Document Detail

Participation of the oviductal s100 calcium binding protein G in the genomic effect of estradiol that accelerates oviductal embryo transport in mated rats.
Jump to Full Text
MedLine Citation:
PMID:  21605449     Owner:  NLM     Status:  Publisher    
Abstract/OtherAbstract:
ABSTRACT: BACKGROUND: Mating changes the mechanism by which E2 regulates oviductal egg transport, from a non-genomic to a genomic mode. Previously, we found that E2 increased the expression of several genes in the oviduct of mated rats, but not in unmated rats. Among the transcripts that increased its level by E2 only in mated rats was the one coding for an s100 calcium binding protein G (s100g) whose functional role in the oviduct is unknown. METHODS: Herein, we investigated the participation of s100g on the E2 genomic effect that accelerates oviductal transport in mated rats. Thus, we determined the effect of E2 on the mRNA and protein level of s100g in the oviduct of mated and unmated rats. Then, we explored the effect of E2 on egg transport in unmated and mated rats under conditions in which s100g protein was knockdown in the oviduct by a morpholino oligonucleotide against s100g (s100g-MO). In addition, the localization of s100g in the oviduct of mated and unmated rats following treatment with E2 was also examined. RESULTS: Expression of s100g mRNA progressively increased at 3-24 h after E2 treatment in the oviduct of mated rats while in unmated rats s100g increased only at 12 and 24 hours. Oviductal s100g protein increased 6 h following E2 and continued elevated at 12 and 24 h in mated rats, whereas in unmated rats s100g protein increased at the same time points as its transcript. Administration of a morpholino oligonucleotide against s100g transcript blocked the effect of E2 on egg transport in mated, but not in unmated rats. Finally, immunoreactivity of s100g was observed only in epithelial cells of the oviducts of mated and unmated rats and it was unchanged after E2 treatment. CONCLUSIONS: Mating affects the kinetic of E2-induced expression of s100g although it not changed the cellular localization of s100g in the oviduct after E2. On the other hand, s100g is a functional component of E2 genomic effect that accelerates egg transport. These findings show a physiological involvement of s100g in the rat oviduct.
Authors:
Mariana Rios; Alexis Parada-Bustamante; Luis A Velasquez; Horacio B Croxatto; Pedro A Orihuela
Related Documents :
9342609 - Inhibitory effects of plasminogen fragment on experimentally induced neovascularization...
468799 - Characterization of a somatomedin (insulin-like growth factor) synthesized by fetal rat...
302789 - Biological activity of bullfrog growth hormone in the rat and the bullfrog (rana catesb...
22038359 - Antilithic effects of extracts from urtica dentata hand on calcium oxalate urinary ston...
21821959 - Antihypertensive and vasorelaxant effects of water-soluble proanthocyanidins from persi...
2862969 - Ventromedial and dorsomedial hypothalamic syndromes in the weanling rat: is the "center...
11219489 - Potent antitumor effects of intra-arterial injection of fibroblasts genetically enginee...
2253819 - The effect of early experience on water maze spatial learning and memory in rats.
1201819 - Early inhibition of hepatic bilirubin conjugation after paracetamol (acetaminophen) adm...
Publication Detail:
Type:  JOURNAL ARTICLE     Date:  2011-5-23
Journal Detail:
Title:  Reproductive biology and endocrinology : RB&E     Volume:  9     ISSN:  1477-7827     ISO Abbreviation:  -     Publication Date:  2011 May 
Date Detail:
Created Date:  2011-5-24     Completed Date:  -     Revised Date:  -    
Medline Journal Info:
Nlm Unique ID:  101153627     Medline TA:  Reprod Biol Endocrinol     Country:  -    
Other Details:
Languages:  ENG     Pagination:  69     Citation Subset:  -    
Export Citation:
APA/MLA Format     Download EndNote     Download BibTex
MeSH Terms
Descriptor/Qualifier:

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine

Full Text
Journal Information
Journal ID (nlm-ta): Reprod Biol Endocrinol
ISSN: 1477-7827
Publisher: BioMed Central
Article Information
Download PDF
Copyright ©2011 Ríos et al; licensee BioMed Central Ltd.
open-access:
Received Day: 5 Month: 2 Year: 2011
Accepted Day: 23 Month: 5 Year: 2011
collection publication date: Year: 2011
Electronic publication date: Day: 23 Month: 5 Year: 2011
Volume: 9First Page: 69 Last Page: 69
ID: 3115850
Publisher Id: 1477-7827-9-69
PubMed Id: 21605449
DOI: 10.1186/1477-7827-9-69

Participation of the oviductal s100 calcium binding protein G in the genomic effect of estradiol that accelerates oviductal embryo transport in mated rats
Mariana Ríos1 Email: mrios@bio.puc.cl
Alexis Parada-Bustamante1 Email: aparada@uc.cl
Luis A Velásquez23 Email: luis.velasquez.c@usach.cl
Horacio B Croxatto234 Email: horacio.croxatto@usach.cl
Pedro A Orihuela23 Email: pedro.orihuela@usach.cl
1Unidad de Reproducción y Desarrollo, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Chile
2Laboratorio de Inmunología de la Reproducción, Facultad de Química y Biología, Universidad de Santiago de Chile, Chile
3Centro para el Desarrollo en Nanociencia y Nanotecnología-CEDENNA, Santiago, Chile
4Millennium Institute for Fundamental and Applied Biology, Santiago, Chile

Background

In mammals, the transport of the gametes, fertilization or preimplantation development depends on the oviduct functions [1]. In this context, the participation of ovarian hormones estradiol (E2) or progesterone (P) is crucial for the successful of these events. Oviduct malfunction may result in tubal ectopic pregnancy that still remains a potentially life-threatening condition in women [2]. Therefore, elucidation of the cellular and molecular mechanisms by which E2 and P regulate oviductal egg transport are essentials to fully understand the physiology of the tubal function.

In the rat, the duration of oviductal egg transport is dependent on ovarian hormones and mating-associated signals [3-5]. A single injection of E2 on day 1 of the cycle (unmated) or pregnancy (mated) shortens oviductal transport of eggs from the normal 72-96 h to less than 24 h [4,6]. However, E2 accelerates egg transport to the uterus through intraoviductal genomic pathways in mated rats and through nongenomic pathways in unmated rats [3,7]. Interestingly, both pathways require activation of estrogen receptors (ER) [8,9]. The intraoviductal nongenomic-signalling pathway of E2 has been well established and involves conversion of E2 to 2-methoxyestradiol (2ME) and sequential activation of cAMP-PKA and PLC-IP3 signalling pathways [5,8,10]. In contrast, little is known about the components of the E2 genomic signaling that accelerates embryo transport in the rat. Early works have shown that antagonists of Endothelin receptor type A or B inhibited the effect of E2 on embryo transport [11] while Connexin 43 uncouplers blocked the increase in the instant velocity of microsphere movement induced by E2 in mated rats [12]. Thus, the E2 genomic pathway involves participation of endothelin receptors (ETR) and functional integrity of gap junctions in the oviduct.

Previously, we have found by microarray analysis that E2 increased the expression of several genes in the oviduct of mated rats, but not in unmated rats [13]. These genes were s100 calcium binding protein G (s100 g), adenosine monophosphate deaminase 3 (Ampd3), cysteine rich protein 61(Cyr61) and tumour necrosis factor induced protein (Tnfip6) that are involved in remodelation of extracellular matrix, regulation of energetic metabolism or calcium transport in normal tissues or tumour cells [14-16]. In order to identify whether these genes are functional components of the E2 genomic pathway that accelerates embryo transport in mated rats, we first compared the mRNA level of these four transcripts between oviducts of unmated and mated rats treated with E2. We reasoned that genes whose level of expression increases in response to E2 in mated, but not in unmated rats are good candidates to further exploration. The results oriented us towards a possible involvement of s100 g transcript previously described as Calbindin-D9k. s100 g belongs to a family of intracellular proteins having high affinity for calcium and is expressed in a variety of mammalian tissues, i.e., intestine, uterus, kidney and bone [17-19] including the female reproductive tract [20,21]. Furthermore, estrogens up-regulates the expression of the mRNA [18] and protein [18] of s100 g in the uterus. Moreover, s100 g may control motile activity of smooth muscle through regulation of intracellular calcium level in the rat uterus [18]. Therefore, we investigated the participation of s100 g on the E2 genomic effect that accelerates oviductal embryo transport. For this purpose, we determined the time-course of the effect of E2 on the mRNA and protein level of s100 g in the oviduct of mated and unmated rats. Then, we explored the effect of E2 on egg transport in unmated and mated rats under conditions in which s100 g protein was knockdown in the oviduct by a morpholino oligonucleotide against s100 g (s100 g-MO). Finally, the localization of s100 g in the oviduct of mated and unmated rats following treatment with E2 was also examined.


Methods
Animals

Locally bred Sprague-Dawley rats were used. Animals were kept under controlled temperature (21-24°C) and lights were on from 07:00 to 21:00 h. Water and pelleted rat chow was supplied ad libitum. Daily vaginal smears were used to verify cycle regularity [22]. Females weighing 200-220 g were selected from among those having 4-day estrous cycles. Females in proestrus were either kept isolated or caged with fertile males. The following day (estrus) was designated as Day 1 of the cycle (C1) in the first instance and Day 1 of pregnancy (P1) in the second, provided spermatozoa were found in the vaginal smear of the later. The protocols on animal manipulation have been approved by the Ethical Committees of our National Fund of Science (CONICYT-FONDECYT 1080523).

Treatments
Systemic administration of E2

Rats on C1 or P1 were injected s.c. with 10 mu μg of E2 as a single dose dissolved in 0.1 mL of propylene glycol. Control rats received propylene glycol as the vehicle.

Local administration of morpholinos (MOs)

The following MOs were used: s100 g-MO, 5'CGC TCA TTT TTC TGT GCT GCT TGC T 3'; an irrelevant MO (standard control MO) 5'CCT CTT ACC TCA GTT ACA ATT TAT A 3'; and a Fluoresceinated -labeled standard control MO (FITC-MO). All MO were purchased from Gene Tools, LLC, Philomarth, OR. The MOs were prepared at a stock concentration of 10 mM in sterile water. For intraoviductal administration (i.o), 0.2 mu μl of Endo-Porter (non-toxic delivery mechanism from Gene Tools) was mixed with 2.8 mu μl of MO stock (28 nmoles). The MO/Endo-Porter mixture was vortexed and incubated for 20 min at room temperature, immediately prior to injection into each oviduct.

Animal surgery

Intraoviductal administration of MOs was done in the morning of C1 or P1 using a surgical microscope (OPMI 6-SDFC; Zeiss, Oberkochen, Germany) as previously described [3,7]. Since ovulation was completed at this time point, this treatment did not affect the number of oocytes that ovulated.

Assessment of egg transport

Animals were euthanized 24 hours after different treatments, and their oviducts were flushed individually with saline. Each flushing was examined under low-power magnification (25×). The number of eggs in both oviducts was recorded as a single datum. Attempts to recover eggs from the uterus and vagina with or without placing ligatures in the uterine horns have shown that the reduction in the number of oviductal oocytes following treatment with E2 corresponds to premature transport to the uterus [6]. Thus, we refer to it as E2-induced acceleration of oviductal transport.

Analysis of MO Uptake

Animals were euthanized 5 hours after i.o. administration of FITC-MO or standard control MO and their oviducts were excised and frozen in Tissue Freezing Medium (Electron Microscopy Sciences, Washington, PA). Five-micrometer thick frozen sections were fixed in ethanol 70% and mounted with Fluoromount G (Electronic Microscopy Science, Washington, PA), and then analyzed under an Optiphot Epifluoresence Microscope (Olympus, Middlebush, NJ).

Real-Time Polymerase Chain Reaction (qPCR)

Animals were euthanized and their oviducts were collected and flushed with saline. Total RNA was isolated using Trizol Reagent (Invitrogen Co., California, CA) and 1 mu μg of total RNA of each sample (2 oviducts from 1 rat) was treated with Dnase I Amplification grade (Invitrogen). The single-strand cDNA was synthesized by reverse transcription using the Superscript III Reverse Transcriptase First Strand System for RT-PCR (Invitrogen), according to the manufacturer's protocol. The Light Cycler instrument (Roche Diagnostics, GmbH Mannheim, Germany) was used to quantify the relative transcript level of s100 g, Ampd3, Cyr61 and Tnfip6 while Gapdh was chosen as the housekeeping gene for load control because we have previously demonstrated that E2 or pregnancy did not affect its expression [9,12]. The SYBR® Green I double-strand DNA binding dye (Roche Diagnostics) was the reagent of choice for these assays. The primers used in qPCR are listed in Table 1. All real time PCR assays were performed in duplicate. The thermal cycling conditions included an initial activation step at 95°C for 25 min, followed by 40 cycles of denaturizing and annealing-amplification (95°C for 15 sec, 60°C for 15 sec and 72°C for 30 sec) and finally one cycle of melting (95° to 60°C). To verify specificity of the product, amplified products were subject to melting curve analysis as well as electrophoresis, and product sequencing was performed to confirm identity using an ABI Prism 310 sequencer. The expression of s100 g, Ampd3, Cyr61, or Tnfip6 were determined using the equation: Y = 2-ΔCp where Y is the relative expression, Cp (crossing point) is the cycle in the amplification reaction in which fluorescence begins to be exponential above the background base line, -∆Cp is the result of subtracting Cp value of s100 g, AmpD3, Cyr61, or Tnfip6 from Cp value of Gapdh for each sample. In order to simplify the presentation of the data the relative expression values were multiplied by 103[23].

Western blot

Animals were euthanized and their oviducts were collected and flushed with saline. Total proteins were isolated, resolved by electrophoresis and electroblotted onto nitrocellulose membranes as previously described [8]. Nitrocellulose blots were blocked by incubation overnight at 4°C in TTBS (100 mM Tris/HCl pH 7.5, 150 mM NaCl and 0.05% v/v Tween 20) containing 5% nonfat dry milk. Afterward, blots were incubated with anti-rat antibodies for 1 h with a rabbit anti-rat s100 g (Swant, Bellinzona, Switzerland) or with a mouse anti-rat β-actin (clone JLA20, Calbiochem, La Jolla, CA) as load control because expression level does not change in the rat oviduct after E2 treatment [12] in 1:2500 or 1:5000 dilutions, respectively. Blots were rinsed 5 times for 5 min each in TBS (100 mM Tris/HCl pH 7.5, and 150 mM NaCl) and were incubated for 2 h in TTBS containing 1:5000 dilution of goat anti-rabbit or anti-mouse IgG horseradish peroxidase conjugate (Chemicon International, Temecula, CA). The horseradish peroxidase activity was detected by enhanced chemiluminescence using Western Lighting Chemiluminescence Reagent Plus (Perkin Elmer Life Sciences, Boston, MA). Negative controls consisting of oviductal samples without anti-s100 g or anti-β-actin were included. Protein extracts from immature rat uterus (18 days old) treated with E2 for 3 days were used as positive controls [24].

Immunohistochemistry

Animals were euthanized and their oviducts were fixed in Bouin's solution overnight. Paraffin embedded samples cut in 6 mu μm serial sections were deparaffinized, rehydrated, and boiled in 10 mM citrate buffer (pH 6.0), for antigen retrieval. Sections were then rinsed in phosphate-buffered saline (PBS) and endogenous peroxidase was blocked by incubation with 3% v/v H2O2 for 20 minutes. After rinsing with PBS, sections were incubated with 1% w/v Bovine Serum Albumin (BSA) in PBS at room temperature to prevent unspecific binding, and then incubated with anti-rat s100 g antibody 1:100 (Swant, Bellinzona, Switzerland) in a humidified chamber overnight. The slides were washed three times for 5 min with PBS and incubated for 1 h with blocking buffer containing goat anti-rabbit IgG conjugated to horseradish peroxidase 1:1000. The antigen-antibody complexes were visualized using 3,3'-diaminobenzidine tetrahydrochloride (DAB)/Metal concentrate (Pierce, Rockford, IL). All sections were lightly counter-stained with hematoxylin (Sigma-Aldrich), dehydrated, coverslipped, and observed under a phase contrast microscope (Optiphot-2, Nikon, Japan) and photographed with a digital camera (CoolPix 4500, Nikon, Japan). The specificity of immunoreactivity was assessed by omitting the first antibody or replacing it by preimmune serum. Negative controls showed no specific immunoreactivity.

Statistical Analyses

The results are presented as mean ± SE. Overall analysis was carried out using the Kruskal-Wallis test, followed by the Mann-Whitney test for pairwise comparisons when overall significance was detected. The actual N value in experiments to determine the effects of drugs on oviductal egg transport is the total number of rats used in each experimental group.


Results
Estradiol up-regulates the expression of s100 g and Ampd3 transcripts in the oviduct of mated but not of unmated rats

Here we determined the mRNA level of s100 g, Ampd3, Cyr61 and Tnfip6 in the oviducts of mated and unmated rats by quantitative RT-PCR. Rats on C1 (N = 5) or P1 (N = 5) were treated with E2 or vehicle and 3 h later oviducts were excised and their total RNA were processed by Real Time PCR.

Figure 1 shows that all four transcripts increased their mRNA level after E2 treatment in mated rats, but Cyr61 and Tnfip6 also increased in unmated animals. Thus, we choose s100 g for further exploration, leaving Ampd3 for future analysis.

Time-course of the effect of E2 on the mRNA and protein level of s100 g in the oviducts of mated and unmated rats

This experiment was designed to establish the level of s100 g mRNA and protein at different times following E2 treatment. Rats injected with 10 mu μg of E2 or vehicle on C1 (N = 5) or P1 (N = 5) were sacrificed at 3, 6, 12 or 24 hours after treatment and the oviducts were collected to measure the level of s100 g mRNA by Real Time PCR. Five rats were used for each time point. Other rats on C1 (N = 3) or P1 (N = 3) were treated with E2 10 mu μg and 0, 3, 6 12 or 24 hours after treatment the oviducts were excised and processed to determine the level of s100 g protein by western blot.

s100 g transcript showed progressively increasing levels in response to E2 throughout all time points examined in mated rats while in unmated rats s100 g increased only at 12 and 24 hours after treatment (Figure 2). On the other hand, s100 g protein increased 6 hours after treatment with E2 and continued elevated at 12 and 24 hours in mated rats, whereas in unmated rats s100 g protein increased at the same time points as its transcript (Figure 3).

Assessment of MOs uptake

In order to confirm that oviductal cells took up MOs, 3 rats on C1 were injected with 3 mu μl of FITC-MO/Endo Porter mixture into one oviduct and with Endo-Porter alone in the contralateral side. Five hours later oviducts were collected, frozen and sectioned for examination in a fluorescence microscope.

Strong fluorescence representing cellular uptake of FITC-MO was observed in the luminal epithelium demonstrating penetration of MO in these cells in vivo. No fluorescence was observed in the contra lateral oviduct, which was treated with vehicle alone (Figure 4).

Effect of intraoviductal administration of s100 g-MO on E2-induced egg transport acceleration in mated and unmated rats

This experiment was designed to determine whether i.o. administration of s100 g-MO can inhibit acceleration of oviductal egg transport induced by E2. Rats on C1 (N = 5) or P1 (N = 7) were injected i.o. with MO/Endo-Porter mixture (s100 g-MO or standard control MO) and three hours later 10 mu μg of E2 was injected s.c. This dose of E2 accelerates oviductal transport consistently in mated and unmated rats [3,6]. A control group was included that was treated with standard control MO and the vehicle of E2. Twenty-four hours after i.o. administration the animals were autopsied and the number of eggs was determined as described above. To confirm that s100 g-MO effectively knockdown expression of s100 g protein in the oviduct, other rats on C1 or P1 were i.o. injected with s100 g-MO or standard control MO and 3 hours later E2 10 mu μg or vehicle was injected s.c to these rats. Twenty-four hours after i.o. injection oviducts were obtained to determine s100 g level by western blot.

The mean number of eggs recovered from the oviducts of the control group (vehicle of E2 + standard control MO) was 7.6 ± 1,1 and 10.2 ± 1.2 in unmated and mated rats, respectively. As expected, E2 reduced the number of oviductal eggs in unmated rats (0.6 ± 0.6) and in mated rats (1.6 ± 0.8). Local administration of s100 g-MO partially blocked the effect of E2 in mated, but not in unmated rats, 4.9 ± 0.8 and 1.7 ± 1.1 respectively (Figure 5). On the other hand, no changes in the rate of preimplantation embryo development were noticed in the oviducts from mated rats treated with the morpholino s100 g- MO (data not shown).

Intraoviductally administration of s100 g-MO partially reduced the increase of s100 g protein level induced by E2 in mated rats while s100 g-MO had no effect in unmated rats, as the level of s-100 g 24 hours after E2 was unchanged in comparison with vehicle-treated rats (Figure 6).

Localization of s100 g protein in the oviduct of unmated and mated rats treated with E2

Here we determined whether mating or E2 treatment changes localization of s100 g protein in the oviduct. Rats injected with 10 mu μg of E2 on C1 (N = 3) or P1 (N = 3) were sacrificed at 12 hours after treatment and their oviducts were collected and fixed in Bouin's solution and processed by immunohistochemistry as described above.

s100 g immunoreactivity was observed only in epithelial cells of the oviducts of C1 and P1 and it was unchanged following E2 treatment (Figure 7).


Discussion

Mating changes the mechanism of action by which E2 regulates oviductal egg transport, from a non-genomic to a genomic mode. This changes in pathways has been denominated "intracellular path shifting" (IPS) and reflects a functional plasticity in well-differentiated cells. Although, microarray analysis showed that s100 g, Ampd3, Cyr61 and Tnfip6 transcripts increased their level only in the E2-treated oviducts of mated, but not in unmated rats [13] confirmation by quantitative RT-PCR demonstrated that Cyr61 and Tnfip6 increased their level in response to E2 in both group of rats. Therefore, we consider that s100 g and Ampd3 were only up-regulated by E2 in the oviducts of mated rats while Cyr61 and Tnfip6 are up-regulated in both physiological conditions. On the other hand, these findings show for the first time evidence that E2 regulates expression of Ampd3, Cyr61 and Tnfip6 in the mammalian oviduct and that mating-associated signals stimulate the response of s100 g and Ampd3 to E2 in the rat oviduct. However, the functional relevance of Ampd3, Cyr61 and Tnfip6 in the oviductal physiology was not explored in this work.

Despite of s100 g and Ampd3 genes are potential candidates to participate in the intraoviductal E2 genomic effect that accelerates egg transport in mated rats we elected explore the participation of s100 g because it is known that is regulated by E2 in several mammalian tissues including female reproductive tract [20,25]. According with this, we found that mRNA and protein level of s100 g increased in response to E2 in the oviducts of mated and unmated rats. However, the effect of E2 was evidenced much earlier in mated rats than in unmated showing that mating-associated signals changes the kinetic of transcription or translation of s100 g. Estradiol exerts its effects after binding to ER in the nucleus, inducing a conformational change and relocation of co-regulators proteins that permits the association of the E2-ER complex to estrogens-responsive elements (ERE) in the DNA [26]. In the rat, the regulation of s100 g is mediated by an ERE located at the first intron of this gene [27]. The mechanism of distinct regulation of oviductal s100 g between mated and unmated rats is not clear. Probably, mating removes some co-regulator proteins that prevent the transcription of s100 g or there are differences in the stability of the s100 g mRNA or protein in the oviductal cells of mated and unmated rats, but all of this needs further exploration. On the other hand, rat oviductal level of s100 g throughout the estrous cycle or early pregnancy remains undetermined.

The administration of s100 g-MO directly into the oviductal lumen revealed that E2-induced expression of s100 g protein is essential for the E2 genomic pathway that accelerates oviductal embryo transport. The effect of s100 g-MO on accelerated egg transport was only partial in accordance with the fact that expression of the s100 g protein in the oviduct of mated rats was partially blocked by the morpholino. This may attributable to insufficiency of the dose administered-a dose chosen because higher doses could not be dissolved in the small volume that can be injected to the oviductal lumen. Furthermore, On the other hand, local injection of s100 g-MO to unmated rats neither affected the E2-induced egg transport acceleration nor the expression of s100 g protein in the oviduct. In contrast to previously observed (Figure 3) E2 did not increase the level of s100 g protein in the oviduct of unmated rats 24 h after treatment with standard control MO (Figure 6). This may be explained because in this particular group of rats, oviductal cells were more affected or damaged by the intraoviductal injection blunting the effect of E2 on expression of s100 g in the oviduct. Therefore, we cannot discard the participation of s100 g in the E2 non-genomic pathway that accelerates egg transport in unmated rats. Probably, others routes of administration of the morpholino would be required in unmated rats, but this was not done.

Although, it has been shown that in the mouse endometrial s100 g is critical for embryo implantation [25] the role of oviductal s100 g in the embryo development is unknown. Since, we did not notice any change in the development of early embryos flushed out of the oviducts from mated rats treated with E2 and the morpholino s100 g- MO we could speculate that morpholino s100 g did not affect preimplantation embryo development.

Previous works have shown that s100 g protein was localized exclusively in the epithelial cells of the rat oviduct [18]. Here, we report that mating did not affect the cellular localization of this molecule as well as the response to E2 suggesting that the role of s100 g in the E2 genomic pathway is not explained by a change in the localization of s100 g in the oviduct. Since the proportion between ciliated and secretory cells varies in the oviductal epithelial cells it is probable that mating-associated signals could have acted differentially on these two types of cells. Ultrastructural studies using immunoelectron microscopy needs to be done to resolve this issue.

In other tissues s100 g enhance Ca2+ transport and increase in the cells capacity to store Ca2+[28,29]. In the uterus, s100 g may be involved in controlling myometrial activity related to regulation of the Ca2+ level [20,28]. Furthermore, a role of endometrial s100 g in the embryo implantation was previously reported [25]. Since, E2 genomic pathway that control oviductal egg transport requires participation of calcium-dependent molecules such as ETR and Cx43 [11,12] we postulate that oviductal s100 g signalling initiated in the epithelial cells could modulate expression or activity of ETR and Cx43 to regulate contractile activity in the oviduct necessary for the embryo movement.


Conclusions

Mating changes the kinetic of E2-induced expression of s100 g in the oviduct although cellular localization of s100 g was not affected by mating following E2 treatment. Furthermore, the E2 intraoviductal genomic pathway that accelerates embryo transport in mated rats requires functional participation of s100 g. These findings provide evidence of a physiological involvement of s100 g in the rat oviduct.


Competing interests

The authors declare that they have no competing interests.


Authors' contributions

MR participated in the design of the study, performed the sampling of the animals, carried out the Real-Time PCR, intraoviductal injections of drugs and assessment of the egg transport. APB collaborated in the design of the studies of the western blot and immunohistochemistry of s100 g. LV and HBC participated in planning experiments and contributed to drafting the manuscript. PAO participated in the design of the study, in directing and completing all experimental analysis and in writing the manuscript. All authors have read and approved the final manuscript.


Acknowledgements

This work was supported by grants received from FONDECYT 1030315, 1080523, PROGRESAR (PRE 004/2003) and Proyecto BASAL FB0807.


References
Pauerstein CJ,Eddy CA,The role of the oviduct in reproduction; our knowledge and our ignoranceJ Reprod FertilYear: 19795522322910.1530/jrf.0.0550223370380
Nama V,Manyonda I,Tubal ectopic pregnancy: diagnosis and managementArch Gynecol ObstetYear: 200927944345310.1007/s00404-008-0731-318665380
Orihuela PA,Ríos M,Croxatto HB,Disparate effects of estradiol on egg transport and oviductal protein synthesis in pregnant and cyclic ratsBiol ReprodYear: 2001651232123710.1095/biolreprod65.4.123211566748
Orihuela PA,Croxatto HB,Acceleration of oviductal transport of oocytes induced by estradiol in cycling rats is mediated by nongenomic stimulation of protein phosphorylation in the oviductBiol ReprodYear: 2001651238124510.1095/biolreprod65.4.123811566749
Parada-Bustamante A,Orihuela PA,Ríos M,Navarrete-Gómez PA,Cuevas CA,Velasquez LA,Villalón MJ,Croxatto HB,Catechol-o-methyltransferase and methoxyestradiols participate in the intraoviductal nongenomic pathway through which estradiol accelerates egg transport in cycling ratsBiol ReprodYear: 20077793494110.1095/biolreprod.107.06162217699737
Ortiz ME,Villalón M,Croxatto HB,Ovum transport and fertility following post-ovulatory treatment with estradiol in ratsBiol ReprodYear: 1979211163116710.1095/biolreprod21.5.1163518944
Ríos M,Orihuela PA,Croxatto HB,Intraoviductal administration of ribonucleic acid from estrogen-treated rats mimics the effect of estrogen on ovum transportBiol ReprodYear: 19975627928310.1095/biolreprod56.1.2799002661
Orihuela PA,Parada-Bustamante A,Cortés PP,Gatica C,Croxatto HB,Estrogen Receptor, Cyclic Adenosine Monophosphate, and Protein Kinase A Are Involved in the Nongenomic Pathway by Which Estradiol Accelerates Oviductal Oocyte Transport in Cyclic RatsBiol ReprodYear: 2003681225123112606351
Orihuela PA,Zuñiga LM,Rios M,Parada-Bustamante A,Sierralta WD,Velásquez LA,Croxatto HB,Mating changes the subcellular distribution and the functionality of estrogen receptors in the rat oviductReprod Biol EndocrinolYear: 2009713910.1186/1477-7827-7-13919948032
Orihuela PA,Parada-Bustamante A,Zuñiga LM,Croxatto HB,Inositol triphosphate participates in an oestradiol nongenomic signalling pathway involved in accelerated oviductal transport in cycling ratsJ EndocrinolYear: 200618857958810.1677/joe.1.0644816522737
Parada AA,Maisey K,Forcelledo ML,Velásquez LA,Orihuela PA,Croxatto HB,Mating modifies the participation of endothelin in the effect of estradiol on egg transport in the ratProgram of the 18th annual meeting of the Latinoamerican Association of Investigators in Human ReproductionYear: 2003La Habana, Cuba Abstract-R22.
Ríos M,Hermoso M,Sánchez TM,Croxatto HB,Villalón MJ,Effect of oestradiol and progesterone on the instant and directional velocity of microsphere movements in the rat oviduct: gap junctions mediate the kinetic effect of oestradiolReprod Fertil DevYear: 20071963464010.1071/RD0614617601411
Parada-Bustamante A,Orihuela PA,Rios M,Cuevas CA,Oróstica ML,Velasquez LA,Villalón MJ,Croxatto HB,A non-genomic signaling pathway shut down by mating changes the estradiol-induced gene expression profile in the rat oviductReproductionYear: 201013963164410.1530/REP-09-021820032209
Szydlowska M,Roszkowska A,Expression patterns of AMP-deaminase isozymes in human hepatocellular carcinoma (HCC)Mol Cell BiochemYear: 20083181510.1007/s11010-008-9773-x18493842
Deng Y,Chang J,Yeh C,Cheng S,Kuo M,Arecoline stimulated Cyr61 production in human gingival epithelial cells: Inhibition by lovastatinOral OncolYear: 20114725626110.1016/j.oraloncology.2011.01.00521317023
Mukhopadhyay D,Asari A,Rugg MS,Day AJ,Fülöp C,Specificity of the tumor necrosis factor-induced protein 6-mediated heavy chain transfer from inter-a-trypsin inhibitor to hyaluronanJ Biol ChemYear: 200427911191128
Armbrecht HJ,Boltz M,Strong R,Richardson A,Bruns DE,Bruns ME,Christiakos S,Expression of calbindin-D decreases with age in intestine and kidneyEndocrinologyYear: 19891252950295610.1210/endo-125-6-29502583050
Mathieu CL,Mills SE,Burnett SH,Cloney DL,Bruns DE,Bruns ME,The presence and estrogen control of immunoreactive calbindin-D9k in the fallopian tube of the ratEndocrinologyYear: 19891252745275010.1210/endo-125-5-27452676491
Seifert MF,Gray RW,Bruns ME,Elevated levels of vitamin D-dependent calcium-binding protein (calbindin-D9k) in the osteosclerotic (oc) mouseEndocrinologyYear: 19881221067107310.1210/endo-122-3-10673342744
Choi KC,Leung PCK,Jeung EB,Biology and physiology of calbindin-D9k in female reproductive tissues: Involvement of steroids and endocrine disruptorsReprod Biol EndocrinolYear: 200536610.1186/1477-7827-3-6616288660
L'Horset F,Blin C,Brehier A,Thomasset M,17 beta-estradiol stimulates the calbindin-D9k (CaB9K) gene expression in the rat uterus during the estrous cycle: late antagonistic effect of progesteroneEndocrinologyYear: 19901272891289710.1210/endo-127-6-28912249631
Turner CD,Endocrinology of the ovaryGeneral EndocrinologyYear: 19613Saunders WB Company. Philadelphia365409
Livak KJ,Schmittgen TD,Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) methodMethodsYear: 20012540240810.1006/meth.2001.126211846609
Lee GS,Kim HJ,Jung YW,Choi KC,Jeung EB,Estrogen receptor pathway is involved in the regulation of calbindin-D9k in the uterus of immature ratsToxicol SciYear: 20058427027710.1093/toxsci/kfi07215635152
Luu KC,Nie GY,Salamonsen LA,Endometrial calbindins are critical for embryo implantation: evidence from in vivo use of morpholino antisense aligonucleotidesProc Natl Acad Sci USAYear: 20042180288033
O'Malley B,The year in basic science: nuclear receptors and coregulatorsMol EndocrinolYear: 2008222751275610.1210/me.2008-029718845672
Darwish H,Krisinger J,Furlow JD,Smith C,Murdoch FE,DeLuca HF,An estrogen-responsive element mediates the transcriptional regulation of calbindin D-9k gene in rat uterusJ Biol ChemYear: 19912665515581985915
Linse S,Brodin P,Drakenberg T,Thulin E,Sellers P,Elmden K,Grundstrom T,Forsen S,Structure-function relationships in EF-hand Ca2+-binding proteins. Protein engineering and biophysical studies of calbindin D9kBiochemistryYear: 1987266723673510.1021/bi00395a0232827733
Andersson M,Malmendal A,Linse S,Ivarsson I,Forsén S,Svensson LA,Structural basis for the negative allostery between Ca(2+)- and Mg(2+)-binding in the intracellular Ca(2+)-receptor calbindin D9kProtein SciYear: 1997611394710.1002/pro.55600606029194174

Figures

[Figure ID: F1]
Figure 1 

Expression of s100 g, Ampd3, cyr61 or Tnfip6 in unmated (C) or mated (P) rat oviducts treated with E2. Real-time quantitative RT-PCR analysis was done 3 hours after treatment with 10 mu μg of E2 or vehicle (V). N = 5 animals per group. Different letters are significantly different from each other within each graph. a ≠ b, p < 0.05.



[Figure ID: F2]
Figure 2 

Time course of s100 g mRNA level in the rat oviduct after estradiol (E2) treatment. Unmated and mated rats were treated with 10 mu μg of E2 or vehicle and 3, 6, 12 or 24 hours later, s100 g mRNA level was determined using real-time quantitative RT-PCR. N = 5 animals per group. Different letters are significantly different from each other within each graph. a ≠ b, p < 0.05.



[Figure ID: F3]
Figure 3 

Time course of s100 g protein level in the rat oviduct after treatment with estradiol (E2). Unmated and mated rats were treated with 10 mu μg of E2 or vehicle (V) and 3, 6, 12 or 24 hours later s100 g protein level was determined using immunoblotting analysis. N = 3 animals per group. Different letters are significantly different from each other within each graph. a ≠ b, p < 0.05.



[Figure ID: F4]
Figure 4 

Cellular uptake of the FITC-MO in the rat oviduct. Photomicrographs of rat sections after 5 hours of intraoviductal injection of FITC-MO/Endo Porter mixture (A) or Endo-Porter alone (B). Note that arrows point strong green fluorescence representing cellular uptake of FITC-MO mainly in the luminal epithelium demonstrating penetration of MO in these cells in vivo. e = epithelium, sm = smooth muscle, L = lumen.



[Figure ID: F5]
Figure 5 

Effect of s100 g-MO on E2-induced egg transport acceleration. Number of eggs recovered from oviducts of unmated and mated rats 24 hours after intraoviductal (i.o.) administration of s100 g-MO, standard control-MO (Ct-MO) or vehicle (V) followed 3 hours later by a s.c. injection of 10 mu μg of estradiol (E2) or V. The number of animals per group was 5 in unmated and 7 in mated rats. Different letters are significantly different from each other within each graph. a ≠ b ≠ c, p < 0.05.



[Figure ID: F6]
Figure 6 

Effect of s100 g-MO on oviductal s100g. Level of s100 g protein in the oviduct of unmated and mated rats following intraoviductal (i.o.) administration of s100 g-MO, standard control-MO (Ct-MO) or vehicle (V) followed 3 hours later by a s.c. injection of 10 mu μg of estradiol (E2) or V. s100 g protein level was determined using immunoblotting analysis. N = 3 animals per group. Different letters are significantly different from each other within each graph. a ≠ b ≠ c, p < 0.05.



[Figure ID: F7]
Figure 7 

Cellular localization of s100 g in E2-treated rat oviducts. Photomicrographs of unmated (A-C) and mated (E-F) rat oviducts 12 h after injecting vehicle (A, D) or E2(B, E). Arrows point to immunoreactivity of s100 g present only in epithelial cells. The specificity of immunoreactivity was confirmed by omitting the first antibody or replacing by preimmune serum (C, F). Insets in B and D show higher magnification of s100 g immunoreactivity in epithelial cells.



Tables
[TableWrap ID: T1] Table 1 

Primer sequences of the transcripts for s100 g, cyr61, tnfip6, ampd3 and gapdh


Gene Sense Antisense Length of band
s100 g GGCAGCACTCACTGACAGC CAGTAGGTGGTGTCGGAGC 307 bp
cyr61 ATCTACCAGAACGGGGAGAG TATTAACTCCACCTCCGAGG 253 bp
tnfip6 TGACAGTTATGACGATGTCC GCCTTGATTGGATTTAGGTGC 167 bp
ampd3 CACCCTATGACATGCCTGAG CAAAGAGAACACCTCCCTGC 320 bp
gapdh ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA 498 bp


Article Categories:
  • Research


Previous Document:  Military veteran mortality following a survived suicide attempt.
Next Document:  Short term non-invasive ventilation post-surgery improves arterial blood-gases in obese subjects com...