| Ovine fetal thymus response to lipopolysaccharide-induced chorioamnionitis and antenatal corticosteroids. | |
| | |
| Jump to Full Text | |
MedLine Citation:
|
PMID: 22693607 Owner: NLM Status: MEDLINE |
Abstract/OtherAbstract:
|
RATIONALE: Chorioamnionitis is associated with preterm delivery and involution of the fetal thymus. Women at risk of preterm delivery receive antenatal corticosteroids which accelerate fetal lung maturation and improve neonatal outcome. However, the effects of antenatal corticosteroids on the fetal thymus in the settings of chorioamnionitis are largely unknown. We hypothesized that intra-amniotic exposure to lipopolysaccharide (LPS) causes involution of the fetal thymus resulting in persistent effects on thymic structure and cell populations. We also hypothesized that antenatal corticosteroids may modulate the effects of LPS on thymic development. METHODS: Time-mated ewes with singleton fetuses received an intra-amniotic injection of LPS 7 or 14 days before preterm delivery at 120 days gestational age (term = 150 days). LPS and corticosteroid treatment groups received intra-amniotic LPS either preceding or following maternal intra-muscular betamethasone. Gestation matched controls received intra-amniotic and maternal intra-muscular saline. The fetal intra-thoracic thymus was evaluated. RESULTS: Intra-amniotic LPS decreased the cortico-medullary (C/M) ratio of the thymus and increased Toll-like receptor (TLR) 4 mRNA and CD3 expression indicating involution and activation of the fetal thymus. Increased TLR4 and CD3 expression persisted for 14 days but Foxp3 expression decreased suggesting a change in regulatory T-cells. Sonic hedgehog and bone morphogenetic protein 4 mRNA, which are negative regulators of T-cell development, decreased in response to intra-amniotic LPS. Betamethasone treatment before LPS exposure attenuated some of the LPS-induced thymic responses but increased cleaved caspase-3 expression and decreased the C/M ratio. Betamethasone treatment after LPS exposure did not prevent the LPS-induced thymic changes. CONCLUSION: Intra-amniotic exposure to LPS activated the fetal thymus which was accompanied by structural changes. Treatment with antenatal corticosteroids before LPS partially attenuated the LPS-induced effects but increased apoptosis in the fetal thymus. Corticosteroid administration after the inflammatory stimulus did not inhibit the LPS effects on the fetal thymus. |
| | |
Authors:
|
Elke Kuypers; Jennifer J P Collins; Reint K Jellema; Tim G A M Wolfs; Matthew W Kemp; Ilias Nitsos; J Jane Pillow; Graeme R Polglase; John P Newnham; Wilfred T V Germeraad; Suhas G Kallapur; Alan H Jobe; Boris W Kramer |
Related Documents
:
|
1452797 - The effect of strontium chloride hexahydrate dentifrices on plaque accumulation and gin... 18509787 - Pregnancy outcomes during an era of aggressive management for intrahepatic cholestasis ... 11844197 - The anatomy of the umbilical, portal and hepatic venous systems in the human fetus at 1... 456847 - Chronic-persistent hepatitis and pregnancy. 9114407 - Association of ureaplasma urealyticum biovars with clinical outcome for neonates, obste... 10985977 - In utero perfusing fraction maps in normal and growth restricted pregnancy measured usi... |
Publication Detail:
|
Type: Journal Article; Research Support, N.I.H., Extramural; Research Support, Non-U.S. Gov't Date: 2012-05-31 |
Journal Detail:
|
Title: PloS one Volume: 7 ISSN: 1932-6203 ISO Abbreviation: PLoS ONE Publication Date: 2012 |
Date Detail:
|
Created Date: 2012-06-13 Completed Date: 2012-10-22 Revised Date: 2013-05-20 |
Medline Journal Info:
|
Nlm Unique ID: 101285081 Medline TA: PLoS One Country: United States |
Other Details:
|
Languages: eng Pagination: e38257 Citation Subset: IM |
Affiliation:
|
Department of Pediatrics, Maastricht University Medical Center, Maastricht, The Netherlands. |
Export Citation:
|
APA/MLA Format Download EndNote Download BibTex |
| MeSH Terms | |
Descriptor/Qualifier:
|
Adrenal Cortex Hormones
/
pharmacology*,
therapeutic use Animals Antigens, CD3 / metabolism Apoptosis / drug effects Bone Morphogenetic Protein 4 / genetics, metabolism Cell Proliferation / drug effects Chorioamnionitis / chemically induced*, drug therapy*, immunology, metabolism Female Fetus / drug effects*, metabolism Forkhead Transcription Factors / genetics, metabolism Gene Expression Regulation / drug effects Hedgehog Proteins / genetics, metabolism Lipopolysaccharides / pharmacology* Pregnancy Sheep / embryology* T-Lymphocytes / cytology, drug effects, metabolism Thymus Gland / drug effects, embryology*, metabolism Time Factors Toll-Like Receptors / genetics, metabolism |
| Grant Support | |
ID/Acronym/Agency:
|
HD-57869/HD/NICHD NIH HHS; R01 HD057869/HD/NICHD NIH HHS |
| Chemical | |
Reg. No./Substance:
|
0/Adrenal Cortex Hormones; 0/Antigens, CD3; 0/Bone Morphogenetic Protein 4; 0/Forkhead Transcription Factors; 0/Hedgehog Proteins; 0/Lipopolysaccharides; 0/Toll-Like Receptors |
| Comments/Corrections | |
| Full Text | |
|
Journal Information Journal ID (nlm-ta): PLoS One Journal ID (iso-abbrev): PLoS ONE Journal ID (publisher-id): plos Journal ID (pmc): plosone ISSN: 1932-6203 Publisher: Public Library of Science, San Francisco, USA |
Article Information Download PDF ![]() Kuypers et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Received Day: 5 Month: 3 Year: 2012 Accepted Day: 2 Month: 5 Year: 2012 collection publication date: Year: 2012 Electronic publication date: Day: 31 Month: 5 Year: 2012 Volume: 7 Issue: 5 E-location ID: e38257 ID: 3365024 PubMed Id: 22693607 Publisher Id: PONE-D-12-06580 DOI: 10.1371/journal.pone.0038257 |
| Ovine Fetal Thymus Response to Lipopolysaccharide-Induced Chorioamnionitis and Antenatal Corticosteroids Alternate Title:Thymic Changes after Chorioamnionitis | |
| Elke Kuypers1 | |
| Jennifer J. P. Collins1 | |
| Reint K. Jellema1 | |
| Tim G. A. M. Wolfs1 | |
| Matthew W. Kemp2 | |
| Ilias Nitsos2¤ | |
| J. Jane Pillow2 | |
| Graeme R. Polglase2¤ | |
| John P. Newnham2 | |
| Wilfred T. V. Germeraad3 | |
| Suhas G. Kallapur24 | |
| Alan H. Jobe24 | |
| Boris W. Kramer1* | |
| Rory Edward Mortyedit1 |
Role: Editor |
|
1Department of Pediatrics, Maastricht University Medical Center, Maastricht, The Netherlands |
|
|
2School of Women's and Infants' Health, The University of Western Australia, Perth, Australia |
|
|
3Department of Internal Medicine, Division of Haematology, Maastricht University Medical Center, Maastricht, The Netherlands |
|
|
4Division of Pulmonary Biology, Cincinnati Children's Hospital Medical Center, University of Cincinnati, Cincinnati, Ohio, United States of America |
|
| University of Giessen Lung Center, Germany |
|
| Correspondence: * E-mail: b.kramer@mumc.nl Contributed by footnote: Conceived and designed the experiments: EK MK IN JP GP JN SK AJ BK. Performed the experiments: EK JC MK IN JP GP JN SK AJ BK. Analyzed the data: EK JC RJ. Contributed reagents/materials/analysis tools: TW WG. Wrote the paper: EK JC RJ TW AJ BK. ¤Current address: The Ritchie Centre, Monash Institute of Medical Research, Melbourne, Australia |
|
Preterm birth is the leading cause of morbidity and mortality in the neonatal period [1]. In the developed world, the majority of women at risk of preterm birth receive antenatal corticosteroids to induce lung maturation and decrease infant mortality [2]. This therapy is given irrespective of the presence of an intra-uterine infection of the amniotic fluid and placental membranes (chorioamnionitis). Chorioamnionitis is present in up to 60% of preterm births and is highly associated with adverse neonatal outcomes [3]. In the majority of preterm births, chorioamnionitis is clinically silent prior to early gestational preterm labor [3]. As a result, many preterm infants are exposed to both chorioamnionitis and antenatal corticosteroids.
Exposure to intra-uterine infection may increase the risk for respiratory and neurological complications in later life [4], [5]. Intra-amniotic lipopolysaccharide (LPS)-induced chorioamnionitis causes lung [6], [7], gut [8] and skin [9] inflammation in preterm lambs, which demonstrates that chorioamnionitis causes a ‘multi-organ disease of the fetus’ [10].
The concept of fetal and early life origins of disease has developed from epidemiological studies, which correlate fetal and maternal exposures during gestation to outcomes in childhood such as asthma [11]. The pathogenesis of some diseases may result from altered T-cell immunity during fetal development [12]. The net outcome of pro-inflammation effects from chorioamnionitis and anti-inflammation effects from antenatal corticosteroids remain unstudied. As such, there is minimal information about how the fetal thymus responds to these clinically relevant exposures [13].
The thymus is the primary site for T-cell development [14]. Immature T-cells migrate from the cortico-medullary junction, move through the thymic cortex to the medullary compartment. During this migration, the immature T-cells proliferate greatly, alter antigen expression and rearrange their T-cell receptor expression [14]. Previous studies demonstrated that chorioamnionitis interferes with the development of the fetal thymus [15], [16]. In an ovine model of chorioamnionitis, Kunzmann et al.[17] showed that intra-amniotic LPS decreased the fetal thymus/body weight ratio and decreased thymic Foxp3 expression. However, the combined effects of chorioamnionitis and antenatal corticosteroids on fetal thymic development remain to be characterized [18].
Sonic hedgehog (Shh) and Bone morphogenetic protein (BMP) pathways participate in T-cell development and are sensitive to prenatal events such as exposure to toxins [19]–[21]. Both morphogens are produced and secreted by the thymic epithelium as negative regulators of T-cell differentiation to maintain a pool of undifferentiated, precursor T-cells in the thymus [22], [23]. We hypothesized that intra-amniotic exposure to LPS causes involution of the fetal thymus and modulation of Shh and BMP4 expression with persistent effects on thymic structure and cell populations. We also hypothesized that antenatal corticosteroids may modulate the effects of LPS on thymic development. Therefore, we exposed fetal sheep sequentially to intra-amniotic LPS and/or antenatal corticosteroids at 7-day intervals [24] and evaluated multiple indicators of thymic development. An interval of 7 days between the two interventions was chosen as representative of the interval between recognition of preterm labor and delivery for many women who deliver preterm and the probability that many early gestation fetal exposures to infection are chronic [3], [25], and that repeated administration of antenatal corticosteroids are given at weekly intervals [26].
The animal experiments for this study were performed in Western Australia and were approved by the Animal Ethics Committees at The University of Western Australia (animal ethics protocol RA/3/100/830) and Cincinnati Children's Hospital Medical Center. Time-mated ewes with singleton fetuses were randomly allocated to one of six treatment groups to receive an intra-amniotic (IA) injection of lipopolysaccharide (LPS) (10 mg Escherichia Coli 055:B5, Sigma Chemical, St. Louis, MO, USA) and/or an intra-muscular injection of betamethasone (Beta) (Celestone Soluspan, Schering-Plough, North Ryde, New South Wales (NSW), Australia, 0.5 mg/kg maternal weight) and/or an equivalent injection of saline for control animals at 107 days and/or 114 days gestation (GA) (Figure 1). All ewes received a single intra-muscular injection of 150 mg medroxyprogesterone acetate (Depo-Provera, Kenral, NSW, Australia) at 100 days GA to decrease the risk of preterm birth induced by the betamethasone treatment. Despite the medroxyprogesterone acetate treatment, animals exposed to maternal betamethasone experienced fetal losses, such that we reassigned animals from a group which received betamethasone 14 days before delivery to other groups as our priority was to test the interactions of betamethasone and LPS. Lambs were delivered by cesarean section at 120 days GA (term = 150 days GA) and euthanized after birth. Intra-thoracic thymic tissue was snap frozen and fixed in 10% buffered-formalin for 24 hours. The pulmonary inflammation and maturation responses of these animals are reported elsewhere [7].
Paraffin embedded thymic sections (4 µm, transverse) were stained for CD3 (DAKO A0452, DAKO Denmark), Foxp3 (eBiosciences 14-7979, eBiosciences, San Diego, USA), bone morphogenetic protein 4 (BMP4) (sc-6896, Santa Cruz Biotechnology, Santa Cruz, USA), cleaved caspase-3 (Asp175, #9661S, Cell Signaling Technology, Boston, USA) and Ki67 (Dako, M7240, DAKO Denmark). The sections were deparaffinized and rehydrated in an ethanol series. Endogenous peroxidase-activity was blocked by incubation with 0,3% H2O2 in phosphate buffered saline (PBS, pH 7.4) (for CD3, BMP4 and Foxp3) or in methanol (for cleaved caspase-3 and Ki67). Antigen retrieval was performed by incubating the sections in heated citrate buffer (10 mM, pH 6.0) for 30 minutes. Aspecific binding was blocked by incubating slides for 30 minutes with 5% bovine serum albumin (BSA) for CD3, 20% normal goat serum (NGS) for Foxp3 and BMP4 or 5% NGS for Ki67. This step was omitted for cleaved caspase-3. Slides were incubated overnight at 4°C with the diluted primary antibody (CD3 1∶200, Foxp3 1∶30, BMP4 1∶500, cleaved caspase-3 1∶400, Ki67 1∶50) followed by incubation with a secondary goat-anti-mouse (for Foxp3 and Ki67) or swine-anti-rabbit (for CD3, BMP4 and cleaved caspase-3) biotin labeled antibodies. The immunostaining was enhanced with Vectastain ABC peroxidase Elite kit (PK-6200, Vector Laboratories, Burlingame, USA) followed by a nickel sulfate-diaminobenzidine (NiDAB) staining. Sections were counterstained with 0.1% Nuclear Fast Red.
Evaluation was performed by light microscopy (Axioskop 40, Zeiss, Germany) with LeicaQWin Pro v.3.4.0 software (Leica Microsystems, Germany). CD3, Foxp3, Ki67 and BMP4 positive staining were measured in three to five representative sections at 200× magnification by Image J software (Rasband, W.S., Image J US National Institutes of Health, Bethesda, Maryland, USA). Cleaved caspase-3 positive cells were counted in three representative high power fields at 200× magnification by a blinded observer and averaged per animal.
The morphology of the thymus was evaluated by light microscopy after hematoxylin and eosin staining. The cortico-medullary (C/M) ratio was quantified for three representative sections from each animal at 2.5× magnification using Image J software (Rasband, W.S.) [27].
Total RNA was extracted from frozen thymic tissue using the SV Total RNA Isolation system (Z3100, Promega, Madison, USA) according to the manufacturer's instructions. Genomic DNA contamination was removed by treatment with RQ1 DNase (M610A, Promega) and the RNA was tested for the presence of genomic GAPDH. Total RNA was reverse transcribed with the First Strand cDNA synthesis kit (4379012001, Roche-Applied, Mannheim, Germany) according to manufacturer's instructions using anchored oligo-primers. Primers for real-time PCR (RT-PCR) were constructed based on published ovine or bovine cDNA sequences (Table 1). RT-PCR reactions were performed in duplicate with the LightCycler 480 SYBR Green I Master mix (4707516001, Roche-Applied) on a LightCycler 480 Instrument according to the manufacturer's instructions. RT-PCR results were normalized to ovRSP15, a housekeeping gene, and mean fold changes in mRNA expression were calculated by the ΔΔCt-method [28].
Groups were compared using one-way ANOVA with Dunnett's or Tukey's test for post-hoc analysis or by a non-parametric Kruskal-Wallis test as appropriate. Statistical analysis was performed by GraphPad Prism v5.0. Significance was accepted at p<0.05.
The cortico-medullary (C/M) ratio decreased significantly after exposure to LPS for 7 days (Figure 2B) compared to controls (Figure 2A). Betamethasone treatment 7 days prior to LPS exposure did not attenuate the change in C/M ratio (Figure 2C). Animals exposed to LPS 14 days before delivery and then exposed to betamethasone had a reduced C/M ratio (Figure 2D) compared to controls.
Cleaved caspase-3 positive cells, an indicator of apoptotic cells, increased in the thymus of animals which received betamethasone prior to the LPS exposure when compared to controls (Figure 3A). No changes in Ki67 expression were detected in any of the experimental groups compared to control (Figure 3D).
TLR2 mRNA levels did not change in the experimental groups compared to control (Figure 4A). TLR4 mRNA almost doubled in animals which were exposed to LPS either 7 or 14 days before delivery (Figure 4B). Treatment with betamethasone 7 days after the LPS exposure did not attenuate the rise in TLR4 mRNA levels.
The percentage of CD-3 positive stained area increased significantly 7 days (Figure 5B) and 14 days (Figure 5C) after LPS exposure compared to controls (Figure 5A) and was primarily located in the thymic medulla (Figure 5C). Betamethasone treatment after the 14 day LPS exposure did not attenuate the LPS-mediated increase in the percentage of CD3-positive stained area of the thymus (Figure 5D).
The percentage of Foxp3-positive stained area detected primarily in the medulla, was decreased significantly 14 days after LPS exposure (Figure 6B) compared to controls (Figure 6A) irrespectively of betamethasone post-treatment (Figure 6C). Other experimental groups did not show a change in thymic Foxp3 expression.
Shh mRNA (Figure 7) decreased to about 20% of the control value 7 and 14 days after LPS exposure. Similarly, BMP4 (Figure 8) mRNA and protein expression also decreased significantly 7 and 14 days after exposure to LPS. Betamethasone treatment before the exposure to LPS attenuated the decrease in Shh mRNA levels and BMP4 protein. BMP4 mRNA but not protein expression remained decreased in this group compared to controls. The animals which received betamethasone treatment after the LPS exposure still had decreased levels of Shh and BMP4 which were similar to the LPS effect alone.
We investigated the responses of the fetal thymus to chorioamnionitis and antenatal corticosteroids, fetal exposures which are common prior to very preterm delivery [1], [3]. We found that intra-amniotic exposure to LPS activated the fetal thymus as shown with increased TLR4 mRNA levels and CD3 expression, decreased Foxp3-positive cells and altered thymic structure.
In organ cultures of the fetal thymus, blocking of Shh signaling accelerated T-cell differentiation [29] while additional Shh protein arrested T-cell development [30]. Cortical epithelial cells of the thymus also produced BMP4 which controls early T-cell development [31]. Inhibition of the BMP4 signaling cascade was required for further differentiation of T-cells at several checkpoints during development [32]. Shh and BMP4 expression decreased in response to LPS-induced chorioamnionitis indicating increased differentiation of thymic T-cells. This increased differentiation was reflected in an increase in CD3 expression, which is expressed on mature T-cells [33]. Taken together these results indicate that exposure to intra-amniotic LPS resulted in differentiation of T-cells with an accumulation of mature T-cells in the medulla and depletion of early progenitor T-cells in the cortex, which was consistent with the changed thymic structure.
Although the involution response of the fetal thymus has been described in several human and animal studies [15], [27], the mechanistic changes behind this response remain unclear. Kunzmann et al. [17] showed an acute thymic involution with changes in Foxp3-positive cells in an ovine model of chorioamnionitis up to 5 days after exposure to LPS. Here, we further characterized this process by demonstrating that the effects of LPS on the thymic population and structure were detected 14 days after the LPS exposure and were not due to changes in proliferation or apoptosis. A persistent increase in medulla area due to the accumulation of mature, differentiated T-cells may explain the change in thymic structure.
Based on the anti-inflammatory properties of antenatal corticosteroids, a reduced inflammatory response after exposure to LPS was expected [34]. Corticosteroids can exert anti-inflammatory effects by upregulation of the IκB family, which are cytoplasmic inhibitors of NF-κB, and by direct antagonism between the glucocorticoid receptor and NF-κB, resulting in blocked transcription of responsive genes. However, in our study betamethasone administration after the inflammatory stimulus did not reverse the LPS-induced increase in TLR4 and CD3 in the fetal thymus. LPS has a half-life of 1.7 days in the amniotic fluid and was still detectable 15 days after intra-amniotic injection [35]. Because of the slow clearance, LPS may induce a persistent inflammatory response which is in line with measurements of pulmonary inflammation in these animals [7].
Surprisingly, betamethasone administration 7 days before LPS exposure attenuated activation with no signs of inflammation in the fetal thymus. Thymic structure changed slightly due to the pro-apoptotic properties of antenatal corticosteroids [36]. Previous reports demonstrated only inhibitory effects of corticosteroids on the immune system for a maximum of 48 hours [37], [38]. Our results indicate that the antenatal corticosteroids used clinically can potentially desensitize the fetal immune system and attenuate a response to LPS. Paradoxically, these ‘longer term’ inhibitory effects of corticosteroids on the fetal immune system did not occur in the animals that were exposed to LPS and then betamethasone 7 days later as the immune system remained activated. Corticosteroids are potent immune-modulatory hormones which can have long term effects on the HPA-axis and subsequently on the function of the immune system [39], [40] which may be reflected in the unresponsiveness of the fetal immune system to LPS after corticosteroid pre-treatment. The longer-term effects of the changes in cell composition and activation of the fetal thymus after exposure to antenatal corticosteroids may depend on the timing of the exposure and the developmental stage of the immune system and therefore remain to be further determined.
Although administration of antenatal corticosteroids to pregnant women at risk of preterm birth is one of the most effective and important therapies in perinatal medicine, concerns remain about effects on fetal growth and development of the brain and immune system. Antenatal corticosteroid treatment can change the population and function of cord blood lymphocytes of preterm infants [41], [42] and may induce thymic involution [43]–[45]. Antenatal dexamethasone also was associated with decreased T-cell numbers in the fetal rat thymus and spleen and changes in the CD4/CD8 ratio [40], [46]. Dexamethasone treatment of neonatal rats changed the peripheral T-cell repertoire and altered endogenous corticosterone production of thymic epithelial cells during neonatal life [47]. These changes may impair the functional maturity of the neonatal immune system and could contribute to the increased incidence and adverse outcome of infections [48], [49].
Our findings contribute to the current concept that events during fetal life can potentially alter the function of the immune system [50]. The clinical associations between chorioamnionitis and adverse outcomes in later life such as BPD [12] or asthma [51] may be mediated in part by changes in immune responses.
In summary, our results demonstrate that fetal exposure to intra-amniotic LPS activated the fetal thymus which was accompanied by structural changes. Treatment with antenatal corticosteroids before LPS partially attenuated the LPS-induced effects but increased apoptosis in the fetal thymus. Corticosteroid administration after the inflammatory stimulus did not inhibit the LPS effects on the fetal thymus. However, insights into the effects of LPS and corticosteroids on molecular pathways such as BMP4 and Shh are limited. Due to the low expression BMP4 and a lack of specific reagents for Shh protein for ovine tissue, we were not able to perform more detailed analysis of these pathways. Further analysis at different time intervals of exposure are necessary to better understand the interactive effects of chorioamnionitis and corticosteroids on the fetal thymus. Although the design of the study does not allow us to evaluate the dynamics of the changes induced by LPS and corticosteroids, this report illustrates the complicated interactions of pro- and anti-inflammatory stimuli on the development of the fetal immune system.
Notes
Competing Interests: The authors have declared that no competing interests exist.
Funding: Supported by NIH HD-57869 (SGK) from the National Institutes of Health (NIH), United States of America, the National Health and Medical Research Council of Australia, the Women and Infants Research Foundation, Western Australia, Veni BWK 016.096.141 from the Dutch Scientific Research Organization and the Research School for Oncology and Developmental Biology (GROW), Maastricht University. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
We thank Richard Dalton, Joe Derwort, Masatoshi Saito, Clare Berry, Carryn McLean, Shaofu Li, Jennifer Henderson and Anne-Sophie Warda for excellent technical support.
References
| 1. | Goldenberg RL,Culhane JF,Iams JD,Romero R. Year: 2008Epidemiology and causes of preterm birth.Lancet371758418177778 |
| 2. | Been JV,Degraeuwe PL,Kramer BW,Zimmermann LJ. Year: 2010Antenatal steroids and neonatal outcome after chorioamnionitis: a meta-analysis.BJOG11811312221054759 |
| 3. | Goldenberg RL,Hauth JC,Andrews WW. Year: 2000Intrauterine infection and preterm delivery.N Engl J Med3421500150710816189 |
| 4. | Hartling L,Liang Y,Lacaze-Masmonteil T. Year: 2012Chorioamnionitis as a risk factor for bronchopulmonary dysplasia: a systematic review and meta-analysis.Arch Dis Child Fetal Neonatal Ed97F8F1721697236 |
| 5. | Shatrov JG,Birch SC,Lam LT,Quinlivan JA,McIntyre S,et al. Year: 2010Chorioamnionitis and cerebral palsy: a meta-analysis.Obstet Gynecol11638739220664400 |
| 6. | Kallapur SG,Willet KE,Jobe AH,Ikegami M,Bachurski CJ. Year: 2001Intra-amniotic endotoxin: chorioamnionitis precedes lung maturation in preterm lambs.Am J Physiol Lung Cell Mol Physiol280L52753611159037 |
| 7. | Kuypers E,Collins JJ,Kramer BW,Ofman G,Nitsos I,et al. Year: 2012Intra-amniotic LPS and antenatal betamethasone: inflammation and maturation in preterm lamb lungs.Am J Physiol Lung Cell Mol Physiol302L38038922160306 |
| 8. | Wolfs TG,Buurman WA,Zoer B,Moonen RM,Derikx JP,et al. Year: 2009Endotoxin induced chorioamnionitis prevents intestinal development during gestation in fetal sheep.PLoS One4e583719503810 |
| 9. | Kemp MW,Saito M,Nitsos I,Jobe AH,Kallapur SG,et al. Year: 2010Exposure to in utero lipopolysaccharide induces inflammation in the fetal ovine skin.Reprod Sci18889820923949 |
| 10. | Gantert M,Been JV,Gavilanes AW,Garnier Y,Zimmermann LJ,et al. Year: 2010Chorioamnionitis: a multiorgan disease of the fetus?J Perinatol30SupplS213020877404 |
| 11. | Getahun D,Strickland D,Zeiger RS,Fassett MJ,Chen W,et al. Year: 2010Effect of chorioamnionitis on early childhood asthma.Arch Pediatr Adolesc Med16418719220124149 |
| 12. | Rosen D,Lee JH,Cuttitta F,Rafiqi F,Degan S,et al. Year: 2006Accelerated thymic maturation and autoreactive T cells in bronchopulmonary dysplasia.Am J Respir Crit Care Med174758316574933 |
| 13. | Kramer BW,Kallapur SG,Moss TJ,Nitsos I,Newnham JP,et al. Year: 2009Intra-amniotic LPS modulation of TLR signaling in lung and blood monocytes of fetal sheep.Innate Immun1510110719318420 |
| 14. | Pearse G. Year: 2006Normal structure, function and histology of the thymus.Toxicol Pathol3450451417067941 |
| 15. | Yinon Y,Zalel Y,Weisz B,Mazaki-Tovi S,Sivan E,et al. Year: 2007Fetal thymus size as a predictor of chorioamnionitis in women with preterm premature rupture of membranes.Ultrasound Obstet Gynecol2963964317471450 |
| 16. | De Felice C,Toti P,Santopietro R,Stumpo M,Pecciarini L,et al. Year: 1999Small thymus in very low birth weight infants born to mothers with subclinical chorioamnionitis.J Pediatr13538438610484809 |
| 17. | Kunzmann S,Glogger K,Been JV,Kallapur SG,Nitsos I,et al. Year: 2010Thymic changes after chorioamnionitis induced by intraamniotic lipopolysaccharide in fetal sheep.Am J Obstet Gynecol20247648520452494 |
| 18. | Kramer BW,Kallapur SG,Moss TJ,Nitsos I,Polglase GP,et al. Year: 2009Modulation of fetal inflammatory response on exposure to lipopolysaccharide by chorioamnion, lung, or gut in sheep.Am J Obstet Gynecol202778619801145 |
| 19. | Crompton T,Outram SV,Hager-Theodorides AL. Year: 2007Sonic hedgehog signalling in T-cell development and activation.Nat Rev Immunol772673517690714 |
| 20. | Lowrey JA,Stewart GA,Lindey S,Hoyne GF,Dallman MJ,et al. Year: 2002Sonic hedgehog promotes cell cycle progression in activated peripheral CD4(+) T lymphocytes.J Immunol1691869187512165511 |
| 21. | Hanson ML,Brundage KM,Schafer R,Tou JC,Barnett JB. Year: 2009Prenatal cadmium exposure dysregulates sonic hedgehog and Wnt/beta-catenin signaling in the thymus resulting in altered thymocyte development.Toxicol Appl Pharmacol24213614519818801 |
| 22. | Sacedon R,Varas A,Hernandez-Lopez C,Gutierrez-deFrias C,Crompton T,et al. Year: 2003Expression of hedgehog proteins in the human thymus.J Histochem Cytochem511557156614566027 |
| 23. | Hager-Theodorides AL,Outram SV,Shah DK,Sacedon R,Shrimpton RE,et al. Year: 2002Bone morphogenetic protein 2/4 signaling regulates early thymocyte differentiation.J Immunol1695496550412421925 |
| 24. | Kramer BW,Moss TJ,Willet KE,Newnham JP,Sly PD,et al. Year: 2001Dose and time response after intraamniotic endotoxin in preterm lambs.Am J Respir Crit Care Med16498298811587983 |
| 25. | Crowther CA,Harding JE. Year: 2007Repeat doses of prenatal corticosteroids for women at risk of preterm birth for preventing neonatal respiratory disease.Cochrane Database Syst RevCD00393517636741 |
| 26. | Ballard PL,Ballard RA. Year: 1995Scientific basis and therapeutic regimens for use of antenatal glucocorticoids.Am J Obstet Gynecol1732542627631700 |
| 27. | Toti P,De Felice C,Stumpo M,Schurfeld K,Di Leo L,et al. Year: 2000Acute thymic involution in fetuses and neonates with chorioamnionitis.Hum Pathol311121112811014581 |
| 28. | Livak KJ,Schmittgen TD. Year: 2001Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) Method.Methods2540240811846609 |
| 29. | Outram SV,Varas A,Pepicelli CV,Crompton T. Year: 2000Hedgehog signaling regulates differentiation from double-negative to double-positive thymocyte.Immunity1318719710981962 |
| 30. | Gutierrez-Frias C,Sacedon R,Hernandez-Lopez C,Cejalvo T,Crompton T,et al. Year: 2004Sonic hedgehog regulates early human thymocyte differentiation by counteracting the IL-7-induced development of CD34+ precursor cells.J Immunol1735046505315470048 |
| 31. | Cejalvo T,Sacedon R,Hernandez-Lopez C,Diez B,Gutierrez-Frias C,et al. Year: 2007Bone morphogenetic protein-2/4 signalling pathway components are expressed in the human thymus and inhibit early T-cell development.Immunology1219410417425602 |
| 32. | Graf D,Nethisinghe S,Palmer DB,Fisher AG,Merkenschlager M. Year: 2002The developmentally regulated expression of Twisted gastrulation reveals a role for bone morphogenetic proteins in the control of T cell development.J Exp Med19616317112119341 |
| 33. | Dave VP. Year: 2009Hierarchical role of CD3 chains in thymocyte development.Immunol Rev232223319909353 |
| 34. | Kallapur SG,Kramer BW,Moss TJ,Newnham JP,Jobe AH,et al. Year: 2003Maternal glucocorticoids increase endotoxin-induced lung inflammation in preterm lambs.Am J Physiol Lung Cell Mol Physiol284L63364212471018 |
| 35. | Newnham JP,Kallapur SG,Kramer BW,Moss TJ,Nitsos I,et al. Year: 2003Betamethasone effects on chorioamnionitis induced by intra-amniotic endotoxin in sheep.Am J Obstet Gynecol1891458146614634586 |
| 36. | Tonomura N,McLaughlin K,Grimm L,Goldsby RA,Osborne BA. Year: 2003Glucocorticoid-induced apoptosis of thymocytes: requirement of proteasome-dependent mitochondrial activity.J Immunol1702469247812594272 |
| 37. | Wang X,Nelin LD,Kuhlman JR,Meng X,Welty SE,et al. Year: 2008The role of MAP kinase phosphatase-1 in the protective mechanism of dexamethasone against endotoxemia.Life Sci8367168018845168 |
| 38. | Kramer BW,Ikegami M,Moss TJ,Nitsos I,Newnham JP,et al. Year: 2004Antenatal betamethasone changes cord blood monocyte responses to endotoxin in preterm lambs.Pediatr Res5576476814973182 |
| 39. | Sloboda DM,Newnham JP,Challis JR. Year: 2000Effects of repeated maternal betamethasone administration on growth and hypothalamic-pituitary-adrenal function of the ovine fetus at term.J Endocrinol165799110750038 |
| 40. | Bakker JM,Schmidt ED,Kroes H,Kavelaars A,Heijnen CJ,et al. Year: 1995Effects of short-term dexamethasone treatment during pregnancy on the development of the immune system and the hypothalamo-pituitary adrenal axis in the rat.J Neuroimmunol631831918550816 |
| 41. | Chabra S,Cottrill C,Rayens MK,Cross R,Lipke D,et al. Year: 1998Lymphocyte subsets in cord blood of preterm infants: effect of antenatal steroids.Biol Neonate742002079691160 |
| 42. | Kavelaars A,van der Pompe G,Bakker JM,van Hasselt PM,Cats B,et al. Year: 1999Altered immune function in human newborns after prenatal administration of betamethasone: enhanced natural killer cell activity and decreased T cell proliferation in cord blood.Pediatr Res4530631210088646 |
| 43. | Wu FF,Momma K,Takao A. Year: 1993Cardiovascular and pulmonary effects of betamethasone during midtrimester on fetal rats.Fetal Diagn Ther889948338630 |
| 44. | Quinlivan JA,Archer MA,Dunlop SA,Evans SF,Beazley LD,et al. Year: 1998Fetal growth retardation, particularly within lymphoid organs, following repeated maternal injections of betamethasone in sheep.J Obstet Gynaecol Res241731829714987 |
| 45. | Michie CA,Hasson N,Tulloh R. Year: 1998The neonatal thymus and antenatal steroids.Arch Dis Child Fetal Neonatal Ed79F1599828749 |
| 46. | Bakker JM,Schmidt ED,Kroes H,Kavelaars A,Heijnen CJ,et al. Year: 1997Effects of neonatal dexamethasone treatment on hypothalamo-pituitary adrenal axis and immune system of the rat.J Neuroimmunol7469769119981 |
| 47. | Bakker JM,Kavelaars A,Kamphuis PJ,Zijlstra J,van Bel F,et al. Year: 2001Neonatal dexamethasone treatment induces long-lasting changes in T-cell receptor vbeta repertoire in rats.J Neuroimmunol112475411108932 |
| 48. | Bakker JM,Kavelaars A,Kamphuis PJ,Cobelens PM,van Vugt HH,et al. Year: 2000Neonatal dexamethasone treatment increases susceptibility to experimental autoimmune disease in adult rats.J Immunol1655932593711067955 |
| 49. | Smolders-de Haas H,Neuvel J,Schmand B,Treffers PE,Koppe JG,et al. Year: 1990Physical development and medical history of children who were treated antenatally with corticosteroids to prevent respiratory distress syndrome: a 10- to 12-year follow-up.Pediatrics8665702193304 |
| 50. | Kramer BW,Ikegami M,Moss TJ,Nitsos I,Newnham JP,et al. Year: 2005Endotoxin-induced chorioamnionitis modulates innate immunity of monocytes in preterm sheep.Am J Respir Crit Care Med171737715466254 |
| 51. | Kumar R,Yu Y,Story RE,Pongracic JA,Gupta R,et al. Year: 2008Prematurity, chorioamnionitis, and the development of recurrent wheezing: a prospective birth cohort study.J Allergy Clin Immunol121878884 e87618313129 |
Figures
Tables
Table 1 Primers used for RT-PCR.
| Gene | Sequence (5′-3′) | Amplicon size | Tm | Accession code (RefSeq) | |
| TLR2 | Fw Rv | [gene: GGCTGTAATCAGCGTGTTCA GATCTCGTTGTCGGACAGGT] | 160 bp | 64°C | NM_001048231.1 |
| TLR4 | Fw Rv | [gene: GAGAAGACTCAGAAAAGCCTTGCT GCGGGTTGGTTTCTGCAT] | 200 bp | 65°C | NM_001135930.1 |
| Shh | Fw Rv | [gene: ACTGGAGCGGACCGGCTGAT CCGGCCACTGGCTCATCAC] | 82 bp | 68°C | XM_614193.3 |
| BMP4 | Fw Rv | [gene: ACCACGAAGAACATCTGGAG TTATACGATGAAAGCCCTGC] | 173 bp | 61°C | NM_001110277.1 |
Article Categories:
|
|
Previous Document: Effects of low-dose drinking water arsenic on mouse fetal and postnatal growth and development.
Next Document: Prediction of molecular targets of cancer preventing flavonoid compounds using computational methods...








