001). In particular recent studies on the lysophosphatidic acid receptor has demonstrated that this GPCR subtype can regulate the expression levels of p53 in cancer cells (Murph et al., 2007). Since GPCRs provide a well established pharmaceutical target it may be possible to specifically target GPCRs on cancer cells to regulate p53-dependent processes. Depending on the GPCR receptor subtype (and almost certainly the cancer type) we would speculate that a GPCR agonist or antagonist could be used to augment the action of a chemotherapeutic agent. In the example of the M3-muscarinic receptor an antagonist would have to be used to prevent autocrine/paracrine activation of this anti-apoptotic pathway. That such autocrine loops exist in tumours has recently been highlighted in a report where release of acetylcholine from small cell lung cancer cells was shown to promote tumour growth through the activation of the M3-muscarinic receptor subtype in a fashion that is inhibited by muscarinic receptor antagonists (Song et al., 2007).


Materials and Methods
Materials

Anti-cytochrome C antibody was obtained from BD Pharmingen (BD Biosciences, Oxford, UK). Primary antibodies against-tubulin, p53 (D0-1), NOXA and Mdm2 were purchased from Santa Cruz Biotechnology, Inc. (Autogen Bioclear UK Ltd, Wiltshire, UK). Primary antibodies against PUMA, PARP (cleaved fragment), caspase-9 (Asp330, cleaved fragment), caspase-3 (cleaved fragment), and all phospho-p53 specific antibodies were purchased from Cell Signaling Technology. Anti-mouse and anti-rabbit HRP-conjugates and U73122 were obtained from Sigma (Sigma-Aldrich Company Ltd. Poole, Dorset, UK). D-4476, JNK inhibitor I, KT-5720, H-89, RO-318220, dantrolene, pifithrin-α, pifithrin-μ and PD98059 were purchased from Calbiochem. KN-93 from Merck and LY294002 from Tocris. All other chemicals and reagents were obtained from the usual commercial sources.

Cell Culture and drug treatments

Chinese hamster ovary cells stably transfected with the human M3-muscarinic receptor were cultured in α-MEM supplemented with 10% fetal bovine serum, 2.5 μg/ml of fungizone, 50 U/ml of penicillin, 50 μg/ml of streptomycin and 250 μg/ml G-418 sulphate. The human neuroblastoma SH-SY5Y cells were cultured in 10cm Petri dishes or 175 cm2 flasks and maintained in MEM media (Earl’s modified), supplemented with 5% fetal bovine serum, 5% newborn calf serum, 2 mM L-glutamine, 2.5 μg/ml of fungizone, 50 U/ml of penicillin and 50 μg/ml of streptomycin.

Apoptosis was induced by treating cells, reaching 50-60% confluency, with etoposide at the indicated concentrations. The muscarinic agonist, methylcholine was applied for the indicated time periods (see results section and figures) and where indicated the stimulation was stopped by addition of atropine (10μM), a specific antagonist for muscarinic receptors.

In experiments where cyclohexamide was used cells were treated with or without etoposide in the presence or absence of methacholine for 16 hours. Cyclohexamide (20μg/ml) was then added for the indicated times and the reaction stopped by addition of lysis buffer (50mM HEPES, pH 7.4, 0.15M NaCl, 2mM EDTA, 1mM DTT, 1% CHAPS) Lysates were then used in caspase assays as described below.

Caspase-3 activity assay

Following appropriate treatment, cells were harvested in PBS-EDTA buffer, washed and cell pellets placed on ice and lysed for 10 min in lysis buffer. Cell lysates were cleared by centrifugation at 14,000 rpm for 3 min, 4°C, and the supernatant fraction was used for caspase-3 activity assay. Aliquots of the cell lysate containing equal amount of proteins (normally 200μg per assay) were incubated in reaction mixture containing Ac-DEVD-pNA (final concentration 200μM) and 10mM DTT for 3 hours at 37°C. Cleavage of the Ac-DEVD-pNA substrate was measured at 405 nm in plate reader using 96-well plates.

Cells fractionation

SH-SY5Y cells were cultured in 175 cm2 flasks until ~ 70-80% confluency. Following treatment cells were harvested in PBS-EDTA buffer, washed once with ice-cold PBS and resuspended in ice-cold hypotonic buffer (20mM HEPES, pH 7.4, 250mM sucrose, 5mM MgCl2, 10mM KCl, 1mM EDTA, 1mM EGTA, 1mM DTT, 1mM PMSF and protease inhibitor cocktail (Sigma)). Following 15 min incubation on ice the cell suspension was passed 8 times through a 27 gauge needle and centrifuged at 750xg for 10min. The pellet was discarded and the supernatant fraction was centrifuged again at 10,000xg for 10 min. The final pellet was taken as mitochondrial fraction while the supernatant as cytosolic one. Samples were resuspended in Laemmli buffer, run over 10% SDS gels and analysed by Western blotting as above. To purify the nuclear fractions, SH-SY5Y cells were maintained and treated in the same manner as it was done for mitochondria fractionation. The cells were harvested, washed in ice-cold PBS and lysed on ice for 5 min in nuclear-lysis buffer (Sigma, NUC-201 nuclei isolation kit). To purify the nuclei, the cell lysates were further centrifuged over 1.8M sucrose cushion solution in accordance with the manual instruction. Isolated nuclei were then analysed by Western blotting.

p53 siRNA treatment

For each treatment (whether CHO-m3 or SHSY-5Y cells), 50pmol of p53 targetting siRNA (Ambion siRNA ID: s605) or control siRNA (Ambion, #AM4611) was transfected in to 1.5×106 cells by nucleofection (Amaxa nucleofector, Cologne, Germany) using buffer V, program A023. 48 hours after transfection, cells were treated with etoposide and/or methylcholine as described above.

Real time–PCR (RT–PCR)

Total RNA was isolated using Trizol reagent (Sigma). RNA (100 ng) was reverse-transcribed using Superscript III (Invitrogen) and the resulting cDNA was used for amplification with SYBR® green mastermix (Applied Biosystems). Reactions were carried out on an ABI PRISM® 7700 RT–PCR machine using optimized primers. Primers for RT–PCR were designed to cross exon-exon boundaries to eliminate the detection of any contaminating genomic DNA using Primer Express® software v2.0 (Applied Biosystems). The sequences used were: mmu-Bax forward, TGGAGCTGCAGAGGATGATTG; mmu-Bax reverse, GCTGCCACTCGGAAAAAGAC; mmu-Puma forward, GGGTCCCCTGCCAGATTT; mmu-Puma reverse, GCAGGAGTCCCATGATGATGA; mmu-Mdm2 forward, TCTACAGGGACGCCATCGA, mmu-Mdm2 reverse, GATCCAACCAATCACCTGAATGT; mmu-Noxa forward, GATTTGCGATTGGGATGCA; mmu-Noxa reverse, GCACACTCGACTTCCAGCTACTT; hsa-Bax forward, TGGAGCTGCAGAGGATGATTG, hsa-Bax reverse, GCTGCCACTCGGAAAAAGAC; hsa-Puma forward, GGGTCCCCTGCCAGATTT; hsa-Puma reverse, GCAGGAGTCCCATGATGATGA; hsa-Mdm2 forward, TCTACAGGGACGCCATCGA; hsa-Mdm2 reverse GATCCAACCAATCACCTGAATGT, hsa-Noxa forward, GATTTGCGATTGGGATGCA; hsa-Noxa reverse, GCACACTCGACTTCCAGCTACTT. ACAGCTTTGAGGTTCGTGTT; p53 forward, TCAGTCTGAGTCAGGCCC; p53 reverse.

The expression level of the gene of interest was normalized to that of TATA box binding protein in all samples expect for analysis of p53 that was normalised to actin. Relative quantification of gene expression was performed with the comparative cycle threshold method (Applied Biosystems, User Bulletin no 2, 1997).

p53 status of cell lines used

SH-SY5Y cells contain wild type p53 (Paulsen et al., 2006). The CHO-m3 cell line used was derived from CHO-K1 cells which are described to contain a mutant of p53 at codon 211 (T211K) (Hu et al., 1999). Point mutations at this codon are observed very rarely in primary human tumors (41 reported cases in more than 27,000 identified p53 mutations, see p53 mutation database, http://p53.free.fr/Database/p53_database.html.) indicating that this mutation is not significant for tumour biology. A recent study revealed that the codon 211 mutants of p53 have subtly different transactivator properties than wild type receptor (Kakudo et al., 2005). It is, therefore, possible that the effects of this mutation mean that high concentrations of etoposide (e.g. 250μM) are necessary to obtain caspase activation in CHO-m3 cells.


Supplementary Material Supplementary Material Click here for additional data file (NIHMS5201-supplement-1.pdf)


Acknowledgements

The authors would like to thank the Wellcome Trust for their support (Grants 073480 and 047600).


Abbreviations
CHO Chinese hamster ovary
GPCR G-protein coupled receptor
ERK extracellular regulated protein kinase
MAP kinase mitogen activated protein kinase
PLC phospholipase C
PKA protein kinase A
PKC protein kinase C

References
Bean LJ,Stark GR. Phosphorylation of serines 15 and 37 is necessary for efficient accumulation of p53 following irradiation with UVOncogeneYear: 20012010768411314044
Bode AM,Dong Z. Post-translational modification of p53 in tumorigenesisNat Rev CancerYear: 2004479380515510160
Bourdon JC. p53 and its isoforms in cancerBr J CancerYear: 2007972778217637683
Brooks CL,Gu W. Ubiquitination, phosphorylation and acetylation: the molecular basis for p53 regulationCurr Opin Cell BiolYear: 2003151647112648672
Brown JM,Attardi LD. The role of apoptosis in cancer development and treatment responseNat Rev CancerYear: 20055231715738985
Budd DC,McDonald J,Emsley N,Cain K,Tobin AB. The C-terminal tail of the M3-muscarinic receptor possesses anti-apoptotic propertiesJ Biol ChemYear: 2003278195657312649280
Budd DC,Spragg EJ,Ridd K,Tobin AB. Signalling of the M3-muscarinic receptor to the anti-apoptotic pathwayBiochem JYear: 200438143915068397
Chao C,Saito S,Anderson CW,Appella E,Xu Y. Phosphorylation of murine p53 at ser-18 regulates the p53 responses to DNA damageProc Natl Acad Sci U S AYear: 200097119364111035798
Chehab NH,Malikzay A,Stavridi ES,Halazonetis TD. Phosphorylation of Ser-20 mediates stabilization of human p53 in response to DNA damageProc Natl Acad Sci U S AYear: 199996137778210570149
Chen CK,Burns ME,Spencer M,Niemi GA,Chen J,Hurley JB,et al. Abnormal photoresponses and light-induced apoptosis in rods lacking rhodopsin kinaseProc Natl Acad Sci U S AYear: 19999637182210097103
Chipuk JE,Green DR. p53’s believe it or not: lessons on transcription-independent deathJ Clin ImmunolYear: 2003233556114601643
Chitaley K,Wingard CJ,Clinton Webb R,Branam H,Stopper VS,Lewis RW,et al. Antagonism of Rho-kinase stimulates rat penile erection via a nitric oxide-independent pathwayNat MedYear: 200171192211135626
Courtois S,de Fromentel CC,Hainaut P. p53 protein variants: structural and functional similarities with p63 and p73 isoformsOncogeneYear: 200423631814737098
Cui H,Schroering A,Ding HF. p53 mediates DNA damaging drug-induced apoptosis through a caspase-9-dependent pathway in SH-SY5Y neuroblastoma cellsMol Cancer TherYear: 200216798612479364
Dale LB,Bhattacharya M,Anborgh PH,Murdoch B,Bhatia M,Nakanishi S,et al. G protein-coupled receptor kinase-mediated desensitization of metabotropic glutamate receptor 1A protects against cell deathJ Biol ChemYear: 2000275382132010982802
De Sarno P,Shestopal SA,King TD,Zmijewska A,Song L,Jope RS. Muscarinic receptor activation protects cells from apoptotic effects of DNA damage, oxidative stress, and mitochondrial inhibitionJ Biol ChemYear: 2003278110869312538580
De Sarno P,Shestopal SA,Zmijewska AA,Jope RS. Anti-apoptotic effects of muscarinic receptor activation are mediated by Rho kinaseBrain ResYear: 20051041112515804506
DeFea KA,Vaughn ZD,O’Bryan EM,Nishijima D,Dery O,Bunnett NW. The proliferative and antiapoptotic effects of substance P are facilitated by formation of a beta -arrestin-dependent scaffolding complexProc Natl Acad Sci U S AYear: 200097110869110995467
Diao CT,Li L,Lau SY,Wong TM,Wong NS. kappa-Opioid receptor potentiates apoptosis via a phospholipase C pathway in the CNE2 human epithelial tumor cell lineBiochim Biophys ActaYear: 20001499496211118638
Dorsam RT,Gutkind JS. G-protein-coupled receptors and cancerNat Rev CancerYear: 20077799417251915
Dumont P,Leu JI,Della Pietra AC 3rd,George DL,Murphy M. The codon 72 polymorphic variants of p53 have markedly different apoptotic potentialNat GenetYear: 2003333576512567188
Erster S,Mihara M,Kim RH,Petrenko O,Moll UM. In vivo mitochondrial p53 translocation triggers a rapid first wave of cell death in response to DNA damage that can precede p53 target gene activationMol Cell BiolYear: 20042467284115254240
Fang X,Yu S,LaPushin R,Lu Y,Furui T,Penn LZ,et al. Lysophosphatidic acid prevents apoptosis in fibroblasts via G(i)-protein-mediated activation of mitogen-activated protein kinaseBiochem JYear: 2000352Pt 11354311062066
Haupt S,Haupt Y. Importance of p53 for cancer onset and therapyAnticancer DrugsYear: 2006177253216926623
Hu T,Miller CM,Ridder GM,Aardema MJ. Characterization of p53 in Chinese hamster cell lines CHO-K1, CHO-WBL, and CHL: implications for genotoxicity testingMutat ResYear: 1999426516210320750
Kakudo Y,Shibata H,Otsuka K,Kato S,Ishioka C. Lack of correlation between p53-dependent transcriptional activity and the ability to induce apoptosis among 179 mutant p53sCancer ResYear: 20056521081415781620
Klabunde T,Hessler G. Drug design strategies for targeting G-protein-coupled receptorsChembiochemYear: 200239284412362358
Koh JY,Palmer E,Cotman CW. Activation of the metabotropic glutamate receptor attenuates N-methyl-D-aspartate neurotoxicity in cortical culturesProc Natl Acad Sci U S AYear: 199188943151658782
Komarov PG,Komarova EA,Kondratov RV,Christov-Tselkov K,Coon JS,Chernov MV,et al. A chemical inhibitor of p53 that protects mice from the side effects of cancer therapyScienceYear: 19992851733710481009
Kwon YG,Min JK,Kim KM,Lee DJ,Billiar TR,Kim YM. Sphingosine 1-phosphate protects human umbilical vein endothelial cells from serum-deprived apoptosis by nitric oxide productionJ Biol ChemYear: 2001276106273311134047
Lambert PF,Kashanchi F,Radonovich MF,Shiekhattar R,Brady JN. Phosphorylation of p53 serine 15 increases interaction with CBPJ Biol ChemYear: 199827333048539830059
Li DW,Liu JP,Schmid PC,Schlosser R,Feng H,Liu WB,et al. Protein serine/threonine phosphatase-1 dephosphorylates p53 at Ser-15 and Ser-37 to modulate its transcriptional and apoptotic activitiesOncogeneYear: 20062530062216501611
Marchenko ND,Zaika A,Moll UM. Death signal-induced localization of p53 protein to mitochondria. A potential role in apoptotic signalingJ Biol ChemYear: 2000275162021210821866
Marinissen MJ,Gutkind JS. G-protein-coupled receptors and signaling networks: emerging paradigmsTrends Pharmacol SciYear: 2001223687611431032
Meek DW. Mechanisms of switching on p53: a role for covalent modification?OncogeneYear: 19991876667510618706
Miyashita T,Krajewski S,Krajewska M,Wang HG,Lin HK,Liebermann DA,et al. Tumor suppressor p53 is a regulator of bcl-2 and bax gene expression in vitro and in vivoOncogeneYear: 1994917998058183579
Moll UM,Wolff S,Speidel D,Deppert W. Transcription-independent pro-apoptotic functions of p53Curr Opin Cell BiolYear: 200517631616226451
Murga C,Laguinge L,Wetzker R,Cuadrado A,Gutkind JS. Activation of Akt/protein kinase B by G protein-coupled receptors. A role for alpha and beta gamma subunits of heterotrimeric G proteins acting through phosphatidylinositol-3-OH kinasegammaJ Biol ChemYear: 19982731908059668091
Murph MM,Hurst-Kennedy J,Newton V,Brindley DN,Radhakrishna H. Lysophosphatidic acid decreases the nuclear localization and cellular abundance of the p53 tumor suppressor in A549 lung carcinoma cellsMol Cancer ResYear: 2007512011118025263
Nakano K,Vousden KH. PUMA, a novel proapoptotic gene, is induced by p53Mol CellYear: 200176839411463392
Nemajerova A,Erster S,Moll UM. The post-translational phosphorylation and acetylation modification profile is not the determining factor in targeting endogenous stress-induced p53 to mitochondriaCell Death DifferYear: 20051219720015550936
Oda E,Ohki R,Murasawa H,Nemoto J,Shibue T,Yamashita T,et al. Noxa, a BH3-only member of the Bcl-2 family and candidate mediator of p53-induced apoptosisScienceYear: 20002881053810807576
Park BS,Song YS,Yee SB,Lee BG,Seo SY,Park YC,et al. Phospho-ser 15-p53 translocates into mitochondria and interacts with Bcl-2 and Bcl-xL in eugenol-induced apoptosisApoptosisYear: 20051019320015711935
Paulsen MT,Starks AM,Derheimer FA,Hanasoge S,Li L,Dixon JE,et al. The p53-targeting human phosphatase hCdc14A interacts with the Cdk1/cyclin B complex and is differentially expressed in human cancersMol CancerYear: 200652516784539
Sakaguchi K,Herrera JE,Saito S,Miki T,Bustin M,Vassilev A,et al. DNA damage activates p53 through a phosphorylation-acetylation cascadeGenes DevYear: 1998122831419744860
Sayan BS,Sayan AE,Knight RA,Melino G,Cohen GM. p53 is cleaved by caspases generating fragments localizing to mitochondriaJ Biol ChemYear: 2006281135667316531411
Shieh SY,Ikeda M,Taya Y,Prives C. DNA damage-induced phosphorylation of p53 alleviates inhibition by MDM2CellYear: 199791325349363941
Siliciano JD,Canman CE,Taya Y,Sakaguchi K,Appella E,Kastan MB. DNA damage induces phosphorylation of the amino terminus of p53Genes DevYear: 1997113471819407038
Song P,Sekhon HS,Lu A,Arredondo J,Sauer D,Gravett C,et al. M3 muscarinic receptor antagonists inhibit small cell lung carcinoma growth and mitogen-activated protein kinase phosphorylation induced by acetylcholine secretionCancer ResYear: 20076739364417440109
Strom E,Sathe S,Komarov PG,Chernova OB,Pavlovska I,Shyshynova I,et al. Small-molecule inhibitor of p53 binding to mitochondria protects mice from gamma radiationNat Chem BiolYear: 20062474916862141
Tibbetts RS,Brumbaugh KM,Williams JM,Sarkaria JN,Cliby WA,Shieh SY,et al. A role for ATR in the DNA damage-induced phosphorylation of p53Genes DevYear: 19991315279925639
Tobin AB,Budd DC. The anti-apoptotic response of the Gq/11-coupled muscarinic receptor familyBiochem Soc TransYear: 2003311182514641022
Ullrich SJ,Mercer WE,Appella E. Human wild-type p53 adopts a unique conformational and phosphorylation state in vivo during growth arrest of glioblastoma cellsOncogeneYear: 199271635431630823
Unger T,Juven-Gershon T,Moallem E,Berger M,Vogt Sionov R,Lozano G,et al. Critical role for Ser20 of human p53 in the negative regulation of p53 by Mdm2Embo JYear: 19991818051410202144
van Koppen CJ,Kaiser B. Regulation of muscarinic acetylcholine receptor signalingPharmacol TherYear: 20039819722012725869
Vichalkovski A,Baltensperger K,Thomann D,Porzig H. Two different pathways link G-protein-coupled receptors with tyrosine kinases for the modulation of growth and survival in human hematopoietic progenitor cellsCell SignalYear: 2005174475915601623
Vogelstein B,Lane D,Levine AJ. Surfing the p53 networkNatureYear: 20004083071011099028
Vousden KH,Lu X. Live or let die: the cell’s response to p53Nat Rev CancerYear: 2002259460412154352
Yan GM,Lin SZ,Irwin RP,Paul SM. Activation of muscarinic cholinergic receptors blocks apoptosis of cultured cerebellar granule neuronsMol PharmacolYear: 199547248577870032
Yu J,Zhang L,Hwang PM,Rago C,Kinzler KW,Vogelstein B. Identification and classification of p53-regulated genesProc Natl Acad Sci U S AYear: 199996145172210588737
Zhou Y,Larsen PH,Hao C,Yong VW. CXCR4 Is a Major Chemokine Receptor on Glioma Cells and Mediates Their SurvivalJ. Biol. ChemYear: 2002277494814948712388552
Zhu WZ,Zheng M,Koch WJ,Lefkowitz RJ,Kobilka BK,Xiao RP. Dual modulation of cell survival and cell death by beta(2)-adrenergic signaling in adult mouse cardiac myocytesProc Natl Acad Sci U S AYear: 20019816071211171998

Article Categories:
  • Article

Keywords: Apoptosis, p53, muscarinic, G-protein coupled receptor, M3-muscarinic, phosphorylation, mitochondria, SH-SY5Y.

Previous Document:  Nedd9/Hef1/Cas-L mediates the effects of environmental pollutants on cell migration and plasticity.
Next Document:  Rb2/p130 is the dominating pocket protein in the p53-p21 DNA damage response pathway leading to sene...