We used two human BC cell lines: BOY, which was established in our laboratory from an Asian male patient, age 66, and diagnosed with stage III BC with lung metastasis (²⁰); T24 was obtained from the American Type Culture Collection. These cell lines were maintained in minimum essential medium (MEM) supplemented with 10% fetal bovine serum (FBS) in a humidified atmosphere of 5% CO₂ and 95% air at 37°C.

Tissue samples were taken from 24 BC patients who had undergone cystectomy or transurethral resection of BCs at Kagoshima University Hospital between 2007 and 2009. The median age of the patients was 71 years, ranging from 62 to 88 years. The BC samples were from 14 non-muscle invasive (<T2) and 10 muscle invasive (≥T2) cancers; 10 were low grade BC and the other 14 were high grade BC. The samples were staged in accordance with the tumor-node-metastasis classification system of the American Joint Committee on Cancer-Union Internationale Contre le Cancer (UICC) and were histologically graded (²¹). The study was approved by the Bioethics Committee of Kagoshima University; written prior informed consent and approval were given by the patients.

Tissue samples were immersed in RNAlater (Qiagen, Valencia, CA, USA) and stored at −20°C until RNA was extracted. Total RNA (including miRNA) was extracted from frozen fresh tissues using the mirVana™ miRNA isolation kit (Ambion, Austin, TX, USA) in accordance with the manufacturer’s protocol. The integrity of the RNA was checked with an RNA 6000 Nano Assay Kit and a 2100 Bioanalyzer™ (Agilent Technologies, Santa Clara, CA, USA).

TaqMan probes and primers for MESDC1 (TaqMan^® Gene Expression Assays, P/N: Hs00739656_s1, Applied Biosystems, Foster City, CA, USA) were assay-on-demand gene expression products. All reactions were performed in duplicate, and a negative control lacking cDNA was included. We followed the manufacturer’s protocol for the PCR conditions. Stem-loop RT–PCR for miR-574-3p (TaqMan^® MicroRNA Assays, P/N: 002349, Applied Biosystems) was used to quantitate miRNAs according to the earlier published conditions (¹⁰). cDNA was made from 5 ng of total RNA from each sample using the TaqMan^® MicroRNA Reverse Transcription Kit (Applied Biosystems). For quantitative analysis of mRNA and miRNA, we used human 18s rRNA (P/N: 4319413E, Applied Biosystems) and RNU48 (P/N: 001006, Applied Biosystems) as an internal control, and we used the delta-delta Ct method to calculate the fold-change. As control RNA, we used three different lots of Premium Total RNA from normal human bladder (AM7990, Applied Biosystems).

As described elsewhere (¹⁰), the BC cell lines were transfected with Lipofectamine™ RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA, USA) and Opti-MEM™ (Invitrogen) with 10 nM of mature miRNA molecules. Mature miRNA molecules, Pre-miR™ (hsa-miR-574-3p, P/N: AM17100, Applied Biosystems) and negative control miRNA (P/N: AM17111, Applied Biosystems) were used in the gain-of-function experiments, whereas MESDC1 siRNA (Cat# HSS126949 and HSS126950, Invitrogen) and negative control siRNA (D-001810-10, Thermo Fisher Scientific, Waltham, MA, USA) were used in the loss-of-function experiments. Cells were seeded in 10-cm dishes for protein extraction (8×10⁵ per dish), in 6-well plates for apoptosis assays (10×10⁴ per well) and for wound healing assays (20×10⁴ per well), in 24-well plates for mRNA extraction and luciferase reporter assays (5×10⁴ per well), and in 96-well plates for XTT assays (3,000 per well).

Cell viability was determined by using an XTT assay (Roche Applied Sciences, Tokyo, Japan) performed according to the manufacturer’s instructions. Cell migration activity was evaluated by wound-healing assays. Cells were plated in 6-well dishes, and the cell monolayer was scraped using a P-20 micropipette tip. The initial gap length (0 h) and the residual gap length 24 h after wounding were calculated from photomicrographs. A cell invasion assay was carried out using modified Boyden Chambers consisting of transwell-precoated matrigel membrane filter inserts with 8 μm pores in 24-well tissue culture plates (BD Biosciences, Bedford, MA, USA). MEM containing 10% FBS in the lower chamber served as the chemo-attractant, as described previously (¹⁴). All experiments were performed in triplicate.

BC cell lines were transiently transfected with transfection reagent only (mock), miR-control, miR-574-3p, si-control, or si-MESDC1 in 6-well tissue culture plates, as described earlier. Cells were harvested 72 h after transfection by trypsinization and washed in cold PBS. Double staining with FITC-Annexin V and propidium iodine (PI) was carried out using the FITC Annexin V Apoptosis Detection Kit (BD Biosciences) according to the manufacturer’s recommendations and analyzed within 1 h by flow cytometry (FACScan^®, BD Biosciences). Cells were discriminated into viable cells, dead cells, early apoptotic cells and apoptotic cells by CellQuest software (BD Biosciences), and then the percentages of early apoptotic cells from each experiment were compared. Experiments were done in triplicate.

Oligo-microarray human 44K (Agilent) was used for expression profiling of miR-574-3p-transfected BC cell lines (BOY and T24) in comparison with miR-negative control transfectants, as previously described (¹⁴). Briefly, hybridization and washing steps were performed in accordance with the manufacturer’s instructions. The arrays were scanned using a Packard GSI Lumonics ScanArray^® 4000 (Perkin-Elmer, Boston, MA, USA). The data obtained were analyzed with DNASIS^® array software (Hitachi Software Engineering, Tokyo, Japan), which converted the signal intensity for each spot into text format. The log2 ratios of the median subtracted background intensity were analyzed. Data from each microarray study were normalized by global normalization.

The predicted target genes and their miRNA binding site seed regions were investigated using TargetScan program (release 5.2, http://www.targetscan.org/), MicroRNA.org (released August 2010, http://www.microrna.org/) and Micro Cosm Targets (version 5, http://www.ebi.ac.uk/enright-srv/microcosm/htdocs/targets/v5/). The sequences of the predicted mature miRNAs were confirmed using miRBase (released 16.0, Sept 2010; http://microrna.sanger.ac.uk/).

MiRNA target sequences were inserted between the SgfI-PmeI restriction sites in the 3′UTR of the hRluc gene in the psiCHECK™-2 vector (C8021, Promega, Madison, WI, USA). Primer sequences for full-length 3′UTR of MESDC1 mRNA (TACGCGATCGCGTCTTCGCCCAGGACTTTAC and TAGGTTTAAACAAACTTGACGTTGGGGGAAA) were designed. Following that, BOY and T24 cells were transfected with 15 ng of vector, 10 nM of miRNA, and 1 μl of Lipofectamine™ 2000 (Invitrogen) in 100 μl of Opti-MEM™ (Invitrogen). The activities of firefly and Renilla luciferases in cell lysates were determined with a dual-luciferase assay system (E1910; Promega). Normalized data were calculated as the quotient of Renilla/firefly luciferase activities.

The relationship between two variables and the numerical values obtained by real-time RT-PCR was analyzed using the Mann-Whitney U test. The relationship between three variables and the numerical values was analyzed using the Bonferroni-adjusted Mann-Whitney U test. Expert StatView^® analysis software (version 4, SAS Institute Inc., Cary, NC, USA) was used in both cases. In the comparison of three variables, a non-adjusted statistical level of significance of P<0.05 corresponds to a Bonferroni-adjusted level of P<0.0167.

Quantitative stem-loop RT-PCR demonstrated that the expression level of miR-574-3p was significantly lower in BCs (n=24) than in the normal human RNAs (P=0.0128, Fig. 1A) and that it was markedly lower in the BC cell lines (Fig. 1B). We found no significant correlations between miR-574-3p expressions and pathological parameters.

To investigate the functional role of miR-574-3p, we performed gain-of-function studies using miR-574-3p-transfected BC cell lines (BOY and T24). The XTT assay demonstrated that cell proliferation was reduced to 76% and 66% of mock in miR-574-3p-transfected BOY and T24 (P<0.0001 and P<0.0005, Fig. 2A). The wound healing assay demonstrated that wound closure ratio was reduced to 20% and 67% of mock in miR-574-3p-transfected BOY and T24 (P<0.0001 and P=0.0004, Fig. 2B). The Matrigel invasion assay demonstrated that cell invasion ratio was reduced to 42% and 48% of mock in miR-574-3p-transfected BOY and T24 (each P<0.0001, Fig. 2B). The early apoptotic cell fractions (right lower quadrant) were greater in the miR-574-3p transfectants than in the mocks and the miR-control transfectants (relative to mock; BOY: 9.60±1.91, 1.00±0.25, and 0.71±0.15, respectively, P=0.0013; T24: 1.84±0.08, 1.00±0.22, and 0.65±0.11, respectively, P=0.0014) (Fig. 2D). These results suggested that restoration of miR-574-3p expression might induce cell apoptosis in BC.

To gain further insight into which genes were affected by miR-574-3p transfection, we performed gene expression analysis with miR-574-3p transfectants (BOY and T24). A total of 11 genes were down-regulated less than −2.0-fold in the miR-574-3p transfectants compared with the control transfectants (Table I). MicroRNA.org and MicroCosm Target programs showed the eight genes had putative target sites for miR-574-3p in their 3′UTR (Table I). The MESDC1 gene was the most down-regulated gene that had conserved target sites for miR-574-3p. Therefore, we focused on MESDC1 as a promising candidate targeted by miR-574-3p. Entries from the former and the current microarray data were approved by the Gene Expression Omnibus (GEO) and were assigned GEO accession number, GSE24782.

The quantitative real-time RT-PCR analysis showed that mRNA expression levels of MESDC1 in BOY and T24 were higher than that in the normal human bladder RNAs (Fig. 3A). In clinical BCs, there was no significant difference in MESDC1 mRNA expression between clinical BCs and the normal human bladder RNAs (data not shown). We performed gain-of-function studies using miR-574-3p-transfected BOY and T24. The mRNA expression levels of MESDC1 were markedly repressed in the miR-574-3p transfectants in comparison with the miR-control transfectants and the mocks (Fig. 3B).

We performed a luciferase reporter assay to determine whether MESDC1 mRNA has an actual target site for miR-574-3p. We used a vector encoding full-length 3′UTR of MESDC1 mRNA and found that the luminescence intensity was significantly reduced in the miR-574-3p transfectants compared to their counterparts (Fig. 3C).

To examine the functional role of MESDC1, we performed loss-of-function studies using two different si-MESDC1-transfected BC cell lines. The mRNA expression of MESDC1 was markedly down-regulated by these si-MESDC1 transfections (Fig. 4A). The XTT assay demonstrated that cell proliferation was reduced to 71% and 57% of control by both siRNAs-treatment in BOY cells (P<0.0001) and that it was 60% and 70% of control (P<0.0001) in the T24 line (Fig. 4B). The early apoptotic cell fractions (right lower quadrant) were greater in the two si-MESDC1 transfectants than in the mocks and the si-control transfectants 72 h after transfection (relative to mock; BOY: 5.53±0.48, 4.93±0.15, 1.00±0.05, and 0.73±0.01, respectively, P<0.0001; T24: 3.30±0.08, 1.37±0.08, 1.00±0.05, and 1.11±0.03, P<0.0001 and P=0.0024) (Fig. 4C). These results suggested that knockdown of MESDC1 expression might induce cell apoptosis in BC. The wound healing assay also demonstrated that wound closure ratio was reduced to 21% and 33% of mock by both siRNAs-treatment in BOY cells (each P<0.0001) and that it was 21% and 62% of control in the T24 cells (P<0.0001 and P=0.0007) (Fig. 4D). The matrigel invasion assay demonstrated that cell invasion ratio was reduced to 4% and 22% of mock by both siRNAs-treatment in BOY cells (each P<0.0001) and that it was 33% and 64% of control in the T24 cells (each P<0.0001) (Fig. 4E).