Document Detail

Molecular profiling of cutaneous squamous cell carcinomas and actinic keratoses from organ transplant recipients.
Jump to Full Text
MedLine Citation:
PMID:  23379751     Owner:  NLM     Status:  MEDLINE    
Abstract/OtherAbstract:
BACKGROUND: The risk of developing cutaneous squamous cell carcinoma (SCC) is markedly increased in organ transplant recipients (OTRs) compared to the normal population. Next to sun exposure, the immunosuppressive regimen is an important risk factor for the development of SCC in OTRs. Various gene mutations (e.g. TP53) and genetic alterations (e.g. loss of CDKN2A, amplification of RAS) have been found in SCCs. The aim of this genome-wide study was to identify pathways and genomic alterations that are consistently involved in the formation of SCCs and their precursor lesions, actinic keratoses (AKs).
METHODS: To perform the analysis in an isogenic background, RNA and DNA were isolated from SCC, AK and normal (unexposed) epidermis (NS) from each of 13 OTRs. Samples were subjected to genome-wide expression analysis and genome SNP analysis using Illumina's HumanWG-6 BeadChips and Infinium II HumanHap550 Genotyping BeadChips, respectively. mRNA expression results were verified by quantitative PCR.
RESULTS: Hierarchical cluster analysis of mRNA expression profiles showed SCC, AK and NS samples to separate into three distinct groups. Several thousand genes were differentially expressed between epidermis, AK and SCC; most upregulated in SCCs were hyperproliferation related genes and stress markers, such as keratin 6 (KRT6), KRT16 and KRT17. Matching to oncogenic pathways revealed activation of downstream targets of RAS and cMYC in SCCs and of NFκB and TNF already in AKs. In contrast to what has been reported previously, genome-wide SNP analysis showed very few copy number variations in AKs and SCCs, and these variations had no apparent relationship with observed changes in mRNA expression profiles.
CONCLUSION: Vast differences in gene expression profiles exist between SCC, AK and NS from immunosuppressed OTRs. Moreover, several pathways activated in SCCs were already activated in AKs, confirming the assumption that AKs are the precursor lesions of SCCs. Since the drastic changes in gene expression appeared unlinked to specific genomic gains or losses, the causal events driving SCC development require further investigation. Other molecular mechanisms, such as DNA methylation or miRNA alterations, may affect gene expression in SCCs of OTRs. Further study is required to identify the mechanisms of early activation of NFκB and TNF, and to establish whether these pathways offer a feasible target for preventive intervention among OTRs.
Authors:
Liesbeth Hameetman; Suzan Commandeur; Jan Nico Bouwes Bavinck; Hermina C Wisgerhof; Frank R de Gruijl; Rein Willemze; Leon Mullenders; Cornelis P Tensen; Harry Vrieling
Publication Detail:
Type:  Journal Article; Research Support, Non-U.S. Gov't     Date:  2013-02-05
Journal Detail:
Title:  BMC cancer     Volume:  13     ISSN:  1471-2407     ISO Abbreviation:  BMC Cancer     Publication Date:  2013  
Date Detail:
Created Date:  2013-02-12     Completed Date:  2013-06-14     Revised Date:  2013-07-11    
Medline Journal Info:
Nlm Unique ID:  100967800     Medline TA:  BMC Cancer     Country:  England    
Other Details:
Languages:  eng     Pagination:  58     Citation Subset:  IM    
Affiliation:
Department of Toxicogenetics, Leiden University Medical Center, PO Box 9600, 2300, RC Leiden, the Netherlands.
Export Citation:
APA/MLA Format     Download EndNote     Download BibTex
MeSH Terms
Descriptor/Qualifier:
Aged
Carcinoma, Squamous Cell / etiology,  genetics*,  immunology
Cluster Analysis
Female
Gene Expression Profiling* / methods
Gene Expression Regulation, Neoplastic
Gene Regulatory Networks
Genetic Predisposition to Disease
Genome-Wide Association Study
Humans
Immunosuppressive Agents / adverse effects
Keratosis, Actinic / etiology,  genetics*,  immunology
Male
Middle Aged
Oligonucleotide Array Sequence Analysis
Organ Transplantation / adverse effects*
Polymorphism, Single Nucleotide
RNA, Messenger / analysis
Real-Time Polymerase Chain Reaction
Reproducibility of Results
Skin Neoplasms / etiology,  genetics*,  immunology
Chemical
Reg. No./Substance:
0/Immunosuppressive Agents; 0/RNA, Messenger
Comments/Corrections

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine

Full Text
Journal Information
Journal ID (nlm-ta): BMC Cancer
Journal ID (iso-abbrev): BMC Cancer
ISSN: 1471-2407
Publisher: BioMed Central
Article Information
Download PDF
Copyright ©2013 Hameetman et al.; licensee BioMed Central Ltd.
open-access:
Received Day: 16 Month: 10 Year: 2012
Accepted Day: 30 Month: 1 Year: 2013
collection publication date: Year: 2013
Electronic publication date: Day: 5 Month: 2 Year: 2013
Volume: 13First Page: 58 Last Page: 58
PubMed Id: 23379751
ID: 3570297
Publisher Id: 1471-2407-13-58
DOI: 10.1186/1471-2407-13-58

Molecular profiling of cutaneous squamous cell carcinomas and actinic keratoses from organ transplant recipients
Liesbeth Hameetman12 Email: Liesbethhameetman@gmail.com
Suzan Commandeur2 Email: S.Commandeur@lumc.nl
Jan Nico Bouwes Bavinck2 Email: J.N.Bouwes_Bavinck@lumc.nl
Hermina C Wisgerhof2 Email: H.C.Wisgerhof@lumc.nl
Frank R de Gruijl2 Email: F.R.de_Gruijl@lumc.nl
Rein Willemze2 Email: R.Willemze.huid@lumc.nl
Leon Mullenders1 Email: L.Mullenders@lumc.nl
Cornelis P Tensen2 Email: C.P.Tensen@lumc.nl
Harry Vrieling1 Email: H.Vrieling@lumc.nl
1Department of Toxicogenetics, Leiden University Medical Center, PO Box 9600, 2300, RC Leiden, the Netherlands
2Department of Dermatology, Leiden University Medical Center, PO Box 9600, 2300, RC Leiden, the Netherlands

Background

Non-melanoma skin carcinomas, comprising cutaneous squamous cell carcinoma (SCC) and basal cell carcinoma (BCC), are the most common malignancies in fair-skinned Caucasians. The risk of developing cutaneous SCC is markedly increased (100-fold) in organ transplant recipients (OTRs) compared to the normal population [1,2] and is associated with the immunosuppressive therapy needed to prevent graft rejection [3]. Moreover, some studies have suggested that SCCs from OTRs display a more aggressive behavior [4].

Like other cancers, the development of cutaneous SCC is thought to be a multi-step process, involving sequential acquisition of genetic changes. Sun (UVR) exposure is the principal carcinogen inducing both immunologic tumor-tolerance and DNA damage that can lead to mutations in oncogenes and tumor suppressor genes (TSGs) [5,6]. Other risk factors include impaired immune surveillance, as seen in OTRs, and human papillomavirus (HPV) infections [7]. However, the oncogenic potential of HPV in cutaneous SCCs remains unclear [8]. In a recent transcriptome sequencing study no evidence of active viral gene expression was found in large group of SCCs [9].

Cutaneous SCCs are thought to develop from precursor lesions, actinic keratoses (AKs). Even though most AKs (80-99 %) do not progress to SCC, there is still both histological and molecular evidence to support this hypothesis (reviewed by C.J. Ko [10]). UVR-related mutations inactivating the TP53 tumor suppressor gene are very common in SCCs and AKs, both in immunocompetent patients and OTRs [5,11]. TP53 mutations are thought to occur very early in the development of skin cancer, since they are already present in microscopic clusters of keratinocytes in sun-exposed human skin [12]. These clusters are thought to precede tumor formation [13] and are more frequent in OTR compared to immunocompetent patients [14]. However, not every SCC contains a mutated TP53 gene [5].

Other common genetic changes found in cutaneous SCC development are the inactivation of the CDKN2A tumor suppressor gene (via mutation, promoter methylation and/or chromosomal loss) and mutation and/or amplification of RAS genes (reviewed in Boukamp et al. [15]). Both oncogenic changes are associated with the progression of AK to SCC. Also, (over-) expression of RAS downstream proteins (MAPKs and cyclins) has been reported in a subset of SCCs [16].

At the chromosomal level, several studies have shown that cutaneous SCCs can display complex karyotypes with large numbers of allelic imbalances [17-19]. Moreover, widespread gains and losses of chromosomal fragments have been reported to be already present in AKs [17,20].

The aim of our study was to identify genes and/or pathways that are consistently involved in the development of cutaneous SCC and their precursor lesions, AKs in OTRs. Thus far, the genome-wide transcriptional profiling studies on SCCs are diverse in nature, show little overlap in differentially expressed genes (DEGs), have limited sample size, use cell lines and do not integrate genomic and expression data [21-24]. This genome-wide study assesses in parallel both RNA and DNA alterations in a sizeable well-defined group of OTRs presenting with both AKs and SCCs. A better understanding of the pathological mechanisms leading to skin carcinomas in these patients could lead to novel molecular targets for effective intervention.


Results
Patient material

Patients were selected from the large group of OTRs that visit the dermatology clinic of the LUMC at a regular basis to provide a well-documented sample series for our study. Moreover from these OTRs it was possible to select both SCCs and AKs as well as normal skin (NS) to circumvent inter-patient variability. Fifteen OTRs (7 females and 8 males) participated in this study (Table 1). The average age of the patients when the selected SCC was diagnosed was 59 years (range 47–74 years). Side-matched normal skin in OTRs often already contains a fair amount of UV damage, a phenomenon described as ‘field cancerisation’ [25,26]. Therefore, (UV-unexposed) skin from the lower back was chosen as normal skin and served as internal negative control. Of patient 42, only SCC and AK samples were available, and for patient 15 only a SCC sample could be obtained. Samples of these two patients were only included in the Genome-wide expression analysis (GWEA). All patients received immunosuppressive drugs (Table 1).

Genome-wide SNP analysis of SCCs and AKs

Thirteen SCC samples and eleven AKs were subjected to genome-wide SNP array analysis together with the corresponding normal DNA from peripheral blood. Results are summarized in Table 2 and Figure 1. Six of thirteen SCCs showed chromosomal aberrations, ranging from a single loss of 9p to multiple losses and gains (amplification/duplication) (Table 2, Figure 1A). Copy number neutral loss of heterozygosity (LOH) was observed in 3 SCCs. Overall, more LOH than gain was seen (14 vs. 9). Also large deletions of (almost) whole chromosome arms were more frequent than small deletions (<40 Mb; 12 vs. 8). In several tumors the detected aberrations were not consistently present in >70% of the tumor sample (i.e. not a full signal of loss or gain), suggesting tumor heterogeneity (Table 2). Four out of thirteen (30%) SCCs demonstrated loss of 9p21 where CDKN2A is located.

Analysis of AK samples showed chromosomal aberrations in 6 of 11 samples, ranging from a single up to multiple (11) aberrations in an affected sample (Table 2, Figure 1B). Again, more losses and copy number neutral LOH than gains were seen (21 vs. 3). Generally, the aberrations observed in AKs, were less extensive than those in SCCs. No correlation was detected among the AKs regarding the extent of chromosomal damage and the relative level of dysplasia. However, similar to SCCs, several AKs demonstrated genetic heterogeneity.

Notably, there was no clear correlation between the number and type of aberrations found in the AK and SCC from the same OTR. However the number of samples in each group was not large enough to perform any statistical analysis.

Cluster and single-gene analyses of expression profiles of SCCs and AKs

Fifteen SCC, fourteen AK and thirteen NS samples were included in the genome wide expression analysis (GWEA). Filtering for annotated and expressed genes resulted in 15,969 probes for further analyses. Subsequent hierarchical clustering, based on expression levels, resulted in two very distinct groups (Figure 2A), separating normal and tumor samples. The tumor samples were divided in three sub-clusters in one arm of the dendogram. Principal component analysis also demonstrated good separation of normal and tumor samples, already in the first component (Figure 2B). In the second component, AKs could be separated from SCCs. No correlation was seen with the type of organ transplanted. However, since 13 of 15 patients were kidney recipients, no definite conclusions can be made about this matter. The same could be concluded for the immunosuppressive regimen (data not shown).

Statistical analysis of the expression data was performed using limma. The following comparisons between sample groups were made: SCC vs. NS, SCC vs. AK and AK vs. NS. For each comparison a FDR <1% was used, and the comparisons were made with several log2 transformed fold change (log2FC) restrictions, namely log2FC > 0.5, log2FC > 1.0 and no log2FC-restriction (Table 3). With log2FC > 0.5, 2,087 probes, representing 2,009 genes, were differentially expressed between SCC and NS (Additional file 1). Among the upregulated genes in SCC were several genes known to be involved in keratinocyte differentiation and skin cancer, including keratins (e.g. KRT16, KRT17 and KRT6), matrix metalloproteinases (MMPs), S100 molecules and small proline-rich proteins (SPRRs). Most of these genes were highly overexpressed with a log2FC > 2.0. The cutaneous T-cell attracting chemokine, CCL27, was the most downregulated gene in SCCs compared to normal skin (log2FC = − 4.2).

With log2FC > 0.5, 977 probes (947 genes) were differentially expressed between AK and NS samples and expression of 571 probes (547 genes) was significantly different between SCCs and AKs (Additional file 1).

In total for the log2FC > 0.5 analysis, 180 probes were present in all three comparisons as visualized by a VennDiagram (Figure 3, Additional file 1). These probes represented 173 genes that were consistently up- or downregulated during the development of SCC from NS, via AK, and can be considered as genes involved in gradual skin cancer progression.

Since SCC, AK and NS samples were available from each patient, we investigated whether the differentially expressed genes between sample groups differed per patient. To this end, a patient factor was included in the design of limma; however this did not change the results (data not shown).

Geneset enrichment analyses of expression of SCCs and AKs

In addition to single-gene analysis, affected molecular pathways were investigated employing gene set enrichment analysis (GSEA) using two different approaches. Firstly, differentially expressed probes between the sample groups from the limma analysis with log2FC > 0.5 (Additional file 1) were analyzed for gene set enrichment with DAVID Bioinformatic Resources. All annotated and expressed probes (n = 15,969) were used as background list. Results are shown in Additional file 2. Genes involved in epidermal development and keratinocytes were among the most enriched GO terms of the biological processes (BP) node in all comparisons. Also KEGG pathways were analyzed by DAVID. When comparing SCC with AK, genes involved in “focal adhesion” and “pathways in cancer” were enriched among the DEGs (Additional file 2).

In the second GSEA approach, the entire dataset was analyzed with the PGSEA package (Figure 4). In this analysis expression profiles of AKs and SCCs were compared to those of NS. PGSEA analysis demonstrated that genes upregulated by RAS were enriched in SCC compared to NS, whereas this was not seen in AK. For both SCC and AK genes positively regulated by TNF, NFκB and fumarate-hydratase (FH, known to be involved in aggressive renal papillary cancers) [27] were enriched. Genes regulated by the oncogenes BRAF and SRC were not enriched in tumors compared to NS.

In addition to GSEA, the results from the limma analysis (log2FC > 0.5, FDR < 0.01, Additional file 1) were subjected to oPOSSUM analysis to investigate if the DEGs were controlled by specific transcription factor (TFs). The TFs whose transcription factor binding sites (TFBSs) were found enriched are listed in Table 4. In the list TFs of upregulated genes, the REL transcription factor class (incl. RELA and NFκB1) was overrepresented. These results correspond with the PGSEA, where genes controlled by NFκB1 were upregulated in SCC and AK (Figure 3). The forkhead (incl. FOXF2 and FOXD1) and ZH-finger (incl. SP1 and MZF1) TF classes were overrepresented in the TFBS of downregulated genes.

Comparison of genome-wide SNP analysis and GWEA

Expression levels of both AKs and SCCs were compared to those of NS based on their chromosomal location to identify any regional chromosomal expression bias using the reb package [28]. Since at the genomic level only a few, non-recurrent chromosomal alterations were found, we compared the results of the genome-wide SNP analyses with those of the regional expression level results per tumor. However, in only very few regions where at the SNP level alterations were seen the expression level of genes in this region were affected too (data not shown).

Validation of the GWEA with QPCR

To validate microarray results, 9 DEGs were selected based on their high log2FC, highly significant adjusted p-value, involvement in identified pathways from the GSEA and potential biological relevance for SCC development. Their expression was quantified by QPCR analysis in all patient samples. The expression of these 9 genes was normalized for the expression of 4 reference genes, which were selected based on their stable expression in the GWEA, using geNORM. Relative differences between sample groups were confirmed for all genes (Table 5, Figure 5), although fold changes were often higher in QPCR results compared to those from the GWEA (Table 5). This is probably due to the larger dynamic range of QPCR compared to array-based analysis.


Discussion

In the present study we performed genome-wide expression analysis on SCCs, AKs and NS from OTRs to identify common pathways involved in the cellular transformation from normal skin cells to AKs and eventually SCC. Data analysis disclosed large numbers of DEGs between NS, AKs and tumor samples and identified the activation of several known oncogenic pathways in SCC, some of which were also activated in AKs.

Our unique isogenic approach in this genome-wide profiling study on a well-documented sample series of OTRs, would circumvent the influence of any possible patient-specific differences on the analysis, including type of immunosuppressive drug used, and would allow identification of genes and pathways specifically involved in progression of skin carcinogenesis. During the last years, several genome-wide expression studies on SCC and AKs have been conducted [21-24]. Most studies focused on genes differentially expressed in SCCs compared to normal skin, although some also included AK samples and cell lines. Since the various studies used different gene expression platforms, tumor selection criteria and isolation and labeling methods, it was impracticable to combine data from these studies with our data into one large dataset and perform a meta-analysis. However, we do see considerable overlap in results obtained, especially after pathway en gene set analyses.

Cluster analysis showed that samples derived from the same patient did not cluster together, indicating that gene expression differences between sample groups (NS, AK and SCC) were larger than differences between patients. So, inter-patient variation did not discernibly influence the results of the expression analysis in our study. Furthermore, gene expression profiles of three AKs demonstrating (mild-to-) severe dysplasia (AK_P-11, AK_P-18 and AK_P42) showed more similarity to that of SCCs than to the other AKs (Figure 2). Even though the numbers were too small to make any statistically reliable statement, this result suggests that the progression of AK to SCC is a continuous process.

Limma analysis demonstrated that more than 40 % of the expressed and annotated probes were differentially expressed between SCC and NS; smaller numbers of DEGs were identified between AK and NS and between SCC and AK. When the analysis was restricted to probes with a log2FC > 0.5 or log2FC > 1.0 the number of differentially expressed probes reduced dramatically, indicating that it was possible to identify subtle but significant changes in expression level in many genes. However, the large number of DEGs hampered identification of genes crucial to SCC development. Moreover, at least for the comparison of SCC with normal skin, differential gene expression might also be caused by non-specific differences owing to increased proliferation and metabolic rate of fast-growing tumor cells compared to keratinocytes in the epidermis. Similar results were obtained previously, where many transcripts showed relatively small changes in expression level between SCC and sun-exposed skin [22]. Additional gene-targeted, approaches are needed to investigate which genes/pathways are crucial for AK formation and subsequent SCC development.

Next to single gene analysis, GSEA was performed to identify specific gene sets and pathways involved in SCC development. With the online resource tool DAVID both GO terms and KEGG pathways were analyzed. From the GO terms analysis, many gene sets involved in (epidermal) cell proliferation and differentiation were enriched in SCC and AK. These gene sets include genes encoding keratins, MMPs, S100 molecules and SPRRs, all (highly) upregulated in SCC and AK compared to normal skin. According to the KEGG analysis, several cancer pathways were enriched in SCC vs. AK or SCC vs. NS, and included ‘pathways in cancer’ and ‘small cell lung cancer’. These cancer pathways comprise many genes downstream of known oncogenes, like RAS and MYC.

Upregulation of downstream targets of RAS was also identified by PGSEA when comparing the profiles of SCC to NS, indicating that this pathway is activated in SCC. NFκB1 and TNF pathways were activated in both AKs and SCCs, suggesting that activation of these pathways is an early event in the development of AK and SCC. NFκB1 is part of the REL TF family, which also includes REL and RELA. Gene promoter analysis by oPOSSUM showed that upregulated genes in SCC and AK were enriched for TF binding sites for REL transcription factors. These TFs have shown to be important in both skin development and carcinogenesis [29,30]. The results from our oPOSSUM analysis concurred with those of a previous study [22].

Both PSGEA and DAVID demonstrated activated RAS signaling in SCC, but not in AK. Previous studies have suggested that RAS might be activated via amplification of the gene locus or by activating mutations (reviewed by Boukamp [15]). However, both copy number alterations (SNP analysis) and oncogenic hot-spot mutations in HRAS and KRAS (data not shown) were not found in our SCCs, suggesting other molecular events to be responsible for activating the RAS signaling. These might include overactivation of the epidermal growth factor receptor (EGFR) upstream of RAS, which is known to occur in a subset of cutaneous SCCs [31,32].

The accuracy of the GWEA was confirmed by validation experiments using QPCR. Differential expression could be confirmed for all nine genes tested. These genes were selected based on their log2FC and adjusted p-value, but also for their presumed biological relevance for the development to SCC. One of these genes, the keratinocyte-specific chemokine CCL27 was confirmed to be downregulated progressively in AK and SCC, corresponding to previous findings that CCL27 was downregulated in keratinocyte-derived tumors [33]. As CCL27 is involved in mediating cutaneous homing of T-lymphocytes [34], its downregulation could signify possible immune evasion by cutaneous SCCs. Furthermore, our GWEA results are in agreement with previous reports that CCL27 is downregulated through activation of the RAS-MAPK-signaling pathway in human skin tumors [33].

Several DEGs identified by GWEA concerned genes involved in epidermal differentiation. Upregulation of intermediate filament keratins KRT6, KRT16 and KRT17, concurred with our previous work in which we found these proteins abundantly expressed in cutaneous SCCs of OTRS, in contrast to normal skin [35]. Also a recent study by Hudson et al. with samples from immunocompetent patients, showed that genes involved in epidermal differentiation were amongst the most DEGs between SCC and normal skin [22].

Next to the genes important in epidermal differentiation, genes involved in extracellular matrix (ECM) organization were differentially expressed in SCCs compared to NS. Among others, QPCR confirmed MMP1, MMP3, MMP9 and MMP10 to be highly upregulated in SCC compared to normal skin, sometimes already in AK. Although MMPs are normally induced temporarily in response to exogenous signals, they are known to play a role in tumor progression and metastasis. MMP1, MMP3 and MMP10 are virtually absent in normal skin, but often found upregulated in cutaneous SCC, although not in AK [36,37]. Moreover, MMP9 has been shown to be involved in the early development of cutaneous SCC in immunosuppressed individuals [38]. Even though it is known that the different MMPs have separate functions [37], MMPs often cooperate in parallel and are regulated by specific and non-specific inhibitors, such as serine proteases such as chymase, plasmin and kallikrein, to achieve targeted ECM degradation. We were able to identify several kallikrein proteins upregulated in SCC compared to normal skin. Upregulation of plasmin and chymase was not found, however these might be inhibited by serpin peptidase inhibitors, such as SERPINB3 and SERPINB4. These genes, which are known to produce circulating SCC-antigens 1 and 2 respectively, were highly upregulated in SCCs in our study and have previously been reported to promote survival of SCC cells in vitro [39].

The SCCs and AKs from the OTRs investigated in this study displayed very few genomic changes. The careful selection of tumor material and the results of the GWEA and QPCR analyses, make us believe that this lack of observed changes is not caused by interference of tumor material with that of normal cells. Nor do we have any indication that many alterations remained undetected because of the Illumina Genotyping Beadchip platform we used. This platform has been successfully used in various other genomic profiling studies [40,41]. Our results from the genome-wide SNP analyses contrast reports on previous studies in which SCCs displayed highly complex karyotypes, including many gains and losses of entire chromosome arms [15,42]. Also in AKs chromosomal aberrations have been reported to occur [20]. However, more recently Purdie et al. demonstrated that SCCs could be separated in genetically distinct subpopulations related to the differentiation status of the tumor [19]. Our results coincide with the observation in this study that well-differentiated SCCs possess fewer genomic aberrations compared to moderate and poorly differentiated tumors, albeit that the absolute number of aberrations per SCC in our study was lower. Although no relationship was detected by Purdie et al. between the patient’s immune status and the number of aberrations observed, eight of nine tumor with 3 or less alterations originated from transplant patients. This observation and the results of our study suggest that perhaps the suppression of the immune system in OTRs may influence the development of SCCs in these patients. This phenomenon has been reported before by Rehman et al., who demonstrated that the LOH rate in SCCs from OTRs was less than half of that in SCCs from immunocompetent patients [43]. Moreover, there could also be a direct effect of the applied immunosuppressive drugs on the molecular pathogenesis of SCCs in OTRs, which has also been suggested before by others [44]. Larger compara-tive studies with SCCs from both OTRs and immunocompetent patients will be necessary to elucidate this matter further.

The results from our genome-wide SNP analysis are unexpected in view of the many changes in mRNA expression levels found in both SCCs and AKs compared to normal skin. Next to a role for immunosuppression as seen in OTRs, the many differences in gene expression observed might be attributable to epigenetic alterations, such as DNA methylation or changes in miRNA expression. The fact that many genes were differentially expressed between tumors and normal skin may be caused by demethylation of these genes or modulation of their transcription factors (e.g. (de)methylation or (de)phosphorylation or interference from miRNA).


Conclusions

With this study we were able to demonstrate vast differences in gene expression profiles to exist between SCC, AK and NS from immunosuppressed OTRs. Moreover, we found that several pathways activated in SCCs were already activated in AKs, confirming the assumption that AKs are the precursor lesions of SCCs. These pathways include the NFκB1 and TNF pathways. RAS and MYC oncogenic pathways on the other hand appear to be specifically activated in SCC. Since the drastic changes in gene expression appeared unlinked to specific genomic gains or losses, the causal events driving SCC development require further investigation. The outcome of the current study also suggests that the early activation of NFκB1 and TNF pathways in the course of SCC development may offer opportunities for targeted preventive intervention in OTRs which may counter act “field cancerisation” by eradicating plaques formed by multiple AKs.


Methods
Patient material

Approval for the present studies was granted by the Leiden University Medical Center institutional review board. Patients were selected from the group of OTRs that are regularly seen at the dermatology clinic of the Leiden University Medical Center [45]. Patients with clinically suspected SCC were informed on the study and after informed consent was obtained, fresh frozen samples were obtained from the SCC. An AK on the forearm and unexposed normal skin (NS) from the buttock were taken and peripheral blood was drawn to serve as normal internal control in genome-wide SNP analysis. All clinical diagnoses were histologically confirmed. SCCs can be histologically categorized as “well”, “moderate” or “poorly differentiated” tumors, based on the degree of keratinization and cellular atypia [46]. All SCCs included in this study were classified as well-differentiated. Most AKs showed mild dysplasia, with the exception of AK_P-11 and AK_P-18, both demonstrating mild to severe dysplasia and AK_P-42 with severe dysplasia.

All samples were further handled in an anonymously coded fashion, following the medical ethical guidelines described in the Code ‘Proper Secondary Use of Human Tissue’ established by the Dutch Federation of Medical Sciences (http://www.federa.org).

RNA and DNA isolation

RNA and DNA were isolated from SCC and AK biopsy samples that contained at least 70% tumor cells, as determined by haematoxylin and eosin stained frozen sections. To ensure that the RNA and DNA represent the same tumor cells/biopsy, the various cut sections were alternately used for RNA and DNA isolation, respectively. From the sample of unexposed NS the epidermis was removed for further processing by cryosectioning parallel to the outer surface of the skin biopsy (cut to a depth where opaque whiting of the remaining dermal surface was observed).

RNA was extracted from frozen material using the RNeasy Fibrous Tissue kit (Qiagen, Hilden, Germany), which included proteinase K treatment (10 min at 55°C) of the lysed sample in RLT-buffer and on-column DNase treatment. DNA from the tumor and skin samples was isolated using the Genomic-tips 20/G kit (Qiagen). A salting-out procedure was used to isolate genomic DNA from the peripheral blood samples [47].

Both RNA and DNA were quantified using a Nanodrop (NanoDrop technologies, Wilmington, CA) and RNA was further evaluated for degradation with the Lab-on-a-chip assay on the 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).

Genome-wide SNP analysis

Genomic DNA from AKs, SCCs and their corresponding normal controls (peripheral blood) were subjected to genome-wide SNP analysis. 400 ng of DNA was assayed with the Infinium II Sentrix HumanHap550v3 duo Genotyping BeadChip (Illumina, San Diego, CA, USA), containing over 550,000 unique tag SNP markers. Hybridizations were performed at the Leiden Genome Technology Center according to the manufacturer’s instructions. Image analysis and quality control (call rate >98%) was performed in Illumina’s BeadStudio Version 3.2 software using the genotyping module. Each BeadChip was self-normalized using information contained within the array. Further analysis and visualization was performed with the Illumina Genome Viewer in Beadstudio. First, tumor data was paired with data from their corresponding normal control. Subsequently, examination of the log R ratio (signal intensity tumor/signal intensity normal control) and B allele frequency (BAF) was analyzed for the presence of copy number variations (CNVs) and/or loss of heterozygosity (LOH) in the tumor samples. By plotting the log R ratio across a chromosome, CNVs could be visualized by an increase or decrease in baseline signal. Secondly, the BAF was plotted across each chromosome to detect regions of LOH in tumor cells.

A region with LOH was defined as a stretch of heterozygous SNPs in normal DNA but homozygous in the matched tumor DNA.

Genome-wide expression analysis (GWEA)

Gene expression profiles were obtained using HumanWG-6 v2 Expression BeadChips (Illumina). In brief, 100 ng of total RNA was converted to cDNA and subsequently labeled cRNA using the Ambion Illumina TotalPrep RNA Amplification kit (Ambion, Austin TX, USA) according to manufacturer’s instructions. The labeled cRNAs were hybridized overnight to the HumanWG-6 v2 BeadChips. After washing, the BeadChips were scanned using the Illumina BeadArray Reader to measure the fluorescence intensity of each probe.

Raw data was extracted from the BeadChip data files in Illumina’s BeadStudio Version 3.2 software using the gene expression module. Background subtracted data was further analyzed in R-based Bioconductor package, lumi (version 1.12.4) [48]. In lumi, the data was transformed (variance-stabilizing transformation (VST)) [49] and normalized (robust spline normalization (RSN)) [48], resulting in log-transformed normalized data. Several quality control plots of both the normalized and unnormalized data were generated in the lumi package. The R-package illuminaHumanv2.db (version 1.4.1) was used for annotation.

The data were purged of genes that did not meet the detection limit (expression-detection P-value >0.01) and/or were not annotated. This selection resulted in 15,969 probes, representing 13,848 genes that were subjected to further analysis.

Hierarchical clustering and principal component analysis (PCA) were used to cluster the samples based on their expression levels, using the bioDist package (version 1.18.0).

The limma package (version 3.2.3) [50] was used to identify differentially expressed genes (DEGs) between SCC, AK and NS. A Benjamini and Hochberg False Discovery Rate (FDR) of 1% was used as cut-off to select significant DEGs and correct for multiple testing.

Gene set enrichment analysis (GSEA) for enriched Gene Ontology (GO) terms and KEGG pathways was performed with the significantly DEGs from the limma analysis using DAVID Bioinformatic Resources v6.7 (http://david.abcc.ncifcrf.gov) [51]. Secondly, GSEA on the entire data set was performed using the parametric gene set enrichment analysis (PGSEA) and regional expression bias (reb) packages (version 1.14.0) [28].

To identify activation of transcription factors (TFs) in AKs and SCCs, the DEGs from the limma analysis were investigated for over-represented TF binding sites (TFBSs) using the online analysis tool oPOSSUM [52]. Only the vertebrate taxonomic supergroup was selected and for each comparison the top 5 TFs were selected.

Both the gene expression data and genome-wide SNP analysis have been deposited in the NCBIs Gene Expression Omnibus [53] as a SuperSeries with accession number GSE32979 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE32979).

Quantitative RT-PCR (QPCR)

For 10 NS, 13 AK and 15 SCC samples sufficient amounts of total RNA were available for cDNA synthesis using the iScript™ cDNA Synthesis Kit (Bio-Rad, Veenendaal, the Netherlands) according to manufacturer’s instructions. Primers (Invitrogen, Breda, the Netherlands) were designed for nine genes of interest and four reference genes (Table 6). The reference genes were selected based on their stable expression in all samples in the GWEA. QPCR reactions were performed using the SYBR Green Supermix (Bio-Rad) on the CFX384™ real-time PCR detection system (Bio-Rad). The PCR-program included initialization (6 min at 95°C), 45 cycles of denaturation (15 s at 95°C), annealing (30 s at 60°C) and elongation (30 s at 72°C), final elongation for 1 min at 72°C and a DNA melting curve (55°C to 95°C through 0.2°C increments every 10s). All samples were tested in duplicate. Specificity of PCR products was evaluated by size in agarose gel electrophoresis followed by DNA sequence analysis. Serial dilutions of cDNA from spontaneously immortalized keratinocytes (own laboratory) and universal human reference RNA (Stratagene, Santa Clara, CA USA) were included to determine PCR-efficiencies.

The stable expression of the reference genes was validated by analyzing their QPCR data using the geNORM method (M < 1.0, CV < 0.5) in the freely available qBase software [54,55]. QPCR data of the genes of interest were normalized based on the expression of the reference genes using the normalization factor from geNORM. Relative gene expression between the different sample groups was statistically analyzed in Excel, using a two-sided Student’s T-test assuming unequal variance. P-value ≤ 0.05 was considered significant.


Abbreviations

AK: Actinic keratosis; BAF: B allele frequency; BCC: Basal cell carcinoma; BP: Biological processes; DEG: Differentially expressed gene; DEP: Differentially expressed probe; ECM: Extracellular matrix; FDR: False discovery rate; GWEA: Genome-wide expression analysis; HPV: Human papilloma virus; KEGG: Kyoto encyclopedia of genes and genomes; log2FC: log2 fold change; LOH: Loss of heterozygosity; NS: Normal skin; OTR: Organ transplant recipient; PCA: Principal component analysis; (P)GSEA: (parametric) geneset enrichment analysis; QPCR: Quantitative RT-PCR; RT-PCR: Reversed transcriptase polymerase chain reaction; SCC: Squamous cell carcinoma; TSG: Tumor suppressor gene; TF: Transcription factor; TFBS: Transcription factor binding-site; UVR: Ultraviolet radiation.


Competing interests

The authors declare that they have no competing interests.


Author’s contributions

LH carried out the experiments, performed statistical analyses and drafted the manuscript. SC carried out the QPCR experiments and drafted the manuscript; JNBB and HCW selected patients and collected the samples; LH, JNBB, FRG, RW, LM, CPT and HV designed the study; all authors saw and approved the final manuscript.


Authors’ information

Cornelis P Tensen and Harry Vrieling shared senior authorship.


Pre-publication history

The pre-publication history for this paper can be accessed here:

http://www.biomedcentral.com/1471-2407/13/58/prepub


Supplementary Material Additional file 1

Results of the Toptable from the limma analysis. Differentially expressed probes between SCC and NS, between AK and NS, between SCC and AK, and the progression list with FDR < 0.01 and log2FC > = 0.5, including the VST transformed RSN normalized data.


Click here for additional data file (1471-2407-13-58-S1.xls)

Additional file 2

Result DAVID analysis for the differentially expressed probes between the sample groups from the limma analysis with log2FC > 0.5 and FDR < 0.01. (XLS 201 kb)


Click here for additional data file (1471-2407-13-58-S2.xls)


Acknowledgments

The authors would like to thank the patients for the cooperation in this study, Wim Zoutman and Coby Out for their technical assistance, Branco Misovic and Jelle Goeman for their help with the statistical analysis of the GWEA, the Leiden Genome Technology Center for their technical assistance and the pathology department is for the histopathological evaluation of the tumor samples. The work was supported by a scholarship of the LUMC for LH. The authors have no conflict of interest.


References
Bouwes Bavinck JN,Hardie DR,Green A,Cutmore S,MacNaught A,O’Sullivan B,Siskind V,van ver Woude FJ,Hardie IR,The risk of skin cancer in renal transplant recipients in Queensland, Australia. A follow-up studyTransplantationYear: 19966171572110.1097/00007890-199603150-000088607173
Bordea C,Wojnarowska F,Millard PR,Doll H,Welsh K,Morris PJ,Skin cancers in renal-transplant recipients occur more frequently than previously recognized in a temperate climateTransplantationYear: 20047757457910.1097/01.TP.0000108491.62935.DF15084938
Fortina AB,Piaserico S,Caforio AL,Abeni D,Alaibac M,Angelini A,Iliceto S,Peserico A,Immunosuppressive level and other risk factors for basal cell carcinoma and squamous cell carcinoma in heart transplant recipientsArch DermatolYear: 20041401079108510.1001/archderm.140.9.107915381547
Glover MT,Deeks JJ,Raftery MJ,Cunningham J,Leigh IM,Immunosuppression and risk of non-melanoma skin cancer in renal transplant recipientsLancetYear: 19973493989033469
Brash DE,Rudolph JA,Simon JA,Lin A,McKenna GJ,Baden HP,Halperin AJ,Ponten J,A role for sunlight in skin cancer: UV-induced p53 mutations in squamous cell carcinomaProc Natl Acad Sci USAYear: 199188101241012810.1073/pnas.88.22.101241946433
Ullrich SE,Mechanisms underlying UV-induced immune suppressionMutat ResYear: 200557118520510.1016/j.mrfmmm.2004.06.05915748647
Proby CM,Harwood CA,Neale RE,Green AC,Euvrard S,Naldi L,Tessari G,Feltkamp MC,de Koning MN,Quint WG,et al. A case–control study of betapapillomavirus infection and cutaneous squamous cell carcinoma in organ transplant recipientsAm J TransplantYear: 2011111498150810.1111/j.1600-6143.2011.03589.x21718442
Nindl I,Gottschling M,Stockfleth E,Human papillomaviruses and non-melanoma skin cancer: Basic virology and clinical manifestationsDis MarkersYear: 20072324725917627060
Arron ST,Ruby JG,Dybbro E,Ganem D,Derisi JL,Transcriptome sequencing demonstrates that human papillomavirus is not active in cutaneous squamous cell carcinomaJ Invest DermatolYear: 20111311745175310.1038/jid.2011.9121490616
Ko CJ,Actinic keratosis: facts and controversiesClin DermatolYear: 20102824925310.1016/j.clindermatol.2009.06.00920541675
McGregor JM,Berkhout RJ,Rozycka M,ter Schegget J,Rozycka M,Bouwes Bavinck JN,Crook T,p53 mutations implicate sunlight in post-transplant skin cancer irrespective of human papillomavirus statusOncogeneYear: 1997151737174010.1038/sj.onc.12013399349508
Jonason AS,Kunala S,Price GJ,Restifo RJ,Spinelli HM,Persing JA,Leffell DJ,Tarone RE,Brash DE,Frequent clones of p53-mutated keratinocytes in normal human skinProc Natl Acad Sci USAYear: 199693140251402910.1073/pnas.93.24.140258943054
Rebel H,Mosnier LO,Berg RJ,Westerman-de Vries A,van Steeg H,van Kranen HJ,de de Gruijl HJ,Early p53-positive foci as indicators of tumor risk in ultraviolet-exposed hairless mice: kinetics of induction, effects of DNA repair deficiency, and p53 heterozygosityCancer ResYear: 20016197798311221893
de Graaf YG,Rebel H,Elghalbzouri A,Cramers P,Nellen RG,Willemze R,Bouwes Bavinck JN,de Gruijl FR,More epidermal p53 patches adjacent to skin carcinomas in renal transplant recipients than in immunocompetent patients: the role of azathioprineExp DermatolYear: 20081734935510.1111/j.1600-0625.2007.00651.x17979968
Boukamp P,Non-melanoma skin cancer: what drives tumor development and progression?CarcinogenesisYear: 2005261657166710.1093/carcin/bgi12315905207
Tsang DK,Crowe DL,The mitogen activated protein kinase pathway is required for proliferation but not invasion of human squamous cell carcinoma linesInt J OncolYear: 19991551952310427134
Ashton KJ,Weinstein SR,Maguire DJ,Griffiths LR,Chromosomal aberrations in squamous cell carcinoma and solar keratoses revealed by comparative genomic hybridizationArch DermatolYear: 200313987688210.1001/archderm.139.7.87612873882
Purdie KJ,Lambert SR,Teh MT,Chaplin T,Molloy G,Raghavan M,Kelsell DP,Leigh IM,Harwood CA,Proby CM,et al. Allelic imbalances and microdeletions affecting the PTPRD gene in cutaneous squamous cell carcinomas detected using single nucleotide polymorphism microarray analysisGenes Chromosomes CancerYear: 20074666166910.1002/gcc.2044717420988
Purdie KJ,Harwood CA,Gulati A,Chaplin T,Lambert SR,Cerio R,Kelly GP,Cazier JB,Young BD,Leigh IM,et al. Single nucleotide polymorphism array analysis defines a specific genetic fingerprint for well-differentiated cutaneous SCCsJ Invest DermatolYear: 20091291562156810.1038/jid.2008.40819131950
Rehman I,Takata M,Wu YY,Rees JL,Genetic change in actinic keratosesOncogeneYear: 199612248324908700506
van Haren R,Feldman D,Sinha AA,Systematic comparison of nonmelanoma skin cancer microarray datasets reveals lack of consensus genesBr J DermatolYear: 20091611278128710.1111/j.1365-2133.2009.09338.x19681882
Hudson LG,Gale JM,Padilla RS,Pickett G,Alexander BE,Wang J,Kusewitt DF,Microarray analysis of cutaneous squamous cell carcinomas reveals enhanced expression of epidermal differentiation complex genesMol CarcinogYear: 20104961962910.1002/mc.2063620564339
Padilla RS,Sebastian S,Jiang Z,Nindl I,Larson R,Gene expression patterns of normal human skin, actinic keratosis, and squamous cell carcinoma: a spectrum of disease progressionArch DermatolYear: 201014628829310.1001/archdermatol.2009.37820231500
Ra SH,Li X,Binder S,Molecular discrimination of cutaneous squamous cell carcinoma from actinic keratosis and normal skinMod PatholYear: 20112496397321743436
Hofbauer GF,Bouwes Bavinck JN,Euvrard S,Organ transplantation and skin cancer: basic problems and new perspectivesExp DermatolYear: 20101947348210.1111/j.1600-0625.2010.01086.x20482618
Braakhuis BJ,Tabor MP,Kummer JA,Leemans CR,Brakenhoff RH,A genetic explanation of Slaughter’s concept of field cancerization: evidence and clinical implicationsCancer ResYear: 2003631727173012702551
Sudarshan S,Linehan WM,Neckers L,HIF and fumarate hydratase in renal cancerBr J CancerYear: 20079640340710.1038/sj.bjc.660354717211469
Furge KA,Chen J,Koeman J,Swiatek P,Dykema K,Lucin K,Kahnoski R,Yang XJ,Teh BT,Detection of DNA copy number changes and oncogenic signaling abnormalities from gene expression data reveals MYC activation in high-grade papillary renal cell carcinomaCancer ResYear: 2007673171317610.1158/0008-5472.CAN-06-457117409424
Gugasyan R,Voss A,Varigos G,Thomas T,Grumont RJ,Kaur P,Grigoriadis G,Gerondakis S,The transcription factors c-rel and RelA control epidermal development and homeostasis in embryonic and adult skin via distinct mechanismsMol Cell BiolYear: 2004245733574510.1128/MCB.24.13.5733-5745.200415199130
Loercher A,Lee TL,Ricker JL,Howard A,Geoghegen J,Chen Z,Sunwoo JB,Sitcheran R,Chuang EY,Mitchell JB,et al. Nuclear factor-kappaB is an important modulator of the altered gene expression profile and malignant phenotype in squamous cell carcinomaCancer ResYear: 2004646511652310.1158/0008-5472.CAN-04-085215374962
Rittie L,Kansra S,Stoll SW,Li Y,Gudjonsson JE,Shao Y,Michael LE,Fisher GJ,Johnson TM,Elder JT,Differential ErbB1 signaling in squamous cell versus basal cell carcinoma of the skinAm J PatholYear: 20071702089209910.2353/ajpath.2007.06053717525275
Commandeur S,van Drongelen V,de Gruijl FR,Ghalbzouri AE,Epidermal growth factor receptor activation and inhibition in 3D in vitro models of normal skin and human cutaneous squamous cell carcinomaCancer SciYear: 20121032120212610.1111/cas.1202622974223
Pivarcsi A,Muller A,Hippe A,Rieker J,van Lierop A,Steinhoff M,Seeliger S,Kubitza R,Pippirs U,Meller S,et al. Tumor immune escape by the loss of homeostatic chemokine expressionProc Natl Acad Sci USAYear: 2007104190551906010.1073/pnas.070567310418025475
Morales J,Homey B,Vicari AP,Hudak S,Oldham E,Hedrick J,Orozco R,Copeland NG,Jenkins NA,McEvoy LM,et al. CTACK, a skin-associated chemokine that preferentially attracts skin-homing memory T cellsProc Natl Acad Sci USAYear: 199996144701447510.1073/pnas.96.25.1447010588729
Commandeur S,de Gruijl FR,Willemze R,Tensen CP,El Ghalbzouri A,An in vitro three-dimensional model of primary human cutaneous squamous cell carcinomaExp DermatolYear: 20091884985610.1111/j.1600-0625.2009.00856.x19469895
Son KD,Kim TJ,Lee YS,Park GS,Han KT,Lim JS,Kang CS,Comparative analysis of immunohistochemical markers with invasiveness and histologic differentiation in squamous cell carcinoma and basal cell carcinoma of the skinJ Surg OncolYear: 20089761562010.1002/jso.2100618404670
Tsukifuji R,Tagawa K,Hatamochi A,Shinkai H,Expression of matrix metalloproteinase-1, -2 and −3 in squamous cell carcinoma and actinic keratosisBr J CancerYear: 1999801087109110.1038/sj.bjc.669046810362121
Chebassier N,Leroy S,Tenaud I,Knol AC,Dreno B,Overexpression of MMP-2 and MMP-9 in squamous cell carcinomas of immunosuppressed patientsArch Dermatol ResYear: 200229412412610.1007/s00403-002-0299-x12029498
Ahmed ST,Darnell JE Jr,Serpin B3/B4, activated by STAT3, promote survival of squamous carcinoma cellsBiochem Biophys Res CommunYear: 200937882182510.1016/j.bbrc.2008.11.14719070595
Peiffer DA,Le JM,Steemers FJ,Chang W,Jenniges T,Garcia F,Haden K,Li J,Shaw CA,Belmont J,et al. High-resolution genomic profiling of chromosomal aberrations using Infinium whole-genome genotypingGenome ResYear: 2006161136114810.1101/gr.540230616899659
Yachida S,Jones S,Bozic I,Antal T,Leary R,Fu B,Kamiyama M,Hruban RH,Eshleman JR,Nowak MA,et al. Distant metastasis occurs late during the genetic evolution of pancreatic cancerNatureYear: 20104671114111710.1038/nature0951520981102
Ashton KJ,Carless MA,Griffiths LR,Cytogenetic alterations in nonmelanoma skin cancer: a reviewGenes Chromosomes CancerYear: 20054323924810.1002/gcc.2018315834942
Rehman I,Quinn AG,Takata M,Taylor AE,Rees JL,Low frequency of allelic loss in skin tumours from immunosuppressed individualsBr J CancerYear: 19977675775910.1038/bjc.1997.4579310241
O’Donovan P,Perrett CM,Zhang X,Montaner B,Xu YZ,Harwood CA,McGregor JM,Walker SL,Hanaoka F,Karran P,Azathioprine and UVA light generate mutagenic oxidative DNA damageScienceYear: 20053091871187410.1126/science.111423316166520
Wisgerhof HC,van der Geest LG,de Fijter JW,Haasnoot GW,Claas FH,le Cessie S,Willemze R,Bouwes Bavinck JN,Incidence of cancer in kidney-transplant recipients: a long-term cohort study in a single centerCancer EpidemiolYear: 20113510511110.1016/j.canep.2010.07.00220674538
Breuninger H,Black B,Rassner G,Microstaging of squamous cell carcinomasAm J Clin PatholYear: 1990946246272239827
Miller SA,Dykes DD,Polesky HF,A simple salting out procedure for extracting DNA from human nucleated cellsNucleic Acids ResYear: 198816121510.1093/nar/16.3.12153344216
Du P,Kibbe WA,Lin SM,lumi: a pipeline for processing Illumina microarrayBioinformaticsYear: 2008241547154810.1093/bioinformatics/btn22418467348
Lin SM,Du P,Huber W,Kibbe WA,Model-based variance-stabilizing transformation for Illumina microarray dataNucleic Acids ResYear: 200836e1118178591
Smyth GK,Linear models and empirical bayes methods for assessing differential expression in microarray experimentsStat Appl Genet Mol BiolYear: 20043Article316646809
Huang DW,Sherman BT,Lempicki RA,Systematic and integrative analysis of large gene lists using DAVID bioinformatics resourcesNat ProtocYear: 20094445719131956
Ho Sui SJ,Mortimer JR,Arenillas DJ,Brumm J,Walsh CJ,Kennedy BP,Wasserman WW,oPOSSUM: identification of over-represented transcription factor binding sites in co-expressed genesNucleic Acids ResYear: 2005333154316410.1093/nar/gki62415933209
Edgar R,Domrachev M,Lash AE,Gene expression omnibus: NCBI gene expression and hybridization array data repositoryNucleic Acids ResYear: 20023020721010.1093/nar/30.1.20711752295
Vandesompele J,de Preter K,Pattyn F,Poppe B,van Roy N,de Paepe A,Speleman F,Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genesGenome BiolYear: 20023RESEARCH003412184808
Hellemans J,Mortier G,de Paepe A,Speleman F,Vandesompele J,qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR dataGenome BiolYear: 20078R1910.1186/gb-2007-8-2-r1917291332

Figures

[Figure ID: F1]
Figure 1 

Graphical overview of chromosomal aberrations in SCCs and AKs. Idiograms summarizing chromosomal aberrations in SCCs (A) and AKs (B) compared to the patient matched normal control. LOH events are shown to the left of the chromosomes in either red (physical loss) or blue (copy-neutral LOH (cnLOH)). Gains are indicated on the right of the chromosomes in green. Dotted lines represent aberrations that were not present in all tumor cells of a sample.



[Figure ID: F2]
Figure 2 

Cluster analysis. (A) Dendogram of unsupervised hierarchical cluster analysis of all samples. Clustering was based on 10,100 probes for which the average expression among all samples showed a standard deviation ≥ 0.15. Samples are labeled by sample group (NS/AK/SCC) and patient number (P-#). (B) Scatter plot of the first two components from PCA based on 6,104 probes for which the average expression among all samples showed a standard deviation/mean ≥ 0.1. Labels indicate the position for each sample (NS/AK/SCC) of a certain patient (P-#).



[Figure ID: F3]
Figure 3 

Venn diagrams of differentially expressed probes (DEPs) from different comparisons within the three sample groups; NS, AK and SCC. The FDR was set at <1%. (A) Differentially expressed probes with FDR < 1%. (B) DEPs with log2FC > 0.5 and FDR < 1%. (C) DEPs with log2FC > 1.0 and FDR < 1%.



[Figure ID: F4]
Figure 4 

Results Parametric geneset enrichment analysis (PGSEA). Gene expression profiles derived from AK (n = 14) and SCC (n = 15) samples were compared with gene expression profiles derived from normal skin (NS, n = 13) samples and analyzed using PGSEA for the gene lists that contain genes responsive to oncogenes or for indicated pathways. The genes that show increased expression to NS for each pathway are indicated with ‘up’. List of genes that show decreased expression relative to control cells for each pathway are indicated with ‘down’ [28]. The resulting t-statistic for each gene list was plotted (−10 < t < 10), p < 0.005); red squares represent significant number of genes in the list with increased expression in tumor samples (AK or SCC) relative to NS; blue squares represent a significant number of genes in each list with decreased expression.



[Figure ID: F5]
Figure 5 

QPCR and genome-wide expression analysis (GWEA). (A) Histograms showing the expression level of CCL27 in NS, AK and SCC samples measured by QPCR (left) and GWEA (right). (B) Histograms showing the expression level of KRT17 in NS, AK and SCC samples measured by QPCR (left) and GWEA (right). For QPCR the normalized relative expression level represents the expression of the gene of interest normalized to those of four reference genes. For the GWEA the normalized expression level represents the RSN normalized, VST transformed expression of the gene of interest.



Tables
[TableWrap ID: T1] Table 1 

Patient and tumor characteristics


Patient characteristics
SCC
AKd
NSd
Peripheral blood
Patient Gendera Ageb Transplanted organ Drugsc location location location Yes/No
P-3
M
56
Kidney
MMF, P
Upper leg
Forearm
Lower back
Yes
P-5
M
72
Kidney
Aza, P
Lower arm
Forearm
Lower back
Yes
P-11
F
56
Kidney
Aza, P
Tibia
Forearm
Lower back
Yes
P-15
M
62
Kidney
P
Lower arm
n.a.
n.a.
No
P-18
M
51
Kidney-pancreas
Aza, P
Dorsal hand
Forearm
Lower back
Yes
P-24
M
74
Kidney
Aza, P
Lower leg
Forearm
Lower back
Yes
P-27
F
56
Liver
Tacroli-mus, P
Shoulder
Forearm
Lower back
Yes
P-33
F
66
Kidney
Aza, P
Shoulder
Forearm
Lower back
Yes
P-38
F
47
Kidney
Aza, P
Shoulder
Forearm
Lower back
Yes
P-39
F
65
Kidney
Aza, P
Lower leg
Upper arm
Lower back
Yes
P-40
M
60
Kidney
MMF, P
Dorsal hand
Forearm
Lower back
Yes
P-41
M
61
Kidney
Aza, P
Dorsal hand
Forearm
Lower back
Yes
P-42
F
48
Kidney
Aza, P
Dorsal hand
Dorsal hand
n.a.
No
P-44
M
62
Kidney
Aza, P
Dorsal hand
Forearm
Lower back
Yes
P-57 F 53 Kidney Aza, P Tibia Forearm Lower back Yes

a F: female; M: male.

b Age when SCC used for study was diagnosed.

c Immunosuppresive drugs at time of SCC diagnosis. MMF: mycophenolate mofetil; P: prednisone; Aza: azathioprine.

d n.a = not available for study.


[TableWrap ID: T2] Table 2 

Overview of chromosomal aberrations in SCCs and AKs


  Type of aberration Cytoband Mb location Size (Mb)  
SCC_P-03
Loss
4q28.3
1:136,448,440 - 136,988,409
0.54
*
 
Gain
5p
 
 
*
 
Gain
14q23.1-32.2
14:57,558,740 - 96,468,442
38.9
*
SCC_P-11
Gain
9q
 
 
*
SCC_P-18
Gain
8q24.22-24.23
8:132,122,430 - 139,467,653
7.3
*
 
Gain
14q13.3
14:71,054,120 - 73,596,540
2.5
 
 
Gain
9p23-tel
9:1–12,039,121
12
*
 
Loss
9p23-cen
 
~40
*
 
Loss
9q
 
 
*
 
Loss
14q13.3-tel
 
~70
*
 
cnLOH
17
 
 
*
SCC_P-27
Loss
3p
 
 
 
 
Gain
3q
 
 
 
 
Loss
4p12-tel
4:1–46,377,946
46,4
*
 
Gain
5q25.3-tel
5:83,159,010 - 100,338,915
17.1
*
 
Loss
6q13-14.1
6:75,600,000 - 76,627,715
1.0
*
 
Loss
9p
 
 
 
 
Gain
9q
 
 
 
 
cnLOH
18p
 
 
 
SCC_P-38
cnLOH
6p21.31-tel
6:1–35,593,684
35.5
 
 
Loss
9p
 
 
 
 
Loss
14q
 
 
 
SCC_P-41
cnLOH
22q12.1-tel
22:24,348,300 - 49,554,696
25.2
 
AK_P-03
Loss
4q
 
 
*
 
Loss
5q15-31.1
5:96,745,240 - 133,072,806
36.3
*
 
cnLOH
5q31.1-tel
5:133,268,490 - 180,857,816
47.2
*
 
cnLOH
9q
 
 
*
AK_P-05
Loss
5q
 
 
*
 
Loss
9p21.1-tel
9:1–33,109,143
 
*
AK_P-11
Loss
2p22.2-25.1
2:11,690,000 - 36,950,000
25.3
*
 
cnLOH
8p
 
 
*
 
Loss
13q
 
 
*
 
Loss
17p
 
 
*
 
Loss
18q12.1-tel
18:26,013,440 - 76,117,152
50.1
*
AK_P-33
Loss
6q22.31-tel
6:122,757,319 - 170,975,699
48.2
*
AK_P-41
Loss
1p32.3
1:54,783,720 - 55,100,840
0.4
*
 
Loss
3p
 
 
 
 
Gain
3q
 
 
*
 
Loss
4q33-tel
4:171,450,620 - 191,411,215
20.0
 
 
Gain
5q31.2-tel
5:138,387,890 - 180,857,851
42.5
*
 
Loss
8p12-tel
8:1–38,377,990
38.4
 
 
Loss
8q22.1
8:95,250,740 - 96,376,326
1.3
 
 
Loss
9p22.2-cen
9:17,230,530 - 50,549,240
33.3
 
 
Gain
10p
10:1–40,144,085
40.1
*
 
Loss
12q24.23
 
0.5
 
 
Loss
14q
 
 
 
AK_P-44 cnLOH 8q33.3-tel 8:126,444,040 - 137,979,818 11.4  

* heterogeneous chromosomal aberration: observed in less than 70% of the tumor sample.


[TableWrap ID: T3] Table 3 

Overview of differentially expressed probes (DEPs) between the different sample groups


  SCC vs. NS AK vs. NS SCC vs. AK ‘Progression’
# of samples
15 vs. 13
14 vs. 13
15 vs. 14
 
# of DEPs with FDR < 0.01
6820* (3333/3487)
3734 (1554/2180)
2131 (1088/1043)
658 (262/396)
# of DEPs with FDR < 0.01 and log2FC > = 0.5
2087 (1087/1009)
977 (526/451)
571 (289/282)
180 (90/90)
# of DEP with FDR < 0.01 and log2FC > = 1.0 639 (370/269) 219 (167/52) 145 (81/64) 40 (32/8)

* Total number of DEPs (number of upregulated DEPs/number of downregulated DEPs).


[TableWrap ID: T4] Table 4 

Results oPOSSUM analysis of overrepresented transcription factors in the differentially expressed genes from limma (logFC > 0.5, FDR < 0.01)


TF TF class Target genes Z-scorea Fisher scoreb
SCC vs NS
 
 
 
 
Up- and downregulated genes (1514 of 2036 genes includedc)
SRF
MADS
107
12.25
7.38E-05
Hand1-Tcfe2a
bHLH
1148
10.30
3.31E-06
RELA
REL
576
8.01
1.21E-06
SP1
ZN-FINGER, C2H2
1036
7.80
1.34E-09
SPIB
ETS
1374
5.97
4.72E-06
Upregulated genes (736 of 1039 genes included)
 
 
SRF
MADS
62
16.93
5.02E-05
RELA
REL
291
11.68
2.66E-04
Hand1-Tcfe2a
bHLH
565
9.30
1.53E-02
ELF5
ETS
658
9.25
2.38E-05
REL
REL
450
8.40
2.86E-05
Downregulated genes (758 of 1004 genes included)
FOXF2
FORKHEAD
221
12.93
1.52E-06
SP1
ZN-FINGER, C2H2
536
11.03
1.12E-08
FOXD1
FORKHEAD
459
8.409
2.16E-06
Foxq1
FORKHEAD
349
7.176
1.47E-06
TP53
P53
3
6.687
1.04E-01
AK vs NS
 
 
 
 
Up- and downregulated genes (695 of 960 genes included)
SP1
ZN-FINGER, C2H2
494
16.58
1.32E-08
MZF1_1-4
ZN-FINGER, C2H2
644
14.28
2.43E-07
SRF
MADS
56
13.50
1.32E-04
Cebpa
bZIP
437
10.90
1.99E-05
TEAD1
TEA
217
10.80
8.74E-05
MZF1_5-13
ZN-FINGER, C2H2
527
10.37
1.59E-08
Upregulated genes (364 of 515 genes included)
 
 
SRF
MADS
35
19.82
8.10E-05
ELF5
ETS
319
11.05
2.04E-04
RELA
REL
150
10.03
1.60E-04
SPIB
ETS
338
9.25
2.28E-04
TLX1-NFIC
HOMEO/CAAT
32
9.00
5.07E-03
Downregulated genes (695 of 960 genes included)
 
 
SP1
ZN-FINGER, C2H2
248
17.04
1.63E-07
MZF1_1-4
ZN-FINGER, C2H2
309
11.7
3.74E-04
Arnt-Ahr
bHLH
289
11.49
2.25E-09
Cebpa
bZIP
228
11.18
5.86E-07
Roaz
ZN-FINGER, C2H2
130
10.88
2.11E-05
SCC vs AK
 
 
 
 
Up- and downregulated genes (412 of 553 genes included)
RREB1
ZN-FINGER, C2H2
38
11.29
1.24E-03
FOXF2
FORKHEAD
111
10.99
7.16E-03
SRF
MADS
36
10.01
4.10E-04
RELA
REL
163
9.239
8.26E-04
TEAD1
TEA
120
8.031
2.46E-02
Upregulated genes (209 of 283 genes included)
 
 
SRF
MADS
24
15.39
6.72E-05
RELA
REL
85
11.99
5.32E-03
Fos
bZIP
157
10.98
3.68E-04
NF-kappaB
REL
108
8.39
2.22E-04
REL
REL
129
7.91
1.93E-03
Downregulated genes (204 of 271 genes included)
 
 
FOXF2
FORKHEAD
70
22.37
2.55E-05
FOXI1
FORKHEAD
126
10.74
7.22E-02
RREB1
ZN-FINGER, C2H2
22
9.86
1.81E-03
T
T-BOX
28
8.77
5.00E-03
Foxd3
FORKHEAD
129
7.91
5.37E-02
Progression genes
 
 
 
 
Up- and downregulated genes (128 of 172 genes included)
RELA
REL
54
10.18
1.00E-02
SP1
ZN-FINGER, C2H2
94
9.66
1.76E-03
FOXF2
FORKHEAD
36
7.30
5.18E-02
NFKB1
REL
35
6.21
1.09E-02
MZF1_1-4
ZN-FINGER, C2H2
118
6.11
3.15E-02
Upregulated genes (53 of 85 genes included)
 
 
RELA
REL
23
14.0
5.41E-02
NFKB1
REL
19
9.78
2.48E-03
SRF
MADS
6
8.09
3.82E-02
TLX1-NFIC
HOMEO/CAAT
7
7.65
2.27E-02
MIZF
ZN-FINGER, C2H2
11
7.11
3.21E-02
Downregulated genes (75 of 87 genes included)
 
 
FOXF2
FORKHEAD
29
14.63
6.46E-04
FOXI1
FORKHEAD
48
11.42
1.14E-01
T
T-BOX
13
8.14
7.45E-03
Foxa2
FORKHEAD
50
8.02
4.40E-02
SP1 ZN-FINGER, C2H2 56 7.60 7.94E-03

a The Z-score determines whether a TFBS occurs more frequently in the set of co-expressed genes compared to pre-computed background set provided by the package.

b The Fisher score (one-tailed Fisher exact) is calculated to determine the probability of non-random association between the co-expressed genes and the TFBS site of interest.

c The number of genes in the differentially expressed gene set that could be aligned to the pre-computed background.

For more details on the oPOSSUM analysis: S.J. Ho Sui et al., (2005) Nucleic Acid Res., 33: 3154–64.


[TableWrap ID: T5] Table 5 

Results QPCR validation compared with the results from the genome-wide expression analysis


QPCR validation experiment
 
 
 
 
 
 
 
 
 
 
 
Normalized relative expressiona
 
 
Fold change and P-value Student’sT-testb
 
 
NS (n = 10)
AK (n = 13)
SSC (n = 15)
SCC vs NS
AK vs NS
SCC vs AK
Gene Median SE Median SE Median SE log2(FC) p-value log2(FC) p-value log2(FC) p-value
CCL27
18,45
2,53
2,46
0,91
0,11
0,14
−7,34
5,48E-05
−2,91
1,80E-04
−4,43
3,30E-03
KRT17
0,12
0,03
1,19
0,41
5,20
0,97
5,39
7,13E-05
3,26
7,07E-03
2,13
1,13E-03
MMP1
0,01
0,01
0,28
1,16
47,19
35,2
12,18
5,68E-02
4,80
2,32E-01
7,38
6,14E-02
MMP3
0,01
0,01
0,36
0,37
17,91
4,95
10,99
3,03E-03
5,36
4,07E-02
5,63
4,31E-03
MMP9
0,07
0,01
1,83
0,74
4,49
4,21
6,07
1,82E-02
4,77
4,42E-03
1,30
6,07E-02
MMP10
0,02
0,03
0,95
1,17
17,70
8,24
9,59
2,69E-03
5,38
4,53E-02
4,21
5,16E-03
PI3
0,02
0,01
2,01
1,67
10,62
6,23
8,95
5,46E-03
6,55
7,71E-03
2,40
3,25E-02
SERPINB4
0,004
0,002
1,99
6,2
18,79
15,7
12,33
2,35E-02
9,09
3,96E-02
3,24
1,46E-01
TUBB3
0,51
0,08
0,64
0,17
3,68
0,94
2,85
1,17E-03
0,32
3,20E-01
2,53
1,78E-03
Genome-wide expression analysis
 
 
 
 
 
 
 
 
 
 
Normalized expression c
 
 
 
Results limma analysis
 
 
 
 
NS (n = 13)
AK (n = 14)
SSC (n = 15)
SCC vs NS
AK vs NS
SCC vs AK
Gene
Median
SE
Median
SE
Median
SE
log2FC
Adj. p-val
log2FC
Adj. p-val
log2FC
Adj. p-val
CCL27
12,92
0,02
10,74
0,10
8,60
0,03
−4,24
2,03E-15
−2,24
9,64E-08
−2,00
1,65E-06
KRT17
10,58
0,07
14,43
0,10
15,56
0,01
4,84
1,28E-14
3,16
5,56E-09
1,68
3,66E-04
MMP1
8,32
0,00
8,39
0,05
10,80
0,08
2,41
5,70E-10
0,22
5,65E-01
2,20
1,61E-07
MMP3
8,33
0,01
8,55
0,06
10,59
0,08
2,44
1,16E-09
0,50
1,59E-01
1,84
6,86E-06
MMP9
8,48
0,01
9,29
0,06
10,50
0,09
2,22
1,37E-07
1,05
8,50E-03
1,93
2,02E-06
MMP10
8,31
0,00
8,33
0,02
10,02
0,10
1,93
3,07E-07
0,09
8,41E-01
1,16
4,61E-03
PI3
9,16
0,05
13,60
0,14
15,27
0,04
5,68
1,33E-13
3,96
1,09E-08
1,72
3,44E-03
SERPINB4
8,34
0,02
10,22
0,13
12,04
0,10
3,81
5,15E-09
2,16
3,64E-04
1,65
6,04E-03
TUBB3 8,84 0,01 8,86 0,05 10,45 0,05 1,91 5,45E-11 0,23 3,66E-01 1,67 5,28E-08

a Relative expression normalized to the expression level of four reference genes.

b Bold values represent the comparisons that could be statistically confirmed in the QPCR validation experiment.

c VST transformed RSN normalized data.


[TableWrap ID: T6] Table 6 

QPCR primers


Gene Accession number Forward primer 5 > 3 Reverse primer 5 > 3 Amplicon size (bp)
Genes of interest
CCL27
NM_006664
GACTGTCACCTCCAGGCTTT
TCTCTTGGTGCTCAAACCAC
100
K17
NM_000422
CTGGAGCAGGAGATTGCCAC
GGGTGGTCACCGGTTCTTTC
88
MMP1
NM_002421
AGGTCTCTGAGGGTCAAGCA
CTGGTTGAAAAGCATGAGCA
111
MMP3
NM_002422
TGCTTTGTCCTTTGATGCTG
GGAAGAGATGGCCAAAATGA
135
MMP9
NM_004994
CCTGGAGACCTGAGAACCAA
ATTTCGACTCTCCACGCATC
103
MMP10
NM_002425
GTGGAGTTCCTGACGTTGGT
TCAATGGCAGAATCAACAGC
130
PI3
NM_002638
GACTGCCCAGGAATCAAGAA
CAGCAGGGACTTAGGACCAG
148
SERPINB4
NM_002974
CAAAGGGCAGTGGGAGAATA
CCTCCAGCAAGGCAAAATTA
131
TUBB3
NM_006086
CTCAGGGGCCTTTGGACATC
CCCTCCGTGTAGTGACCCTT
96
Reference genes
ARPC2
NM_005731
TCCGGGACTACCTGCACTAC
GGTTCAGCACCTTGAGGAAG
96
BAT3
NM_004639
AAGAGACGCAAGACGATGCAG
TGTAGCTCTCCTGAACCTCTGG
151
RPS29
NM_001032
TATGTGCCGCCAGTGTTTCC
TGCCCCGGATAATCCTCTGA
92
ZNF410 NM_021188 GCTGTGGTAAGCAGTTTACTACAG CTTGGGCTTCACAAAGGAAAGG 90


Article Categories:
  • Research Article

Keywords: Cutaneous squamous cell carcinoma, Non-melanoma skin cancer, Actinic keratosis, Organ transplant recipient, Gene expression, Genomic profiling.

Previous Document:  EXPLORING THE SELF-ASSEMBLY OF A SHORT AROMATIC A? (16-24) PEPTIDE.
Next Document:  Regulation of proteorhodopsin gene expression by nutrient limitation in the marine bacterium Vibrio ...