Document Detail

MicroRNAs up-regulated by CagA of Helicobacter pylori induce intestinal metaplasia of gastric epithelial cells.
Jump to Full Text
MedLine Citation:
PMID:  22536353     Owner:  NLM     Status:  MEDLINE    
Abstract/OtherAbstract:
CagA of Helicobacter pylori is a bacterium-derived oncogenic protein closely associated with the development of gastric cancers. MicroRNAs (miRNAs) are a class of widespread non-coding RNAs, many of which are involved in cell growth, cell differentiation and tumorigenesis. The relationship between CagA protein and miRNAs is unclear. Using mammalian miRNA profile microarrays, we found that miRNA-584 and miRNA-1290 expression was up-regulated in CagA-transformed cells, miRNA-1290 was up-regulated in an Erk1/2-dependent manner, and miRNA-584 was activated by NF-κB. miRNA-584 sustained Erk1/2 activities through inhibition of PPP2a activities, and miRNA-1290 activated NF-κB by knockdown of NKRF. Foxa1 was revealed to be an important target of miRNA-584 and miRNA-1290. Knockdown of Foxa1 promoted the epithelial-mesenchymal transition significantly. Overexpression of miRNA-584 and miRNA-1290 induced intestinal metaplasia of gastric epithelial cells in knock-in mice. These results indicate that miRNA-584 and miRNA-1290 interfere with cell differentiation and remodel the tissues. Thus, the miRNA pathway is a new pathogenic mechanism of CagA.
Authors:
Yongliang Zhu; Qiaoli Jiang; Xiaojun Lou; Xiaowei Ji; Zhenzhen Wen; Jia Wu; Haiying Tao; Tingting Jiang; Wei He; Caihua Wang; Qin Du; Shu Zheng; Jianshan Mao; Jian Huang
Related Documents :
7537763 - Conversion of amylase-secreting rat pancreatic ar42j cells to neuronlike cells by activ...
3139103 - Intensification of rheological destruction of rat fibrosarcoma kmt 17 cells by eliminat...
7537763 - Conversion of amylase-secreting rat pancreatic ar42j cells to neuronlike cells by activ...
Publication Detail:
Type:  Journal Article; Research Support, Non-U.S. Gov't     Date:  2012-04-20
Journal Detail:
Title:  PloS one     Volume:  7     ISSN:  1932-6203     ISO Abbreviation:  PLoS ONE     Publication Date:  2012  
Date Detail:
Created Date:  2012-04-26     Completed Date:  2012-08-31     Revised Date:  2013-05-20    
Medline Journal Info:
Nlm Unique ID:  101285081     Medline TA:  PLoS One     Country:  United States    
Other Details:
Languages:  eng     Pagination:  e35147     Citation Subset:  IM    
Affiliation:
Department of Gastroenterology, Second Affiliated Hospital of Zhejiang University School of Medicine, Hangzhou, Zhejiang Province, China. zhuyongliangch@yahoo.com.cn
Export Citation:
APA/MLA Format     Download EndNote     Download BibTex
MeSH Terms
Descriptor/Qualifier:
Animals
Antigens, Bacterial / biosynthesis,  physiology*
Bacterial Proteins / biosynthesis,  physiology*
Cell Line
Epithelial Cells / metabolism,  microbiology,  pathology*
Epithelial-Mesenchymal Transition
Gastric Mucosa / metabolism,  microbiology,  pathology*
Gene Knock-In Techniques
Helicobacter pylori / physiology*
Hepatocyte Nuclear Factor 3-alpha / genetics,  metabolism
Host-Pathogen Interactions
Humans
MAP Kinase Signaling System
Metaplasia / metabolism,  microbiology
Mice
Mice, Inbred C57BL
Mice, Transgenic
MicroRNAs / genetics*,  metabolism
Protein Phosphatase 2 / metabolism
RNA Interference
Recombinant Proteins / biosynthesis
Transcriptional Activation
Up-Regulation*
ets-Domain Protein Elk-1 / metabolism
Chemical
Reg. No./Substance:
0/Antigens, Bacterial; 0/Bacterial Proteins; 0/ELK1 protein, human; 0/FOXA1 protein, human; 0/Hepatocyte Nuclear Factor 3-alpha; 0/MIRN1290 microRNA, human; 0/MIRN584 microRNA, human; 0/MicroRNAs; 0/Recombinant Proteins; 0/cagA protein, Helicobacter pylori; 0/ets-Domain Protein Elk-1; EC 3.1.3.16/PPP2CA protein, human; EC 3.1.3.16/Protein Phosphatase 2
Comments/Corrections

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine

Full Text
Journal Information
Journal ID (nlm-ta): PLoS One
Journal ID (iso-abbrev): PLoS ONE
Journal ID (publisher-id): plos
Journal ID (pmc): plosone
ISSN: 1932-6203
Publisher: Public Library of Science, San Francisco, USA
Article Information
Download PDF
Zhu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Received Day: 3 Month: 1 Year: 2012
Accepted Day: 8 Month: 3 Year: 2012
collection publication date: Year: 2012
Electronic publication date: Day: 20 Month: 4 Year: 2012
Volume: 7 Issue: 4
E-location ID: e35147
ID: 3335061
PubMed Id: 22536353
Publisher Id: PONE-D-12-00471
DOI: 10.1371/journal.pone.0035147

MicroRNAs Up-Regulated by CagA of Helicobacter pylori Induce Intestinal Metaplasia of Gastric Epithelial Cells Alternate Title:miRNAs by CagA Induce Intestinal Metaplasia
Yongliang Zhu1*
Qiaoli Jiang1
Xiaojun Lou1
Xiaowei Ji1
Zhenzhen Wen1
Jia Wu1
Haiying Tao1
Tingting Jiang1
Wei He1
Caihua Wang1
Qin Du1
Shu Zheng2
Jianshan Mao1
Jian Huang2
Yoshio Yamaokaedit1 Role: Editor
1Department of Gastroenterology, Second Affiliated Hospital of Zhejiang University School of Medicine, Hangzhou, Zhejiang Province, China
2Cancer Institute and Education Ministry Key Laboratory of Cancer Prevention and Intervention, Zhejiang University School of Medicine, Hangzhou, Zhejiang Province, China
Veterans Affairs Medical Center (111D), United States of America
Correspondence: * E-mail: zhuyongliangch@yahoo.com.cn
Contributed by footnote: Conceived and designed the experiments: YZ SZ. Performed the experiments: XL QJ XJ ZW JW HT TJ WH YZ. Analyzed the data: CW QD. Contributed reagents/materials/analysis tools: JM JH. Wrote the paper: YZ.

Introduction

Helicobacter pylori (H.pylori) infection is one of the main inducers of chronic active gastritis and peptic ulcer; it is also closely associated with the genesis and development of gastric cancer and gastric mucosa–associated lymphoid tissue (MALT) lymphoma. The Union for International Cancer Control has documented H.pylori as a type I carcinogen [1][3]. China has among the highest incidence rates of both H.pylori infection and gastric cancer, and the H.pylori strain positive for the virulence factor cagA (cagA+ H.pylori) is the most common type [4]. CagA plays important roles in the genesis and development of precancerous gastric lesions, gastric cancer, and MALT lymphoma, which indicates that CagA is a bacterium-derived tumor-associated protein [5][7]. CagA can destroy the apical tight junction complex of MDCK cells in a non–phosphorylation-dependent manner to damage cell barriers, leading to “leakage” between gastric mucosal epithelial cells [8]. After injection into host cells by the type IV secretion system, CagA is phosphorylated on tyrosine residues by c-Src and Lyn kinases. Phosphorylated CagA then associates with and activates a bona fide oncoprotein, SHP-2, leading to Erk1/2 pathway activation. F-actin stress fibers become highly polarized, which leads to cytoskeleton reorganization and cell dissociation into a “hummingbird”-like phenotype [9][11]. In previous study, we had found that activation of the Erk1/2 kinases by CagA directly induces immortalized NIE epithelial cell transformation, and the proliferation activity of transformed cells is significantly inhibited after Erk1/2 inhibition [12]. Ohnishi et al showed that cagA-transgenic mice develop gastric cancer and MALT lymphoma at 72 weeks [13]. Saadat et al showed that CagA causes abnormal chromatin segregation during mitosis through SHP-2 activation of microtubule affinity-regulating kinase [14].

MicroRNAs (miRNAs) are a class of widely distributed, non-coding, single- stranded RNAs composed of about 19 to 22 nucleotides. In mammalian cells, miRNAs bind to 3′ untranslated regions (UTR) of mRNAs mainly through incomplete base- pairing to inhibit gene translation at the post-transcriptional level and thereby down-regulate the expression of target genes [15]. miRNAs regulate cell growth, differentiation, stress, and many other biological processes [16][21]. Previous studies have found that some miRNAs could be altered after H.pylori infection [22], [23]. However, whether cagA is involved in cellular regulation of certain miRNAs in the gastric epithelium remains elusive.

Intestinal metaplasia is a precancerous lesion of the stomach in which there is transdifferentiation of the gastric mucosa to an intestinal phenotype. Intestinal metaplasia of the gastric antrum is common in adults with H.pylori–associated chronic gastritis. As we know that intestinal meteplasia is associated with H.pylori infection, eradication of H. pylori infection could significantly attenuate this condition [24]. An intestine-specific transcription factor, CDX2, is involved in the induction of intestinal metaplasia in the stomach [25]. Whether is there is another molecular mechanism to induce intestinal metaplasia besides CDX2 is still unknown. Therefore, we wanted to know whether the tumorigenic CagA protein also affects the expression of miRNAs to induce intestinal metaplasia of gastric mucosa.

Here, we found that both miRNA-584 and miRNA-1290 were up-regulated by CagA. Overexpression of these miRNAs induced intestinal metaplasia in knock-in mice. These results indicate that the miRNA pathway is a new pathogenic mechanism of CagA.


Results
1. Up-regulation of miRNA-584 and miRNA-1290 Expression by CagA Protein

The pathogenesis of CagA was induced by which was injected into epithelial cells by the type IV secretion system of H.pylori. To mimic injected CagA in the host cell, we first used the standard calcium phosphate precipitation method to establish stable CagA-expressing gastric carcinoma AGS cells to explore whether CagA protein affects miRNA expression (Figure 1a and 1b). We then screened for affected miRNAs in CagA-transformed gastric carcinoma AGS cells and control empty vector–expressing cells using mammalian miRNA expression profile microarrays. After scanning 1024 miRNAs, we found that the expression of miRNA-584 and miRNA-1290 was up-regulated in CagA-transformed cells, but no down-regulated miRNA was found. These results were further verified by TaqMan real-time PCR (Figure 1c). Moreover, both transient transfection of cagA into gastric carcinoma SGC7901 cells and NCTC11637 H.pylori–infected AGS cells for 7 h yielded similar results (Figure 1d and 1e). The above results indicate that CagA protein up-regulates miRNA-584 and miRNA-1290 expression and suggests that CagA may affect cellular functions by altering miRNA expression.

2. miRNA-1290 was Up-regulated in an Erk1/2-dependent Manner and miRNA-584 was Activated by NF-κB

To explore the mechanism of miRNA-584 and miRNA-1290 activation, we examined the transcript factor binding sites in the promoter regions of miRNA-584 and miRNA-1290, and found that there were Elk-1 binding sites in both promoter regions (Figure S1). Elk-1 is one of the important substrates of Erk1/2 kinases. Phosphorylated Elk-1 activated by Erk1/2 kinases potentiates ternary complex formation with serum response element (SRE), serum response factor (SRF), and c-fos to enhance targets’ transcription. It was confirmed that CagA could activate Erk1/2 kinases by directly binding SHP-2 and phosphorylated Elk-1 [26]. We also observed that transactivities of Elk-1 were up-regulated after infection of cagA+ H.pylori (Figure 2a). To find out whether CagA up-regulated miRNA-584 and miRNA-1290 in an Erk1/2-dependent manner, we constructed luciferase reporters containing the promoter regions of miRNA-584 and miRNA-1290 respectively. We found that miRNA-1290 was significantly up-regulated by both Elk-1 and CagA in 293T cells co-transfected with recombinant luciferase reporters and Elk-1 or cagA, whereas miRNA-584 was not affected (Figure 2b), which implied that there were different mechanisms for miRNA-584 and miRNA-1290 activation. On the other hand, we examined the relationship between miRNA-584 and miRNA-1290 in clinic tumor tissue samples and stable miRNA-1290 –expressing cells. Interestingly, a strong relationship was found between miRNA-584 and miRNA-1290 in clinic tumor tissue samples (Figure S2), in accordance with miRNA-584 being up-regulated in stable miRNA-1290 –expressing cells (Figure 2c). This suggests that miRNA-584 may be regulated by miRNA-1290. To analyze the mechanism of miRNA-584 activation, we further checked the transcript factor binding sites in the promoter regions of miRNA-584 again besides Elk-1, and found that there were c-Rel binding sites in the promoter regions of miRNA-584 (Figure S3). Whether does miRNA-1290 activate the NF-κB pathway due to the weak activation of NF-κB by CagA? To this end, we checked the NF-κB activities by co-transfecting NF-κB reporters with miRNA-1290 plasmids into gastric carcinoma SGC7901 cells. We found that NF-κB activities were enhanced at 24 h after transfection of miRNA-1290 (Figure 2d). Western blot showed that NF-κB repressing factor (NKRF) was knockdown after overexpression of miRNA-1290 (Figure 2e). NF-κB activities increased after knockdown of NKRF by shRNA (Figure 2f). These results implied that miRNA-1290 activated NF-κB by knockdown of NKRF. Finally, we examined whether miRNA-584 was activated by NF-κB. We found that miRNA-584 was significantly up-regulated in SGC7901 cells co-transfected with recombinant luciferase reporters and NKRF shRNA or c-Rel plasmids (Figure 2g and 2h). Together, miRNA-1290 was up-regulated in an Erk1/2-dependent manner and miRNA-584 was activated indirectly by miRNA-1290.

3. cagA+ H.pylori Activated Erk1/2 Kinases and miRNA-584 Sustained Erk1/2 Activities through Inhibition of Protein Phosphatase 2a (PPP2a)

We found that Erk1/2 kinases could be activated after infection of cagA+ H.pylori (Figure 3a). To clarify the effects of miRNA-584 and miRNA-1290 on Erk1/2 pathways, we evaluated the effects of miRNA-584 and miRNA-1290 on Erk1/2 signaling. Recombinant plasmids expressing mature miRNA-584 and miRNA-1290 were first constructed and transiently transfected into gastric carcinoma AGS cells (Figure 3b). Kinase assays and western blot analysis were used to detect Erk1/2 activities in transfected cells. Expressing miRNA-584 led to higher activation of Erk1/2, but miRNA-1290 had no significantly effect on Erk1/2 activation (Figure 3c). A TargetScan search found two potential binding sites for miRNA-584 in the 3′-untranslational region (UTR) of PPP2ca, one of the important phosphatases of phosphorylated Erk1/2 (Figure S4), Further, we found that PPP2a expression were inhibited in cells transfected with miRNA-584 (Figure 3d). These results suggest that miRNA-584 sustained Erk1/2 activities through inhibition of PPP2a activities.

4. Foxa1 is a Target of miRNA-584 and miRNA-1290 and Knockdown of Foxa1 Promotes Epithelial-mesenchymal Transition (EMT)

Besides sustaining Erk1/2 and activating NF-κB pathways, miRNAs have hundreds of possible target genes. To identify the key target molecules of miRNA-584 and miRNA-1290, we looked for transcription factor targets common to both miRNA-584 and miRNA-1290. We first used cDNA expression profile microarrays to analyze the transcription factor profile of gastric carcinoma AGS cells. Second, we used TargetScan to screen candidate target transcription factors of miRNA-584 and miRNA-1290. Finally, the target molecules of miRNA-584 and miRNA-1290 were compared and identified (Figure 4a). Out of more than 1000 transcription factors, we obtained 15 possible miRNA-584 and 28 possible miRNA-1290 target transcription factors, of which Foxa1, Smad2, Bach1, MITF, and HoxC13 were possibly shared in common (Figure 4b). Among these five possible common target transcription factors, the pioneer transcription factor Foxa1 had higher prediction probabilities; it was also significantly down-regulated in cDNA expression profile microarrays of transiently transfected miRNA-584 into AGS cells (Figure S5). These results indicated Foxa1 as a strong candidate target molecule of both miRNA-584 and miRNA-1290.

To determine whether Foxa1 is a target molecule of miRNA-584 and miRNA-1290, we cloned a DNA fragment from the Foxa1 3′UTR into the pMIR reporter vector and then co-transfected this plasmid with miRNA-584 or miRNA-1290 into AGS cells. A luciferase activity assay showed that co-transfection of miRNA-584 or miRNA-1290 with pMIR-Foxa1 inhibited firefly luciferase activity by more than 90% compared with pMIR-Foxa1 alone (Figure 4c), indicating that miRNA-584 and miRNA-1290 act on Foxa1 mRNA. Western blot analysis showed that after transfection with either miRNA-584 or miRNA-1290, the expression of Foxa1 protein was down-regulated approximately 50% (Figure 4d and Figure S6). These results further indicate that Foxa1 is a target of miRNA-584 and miRNA-1290.

Silencing Foxa1 may interfere with the normal differentiation of gastric epithelial stem cells [27][31]. To determine the effects of down-regulating Foxa1 on cellular function, we monitored the stem cell ratio and EMT in cells undergoing Foxa1 silencing. Because currently available gastric cancer cell lines mostly have low levels of Foxa1 and E-cadherin or even do not express them, and because H.pylori is associated with the genesis of colon cancer [32], we selected SW620 colon cancer cells with high levels of Foxa1 and E-cadherin expression for this study. We infected common SW620 cells with Foxa1 shRNA recombinant lentiviruses, and flow cytometry revealed that the percentage of CD44+CD133+ cells significantly decreased in Foxa1-silenced SW620 cells, P<0.05 (ANOVA). Further studies on an important stem cell–associated molecule using western blot analysis showed that Bmi1 expression significantly decreased during Foxa1 silencing (Figure 4e), suggesting that silencing of Foxa1 promoted the transformation of stem cells into progenitor cells through down-regulation of the Bmi1 pathway. Moreover, western blot analysis showed that E-cadherin expression decreased and vimentin expression increased in these cells (Figure 4f). Overexpression of miRNA-584 or/and miRNA-1290 also decreased E-cadherin level (Figure 4g). These results suggest that Foxa1 is a key transcription factor and that down-regulating Foxa1 expression promotes EMT and interferes with the differentiation of stem cells.

5. Overexpression of miRNA-584 and miRNA-1290 Induced Intestinal Metaplasia in Knock-in Mice

To explore the developmental affections of gastric epithelial stem cell with abnormal EMT and differentiation induced by miRNA-584 and miRNA-1290, we produced knock-in mice with overexpression of mature miRNA-584 and miRNA-1290. The results showed that the levels of miRNA-584 and miRNA-1290 were up-regulated about 4.32- and 2.85-fold, respectively, in knock-in mouse, as validated by Taqman miRNA assays (Figure 5a). Obvious morphological alterations were not observed at the 12th week in knock-in mice. However, gastric mucosa layers were significantly thinned and flattened, and rugal folds had disappeared at the 72nd week (Figure 5b). Gastric mucosa was completely replaced by large intestinal epithelium under microscopy (Figure 5c). Muc2, an important marker of intestinal epithelials, was significantly increased while Muc6, an important marker of gastric epithelials, was significantly decreased in transgenic mice (Figure 5d). Periodic Acid-Schiff (PAS) staining showed that PAS-positive cells were also increased in in transgenic mice (Figure 5e). These results demonstrated that overexpression of miRNA-584 and miRNA-1290 induced transdifferentiation of gastric epithelial cells in knock-in mice.


Discussion

Our results show that H.pylori CagA protein can up-regulate the expression of both miRNA-584 in an NF-κB–dependent manner and miRNA-1290 in an Erk1/2-dependent manner. miRNA-584 sustained Erk1/2 activities through inhibition of PPP2a activities, and miRNA-1290 activated NF-κB through knockdown of NKRF. Further luciferase reporter assays and western blot revealed Foxa1 to be an important target of miRNA-584 and miRNA-1290. Knockdown of Foxa1 promoted the EMT significantly. Overexpression of miRNA-584 and miRNA-1290 induced intestinal metaplasia of gastric epithelial cells in knock-in mice. Thus, Erk1/2 activitied by CagA drived miRNA-1290 expression and subsequently miRNA-584 acivation. We speculated that different H.pylori strains owned different ability to up-regulate miRNA-1290, due to cagA diversity at C-terminus, in particular which from Western strains with variable number of EPIYA repeat.

The biological functions of miRNA-584 and miRNA-1290 are not clear. miRNA-584 is down-regulated in human renal clear cell carcinoma and was proposed to have tumor suppressor properties [33]. In this study, we found that miRNA-584 could inhibit Smad2 expression as shown by western blot analysis (Figure S7). Moreover, it could inhibit PPP2a activities, which play an important role in attenuation of the Erk1/2 pathway by direct de-phosphorylation of Erk1/2 kinase. The inhibition of Y-Box protein 1 in drug-sensitive gastric cancer cells can lead to increased miRNA-1290 expression [34], whereas no other important targets were identified. We found a strong relationship between miRNA-1290 and miRNA-584 in clinic colon cancer tissue. miRNA-1290 could repress NKRF to enhance NF-κB activities, which may be involved in the development and progression of cancer. Therefore, both miRNAs were also proposed to have oncogenic properties.

One miRNA usually has hundreds of possible target genes, making it difficult to identify the key target molecules of any miRNA. One important intersection between miRNA interference and signaling pathways is altered transcription factor levels; therefore, we looked for transcription factors targeted by both miRNA-584 and miRNA-1290. Candidate target transcription factors were identified by using TargetScan to find transcription factors targeted by both of these miRNAs in gastric carcinoma AGS cells. Out of more than 1,000 transcription factors we found 15 possibly targeted by miRNA-584 and 28 possibly targeted by miRNA-1290, with Foxa1, Smad2, Bach1, MITF, and HoxC13 being common to both miRNAs. Among these five possible target transcription factors, Foxa1 had higher context scores in both the miRNA-584 and miRNA-1290 predictions. Subsequent firefly luciferase reporter assays and western blot analysis confirmed that Foxa1 was knocked down by miRNA-584 and miRNA-1290. FoxA family members include Foxa1, Foxa2, and Foxa3. Foxa1 is expressed in the middle and late embryonic stages; Foxa1 expression significantly increases in embryonic cells after retinoic acid induction [35]. Foxa1 and Smad2 form a complex on the α-fetoprotein (AFP) promoter to promote AFP transcription [36]. Foxa1 is a pioneer transcription factor that can promote tissue-specific transcription and is closely linked with epigenetic signatures of tissues and cells [37]. Foxa1 is involved in the tissue development of the liver, gall bladder, lung, pancreas, intestine, and prostate. Silencing of Foxa1 and/or Foxa2 may result in abnormal development and differentiation of those tissues and cells. Silencing of Foxa1 increases the expression of sonic hedgehog, Foxa2, and Notch, terminates the differentiation of prostate epithelial cells, and causes abnormal phenotypes in glands; silencing of Foxa1 and/or Foxa2 causes lung epithelial dysplasia and epithelial hyperplasia. In the intestine, Foxa1 and Foxa2 are only expressed in epithelial stem cells; silencing of Foxa1 and/or Foxa2 causes goblet cell hyperplasia, alters the properties of the secretory mucins, and causes abnormal differentiation of enteroendocrine cells [27][31]. The functions of Foxa1 and Foxa2 are complementary; however, we found that Foxa1-positive cells were not perfectly coincident with Foxa2-positive cells in gastric mucosa by immunohistochemical staining. Foxa1-positive cells could be found in superfacial mucosa (Figure S8), whereas Foxa2-positive cells only appeared in the bottom of the gland.

EMT is the process of transformation from an epithelial cell phenotype to a mesenchymal phenotype [38][40]. EMT is an important component of the processes of cell differentiation. During the process of cell differentiation, EMT is precisely regulated in space and time. Our results indicate that although miRNA-584 up-regulates Erk1/2 activity, it can induce EMT through the inhibition of Foxa1, suggesting that the infiltrating phenotype associated with CagA may be associated with up-regulation of miRNA-584 and miRNA-1290. In addition, the percentage of stem cells in Foxa1-silenced SW620 cells is significantly lower and Bmi1 is also down-regulated. These findings suggest that silencing of Foxa1 may promote the transformation of stem cells into progenitor cells. Unlike RNA interference, which has only one target, miRNA-584 and miRNA-1290 have hundreds of possible target genes besides the mentioned targets above. To explore the pathogenic phenotype of gastric epithelial cells with overexpression of miRNA-584 and miRNA-1290, we observed the transition of gastric epithelial to large intestinal epithelial by producing knock-in mice, although miRNA-584 was not a conserved miRNA in mice.

Our study indicates that H.pylori CagA protein promotes EMT and interferes with cell differentiation by up-regulating miRNA-584 and miRNA-1290. Thus, the miRNA pathway is a new pathogenic mechanism of CagA. This study provides evidence that interference with miRNA pathways is one of the pathogenic mechanisms of microorganisms.


Materials and Methods
Ethics Statement

This research was approved by the Institutional Review Boards of Second Affiliated Hospital of Zhejiang University School of Medicine. All Animal works had been conducted according to relevant national and international guidelines.

H.pylori and cagA/pEGFP-c1 Plasmid

cagA+ H.pylori and cagA-H.pylori strains were isolated from clinic gastric mucosa and the status of cag pathogenicity island was identified by PCR respectively. The cagA/pEGFP-c1 plasmid was constructed as follows: full-length cagA DNA was amplified by PCRs from the NCTC 11637 H.pylori strain (ATCC) and subsequently cloned into the pEGFP-c1 vector (BD Biosciences), and the sequence of amino acid was identical to that of the NCTC 11637 strain by DNA sequencing (protein accession number: C6K4R4).

DNA Sequences

All DNA sequences used in this study were deposited in GenBank. FoxA1 accession number: U39840; PPP2ca accession number: X12646; NKRF accession number: AJ011812, Smad2 accession number: U59911; cagA accession number: ACS34714.1.

Methods
1. Cell culture

Gastric carcinoma AGS, SGC7901 and 293T cells were from the Cell Bank of Chinese Academy of Sciences (Shanghai, China). Cells were grown in RPMI 1640 culture medium (Gibco) supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin, and 15% fetal bovine serum (FBS) (Sijiqing Biotech, China); cells were passaged every 2 to 3 days. SW620 colon cancer cells were cultured in Leibovitz’s 15 (L-15) culture medium (Gibco) supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin, and 15% FBS; 293T cells were cultured in DMEM culture medium (Gibco) supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin, and 15% FBS;cells were passaged every 3 to 4 days.

2. Cell transfection

The standard calcium phosphate precipitation method (Clontech) was used to establish the stable CagA-expressing AGS cell line. Briefly, the culture medium of AGS cells cultured in a 35-mm culture dish was replaced with fresh culture medium 3 h before transfection. Three micrograms of cagA/pEGFP-c1 plasmid and 12.4 µL of 2 M CaCl2 were added to H2O to make a 100-µL solution, which was mixed thoroughly. The mixture was then added slowly into 100 µL of 2×HBS solution and placed at room temperature for 20 min. After thorough mixing, the mixture was added onto the surface of the cells. After culturing at 37°C for 12 h in a 5% CO2 incubator, the medium was refreshed with new culture medium. Cells were passaged 48 h after transfection at a 1∶8 ratio; 500 µg/mL G418 (Clontech) was added the next day to select transfected cells for 7 to 10 days. Transfection was validated using PCR and DNA sequencing after cell clones had grown. A control AGS cell line stably expressing the empty pEGFP-c1 vector was also established.

Transient transfection of cells was performed using Lipofectamine 2000 liposomes (Invitrogen) or Fugene HD (Roche) strictly according to the manufacturer’s instructions. Eight microliters of Lipofectamine 2000 liposomes or Fugene HD were added into 100 µL OPTI-MEM culture medium (Gibco) containing 2 µg plasmids. This was mixed thoroughly and placed at room temperature for 15 min. The solution was then added onto cells cultured in 35-mm culture plates and mixed thoroughly. After culturing at 37°C for 48 h in a 5% CO2 incubator, cells were harvested.

3. MicroRNA screening

RNA was extracted from AGS cells stably expressing CagA or the empty vector using Trizol reagent (Invitrogen) and was sent to CapitalBio, Beijing, for mammalian miRNA expression profile microarray detection, which included 1024 miRNAs from mouse, rat, and human. The results were compared with those from the control group; changes that were >2-fold or <2-fold were considered significant.

4. Real-time PCR

Detection of mature miRNAs was performed using the TaqMan real-time PCR method (Applied Biosystems) according to the manufacturer’s instructions. RNA was isolated from AGS cells using Trizol; after quantitation, reverse transcription was performed using 10 ng RNA and primers specific for mature miR-584 or miR-1290. The reverse transcription was run at 16°C for 30 min followed by 42°C for 30 min; the reaction was inactivated at 85°C for 5 min. The reverse transcription products were mixed with TaqMan universal PCR master mix II, and real-time PCR was performed. The PCR program was 95°C for 10 min, followed by 40 cycles of 15 s at 95°C and 60 s at 60°C.

For detection of Muc2 and Muc6, RNA was isolated from gastric tissue of transgenic mice using Trizol; after quantitation, reverse transcription was performed using 10 ng RNA and 50 µM oligodT15 primers. The reverse transcription was run at 37°C for 15 min followed by 85°C for 5 s; the reaction was inactivated at 85°C for 5 min. The reverse transcription products were mixed with specific primers and probes for Muc2 and Muc6, and real-time PCR (Takara) was performed. Muc2 top: 5′-aatggcatgc agaccaatta-3′. bottom: 5′-tcttctgcatgttcccaaac-3′. Probe: 5'Fam-caatggcactgaactgtatgccttcc -3'Tamra. Muc6: top: 5′-tctccactgttgctgtctcc-3′. bottom: 5′-acgaggtctga ggagctgat-3′. Probe: 5'Fam-tgca gaccacc attgcctccc-3′Tamra. The PCR program was 95°C for 30s min, followed by 40 cycles of 5 s at 95°C and 34s at 60°C.

5. Construction of miR-584 and miR-1290 expression plasmids

The sequences of mature miR-584 and miR-1290 were chemically synthesized as follows. miRNA -584 top: 5′-ctagtagtttacaggtctgtggcaatactcttaaccataag aattgaaatggta-3′; bottom: 5′-agcttaccatttcaattcttatggttaagagtattgcc acagacctgtaaacta-3′. miRNA-1290 top: 5′-ctagtaacgtggtccaagattcaaaaa tcctattgatagtggccattta-3′; bottom: 5′-agcttaaatggccactatcaataggattt ttgaatcttggaccacgtta-3′. After denaturation at 95°C for 4 min, 4 µL of 10 nM oligos were ligated with 2 µL of 5 ng/µL linearized pcDNA6.2-GW/EmGFP-miR plasmid (Invitrogen) using T4 DNA ligase at room temperature for 1 h. The ligation mixture was transformed into TOP10 cells (Invitrogen), and colonies were selected by 50 µg/mL spectinomycin. Colonies were amplified to extract plasmids for DNA sequence identification.

6. Detection of pMIR-Foxa1 report luciferase activity

DNA fragments from the Foxa1 3′UTR that might interact with miR-584 and miRNA-1290 were chemically synthesized. miRNA-584 top: 5′-ctagtatagcaat attcttggagattgataaccatagcattaatacgcccatta-3′; bottom: 5′-agcttaatg ggcgtattaatgctatggttatcaatctccaagaatattgctata-3′. miRNA-1290 top: 5′-ctagtcaaaccgtcaacagcataataaaatcccaacaactatttttatttcattttt ca-3′; bottom: 5′-agcttgaaaaatgaaataaaaatagttgttgggattttattatgctgtt gacggtttga-3′. DNA fragments were re-natured at 90°C for 3 min followed by 37°C for 60 min. The dsOligos were then ligated into the SpeI/HindIII sites in the MCS of linearized pMIR-report luciferase plasmid (3∶1) (Ambion) using T4 ligase at room temperature for 1 h. The ligation mixture was then transformed into E. coli DH5α. Colonies were selected by 100 µg/mL ampicillin. Colonies were then amplified to extract plasmid for DNA sequence identification. To assess pMIR luciferase activity, recombinant pMIR-Foxa1 plasmids were co-transfected with pcDNA6.2-GW/EmGFP-miR plasmids containing miRNA-584 or miRNA-1290 into gastric carcinoma AGS cells for 48 h. Cells were harvested, and luciferase activity was determined by dual-luminescence reporter assay (Promega).

7. Construction of promoter of miR-584 and miR-1290 luciferase reporter plasmids

The promoter sequences of miR-584 and miR-1290 were amplified by the following primers: miRNA-584 top: 5′-agtctgtggtaccggtggggaagtc agagatga-3′; bottom: 5′-agtctgtaagctttccctgaagcaaccttcttg-3′. miRNA-1290 top: 5′-agtctgtg gtacccccaacctttctcagagcag-3′; bottom: 5′-agtctgtaagctttggcattgggt ctttctttc-3′. After PCR, the products were digested by Kpn I and Hind III and ligated with linearized pGL3 plasmid (Promega) using T4 DNA ligase at 22°C overnight. The ligation mixture was transformed into E. coli DH5α cells, and colonies were selected by 100 µg/mL ampicillin. Colonies were amplified to extract plasmids for DNA sequence identification.

8. Western blotting

Cells (1×106) were harvested and washed with phosphate-buffered saline (PBS) twice. They were then lysed with 350 µL radio-immunoprecipitation assay (RIPA) buffer containing 1% NP-40, 0.25% sodium deoxycholate, 5 mM DL-Dithiothreitol (DTT), and 1× protease inhibitor cocktail on ice for 5 min. The cell lysate was centrifuged at 13,000 g for 10 min, and the supernatant was mixed with an equal volume of sample buffer. After 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE), proteins were transferred onto a nitrocellulose membrane. After blocking with 5% non-fat milk at room temperature for 30 min, the membrane was washed three times and then incubated with diluted primary antibodies: Foxa1 antibody (Abcam) and antibodies to Bmi1, E-cadherin, vimentin, PPP2ca and NKRF (Epitopmics) at room temperature for 2 h or 4°C overnight. After five washes, the membrane was incubated with a 1∶2,000 dilution of horseradish peroxidase (HRP)-labeled goat anti-rabbit antibody at room temperature for 1 h. The membrane was developed using enhanced chemiluminescence (ECL) (Cellsignal Biotech) after five washes.

9. Recombinant lentivirus infection

Five thousand SW620 colon cancer cells were cultured in a 12-well plate at 37°C overnight in a 5% CO2 incubator. The culture medium was changed to fresh medium containing 8 µg/mL polybrene (Sigma) the next day, and 25 µL of recombinant lentivirus solution (Santa Crutz) were added for 24 h at 37°C in a 5% CO2 incubator. The culture medium was then changed, and the cells were digested and passaged at a 1∶8 ratio when the cells were 2/3 confluent. Puromycin (5 µg/mL) (Clontech) was added the next day to select for lentivirus-infected cells for 7 to 10 days. After colonies had grown, western blot analysis was performed for identification. An empty vector was transfected as a control.

10. Flow cytometry

SW620 colon cancer cells infected with recombinant lentivirus were digested with 0.25% trypsin, and cells were then collected by centrifugation at 1,500 g for 5 min. The cells were washed twice with PBS containing 2% FBS and blocked in buffer on ice for 10 min. After centrifugation at 2,000 g for 3 min, the cells were resuspended at 1×106 per 100 µL of buffer. Labeling antibodies (15 µL APC-CD44 and 15 µL PE-CD133) (Miltenyi) were added at 4°C for 30 min in the dark. After centrifugation, the cells were washed with buffer twice and resuspended in 500 µL buffer. They were then analyzed using a FACSAria cell sorter (BD Biosciences). A blank control and an isotype control were included.

11. Production of miRNA-584 and miRNA-1290 knock-in mice

The production of mice with overexpression of mature miRNA-584 and miRNA-1290 was performed by Shanghai Innovation Biotechnology Co. Ltd. Briefly, mature sequences of miRNA-584 and miRNA-1290 from pcDNA6.2-GW/EmGFP-miR plasmids were cloned into BLOCK-iT™ Lentiviral Pol II miR RNAi expression vectors (Invitrogen) and transfected into FT293 cells (Invitrogen) to produce recombinant lentivirus. Subsequently densed lentivirus particles were injected into oosphere cells of C57BL6 mice for the production of mice with overexpression of mature miRNA-584 and miRNA-1290. Finally, the levels of miRNA-584 and miRNA-1290 were validated by Taqman miRNA assays.

12. Infection model

1×105/well AGS cells were seeded into a 12-well plate at 37°C overnight in a 5% CO2 incubator for 24 h. Subsequently cells were infected with H.pylori including NCTC11637 and 9 cagA– isolates for additional 7 h (MOI≈50) respectively, and TaqMan real-time PCR was performed.


Supporting Information Figure S1

Putative Elk-1binding sites in the promoter regions of miRNA-584 and miRNA-1290.

(DOC)


Click here for additional data file (pone.0035147.s001.doc)

Figure S2

Relationship between miRNA-584 and miRNA-1290 in clinic tumor. tissues. Total RNA from 9 pairs of human primary colon cancer tissues were isolated and real-time PCR was performed for miRNA-84 and miRNA-290. The results showed a strong relationship between miRNA-584 and miRNA-1290 in clinic tumor tissue samples.

(DOC)


Click here for additional data file (pone.0035147.s002.doc)

Figure S3

Putative c-Relbinding sites in the promoter regions of miRNA-584.

(DOC)


Click here for additional data file (pone.0035147.s003.doc)

Figure S4

Putative binding sites of miRNA-584 in 3′-UTR of PPP2a.

(DOC)


Click here for additional data file (pone.0035147.s004.doc)

Figure S5

Foxa1 expression is lower in AGS cells transiently expressing miRNA-584. The plasmid pcDNA6.2-GW/EmGFP-miR containing mature miRNA-584 was transiently transfected into AGS cells with Lipofectamine 2000. Total RNA was extracted, and human cDNA genechip scanning was performed. Differential genes were identified by real-time PCR. The results show that Foxa1 expression is lower in AGS cells transiently expressing miRNA-584.

(DOC)


Click here for additional data file (pone.0035147.s005.doc)

Figure S6

Normalized protein expression ofFoxa1. Densitometric analysis of bands corresponding to Foxa1 and GAPDH was performed using Quantity-One software (Bio-Rad). The expression of Foxa1 protein was down-regulated about 50% after transfection of miRNA-584 or miRNA-1290 (P <0.01 and P <0.05, ANOVA. Data are represented as mean +/– s.e.m.). Protein expression was normalized to GAPDH.

(DOC)


Click here for additional data file (pone.0035147.s006.doc)

Figure S7

miRNA-584 decreases the expression of Smad2. pcDNA6.2-GW/EmGFP -miR containing the mature miRNA-584 DNA sequence was transiently transfected into AGS cells with Lipofectamine 2000 for 48 h. Cells were harvested and lysed. The supernatant of the lysate was subject to SDS-PAGE, and proteins were transferred onto a nitrocellulose membrane. After blocking with non-fat milk, the membrane was incubated with anti-Smad2 antibody and diluted HRP-labeled goat anti-rabbit antibody. Finally. the membrane was developed using ECL substrate.

(DOC)


Click here for additional data file (pone.0035147.s007.doc)

Figure S8

Expression of FoxA1 in gastric epithelial cells. Gastric mucosa from a patient with H.pylori infection was sliced after fixation with formalin. The slices were analyzed by immunohistochemical staining after antigen retrieval.

(DOC)


Click here for additional data file (pone.0035147.s008.doc)


Notes

Competing Interests: The authors have declared that no competing interests exist.

Funding: This work was supported by grants from National Science Foundation Committee of China (30670113, 81071768, 31090361) (http://isisn.nsfc.gov.cn/egrantweb/), Natural Science Foundation of Zhejiang province (R2090074, Y2090322) (http://www.zjnsf.gov.cn/), and Foundation of Scientific technology bureau of Zhejiang province (2009C33081, 2011C23091) (http://www.zjkjt.gov.cn/html/node02/zxsb.jsp). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

We thank Ms. Xiaolei Wang and Dr. Weiting Ge for FCM analysis.


References
1. Wong BC,Lam SK,Wong WM,Chen JS,Zheng TT,et al. Year: 2004Helicobacter pylori eradication to prevent gastric cancer in a high-risk region of China: a randomized controlled trial.JAMA29118719414722144
2. Yeh JM,Kuntz KM,Ezzati M,Goldie SJ. Year: 2009Exploring the cost-effectiveness of Helicobacter pylori screening to prevent gastric cancer in China in anticipation of clinical trial results.Int J Cancer12415716618823009
3. Hatakeyama M,Higashi H. Year: 2005Helicobacter pylori CagA: a new paradigm for bacterial carcinogenesis.Cancer Sci9683584316367902
4. Zhu YL,Zheng S,Du Q,Qian KD,Fang PC. Year: 2005Characterization of CagA variable region of Helicobacter pylori isolates from Chinese patients.World J Gastroenterol1188088415682486
5. Hatakeyama M. Year: 2008Linking epithelial polarity and carcinogenesis by multitasking Helicobacter pylori virulence factor CagA.Oncogene277047705419029944
6. Murata-Kamiya N,Kikuchi K,Hayashi T,Higashi H,Hatakeyama M. Year: 2010Helicobacter pylori exploits host membrane phosphatidylserine for delivery, localization, and pathophysiological action of the CagA oncoprotein.Cell Host Microbe739941120478541
7. Tsang YH,Lamb A,Romero-Gallo J,Huang B,Ito K,et al. Year: 2010Helicobacter pylori CagA targets gastric tumor suppressor RUNX3 for proteasome-mediated degradation.Oncogene295643565020676134
8. Amieva MR,Vogelmann R,Covacci A,Tompkins LS,Nelson WJ,et al. Year: 2003Disruption of the epithelial apical-junctional complex by Helicobacter pylori CagA.Science3001430143412775840
9. Higashi H,Tsutsumi R,Muto S,Sugiyama T,Azuma T,et al. Year: 2002SHP-2 tyrosine phosphatase as an intracellular target of Helicobacter pylori CagA Protein.Science29568368611743164
10. Lee IO,Kim JH,Choi YJ,Pillinger MH,Kim SY,et al. Year: 2010Helicobacter pylori CagA phosphorylation status determines the gp130- activated SHP2/ERK and JAK/STAT signal transduction pathways in gastric epithelial cells.J Biol Chem285160421605020348091
11. Hatakeyama M. Year: 2004Oncogenic mechanisms of the Helicobacter pylori CagA protein.Nat Rev Cancer468869415343275
12. Zhu Y,Zhong X,Zheng S,Du Q,Xu W. Year: 2005Transformed immortalized gastric epithelial cells by virulence factor CagA of Helicobacter pylori through Erk mitogen- activated protein kinase pathway.Oncogene243886389515856031
13. Ohnishi N,Yuasa H,Tanaka S,Sawa H,Miura M,et al. Year: 2008Transgenic expression of Helicobacter pylori CagA induces gastrointestinal and hematopoietic neoplasms in mouse.Proc Natl Acad Sci U S A1051003100818192401
14. Saadat I,Higashi H,Obuse C,Umeda M,Murata-Kamiya N,et al. Year: 2007Helicobacter pylori CagA targets PAR1/MARK kinase to disrupt epithelial cell polarity.Nature44733033317507984
15. Inui M,Martello G,Piccolo S. Year: 2010MicroRNA control of signal transduction.Nat Rev Mol Cell Biol1125226320216554
16. Chen CZ,Li L,Lodish HF,Bartel DP. Year: 2004MicroRNAs modulate hematopoietic lineage differentiation.Science303838614657504
17. Poy MN,Hausser J,Trajkovski M,Braun M,Collins S,et al. Year: 2009miR-375 maintains normal pancreatic alpha- and beta-cell mass.Proc Natl Acad Sci U S A1065813581819289822
18. Hornstein E,Mansfield JH,Yekta S,Hu JK,Harfe BD,et al. Year: 2005The microRNA miR-196 acts upstream of Hoxb8 and Shh in limb development.Nature43867167416319892
19. Shimono Y,Zabala M,Cho RW,Lobo N,Dalerba P,et al. Year: 2009Downregulation of miRNA-200c links breast cancer stem cells with normal stem cells.Cell13859260319665978
20. Iliopoulos D,Jaeger SA,Hirsch HA,Bulyk ML,Struhl K. Year: 2010STAT3 activation of miR-21 and miR-181b-1 via PTEN and CYLD are part of the epigenetic switch linking inflammation to cancer.Mol Cell3949350620797623
21. Calin GA,Cimmino A,Fabbri M,Ferracin M,Wojcik SE,et al. Year: 2008MiR-15a and miR-16-1 cluster functions in human leukemia.Proc Natl Acad Sci U S A1055166517118362358
22. Liu Z,Xiao B,Tang B,Li B,Li N,et al. Year: 2010Up-regulated microRNA-146a negatively modulate Helicobacter pylori- induced inflammatory response in human gastric epithelial cells.Microbes Infect1285486320542134
23. Matsushima K,Isomoto H,Inoue N,Nakayama T,Hayashi T,et al. Year: 2011MicroRNA signatures in Helicobacter pylori-infected gastric mucosa.Intern J Cancer128361370
24. Yang HB,Sheu BS,Wang ST,Cheng HC,Chang WL,et al. Year: 2009H.pylori eradication prevents the progression of gastric intestinal metaplasia in reflux esophagitis patients using long-term esomeprazole.Am J Gastroenterol1041642164919436275
25. Almeida R,Almeida J,Shoshkes M,Mendes N,Mesquita P,et al. Year: 2005OCT-1 is over-expressed in intestinal metaplasia and intestinal gastric carcinomas and binds to, but does not transactivate, CDX2 in gastric cells.J Pathol20739640116278805
26. Hirata Y,Maeda S,Mitsuno Y,Tateishi K,Yanai A,et al. Year: 2002Helicobacter pylori CagA protein activates serum response element-driven transcription independently of tyrosine phosphorylation.Gastroenterology1231962197112454853
27. Li Z,White P,Tuteja G,Rubins N,Sackett S,et al. Year: 2009Foxa1 and Foxa2 regulate bile duct development in mice.J Clin Invest1191537154519436110
28. Wan H,Dingle S,Xu Y,Besnard V,Kaestner KH,et al. Year: 2005Compensatory roles of Foxa1 and Foxa2 during lung morphogenesis.J Biol Chem280138091381615668254
29. Vatamaniuk MZ,Gupta RK,Lantz KA,Doliba NM,Matschinsky FM,et al. Year: 2006Foxa1-deficient mice exhibit impaired insulin secretion due to uncoupled oxidative phosphorylation.Diabetes552730273617003337
30. Gao N,Ishii K,Mirosevich J,Kuwajima S,Oppenheimer SR,et al. Year: 2005Forkhead box A1 regulates prostate ductal morphogenesis and promotes epithelial cell maturation.Development1323431344315987773
31. Ye DZ,Kaestner KH. Year: 2009Foxa1 and Foxa2 control the differentiation of goblet and enteroendocrine L- and D-cells in mice.Gastroenterology1372052206219737569
32. Shmuely H,Passaro D,Figer A,Niv Y,Pitlik S,et al. Year: 2001Relationship between Helicobacter pylori CagA status and colorectal cancer.Am J Gastroenterol963406341011774957
33. Ueno K,Hirata H,Shahryari V,Chen Y,Zaman MS,et al. Year: 2011Tumour suppressor microRNA-584 directly targets oncogene Rock-1 and decreases invasion ability in human clear cell renal cell carcinoma.Br J Cancer10430831521119662
34. Belian E,Kurucz R,Treue D,Lage H. Year: 2010Effect of YB-1 on the regulation of micro RNA expression in drug-sensitive and drug-resistant gastric carcinoma cells.Anticancer Res3062963320332481
35. Tan Y,Xie Z,Ding M,Wang Z,Yu Q,et al. Year: 2010Increased levels of FoxA1 transcription factor in pluripotent P19 embryonal carcinoma cells stimulate neural differentiation.Stem Cells Dev1913651367419916800
36. Taube JH,Allton K,Duncan SA,Shen L,Barton MC. Year: 2010Foxa1 functions as a pioneer transcription factor at transposable elements to activate Afp during differentiation of embryonic stem cells.J Biol Chem285161351614420348100
37. Lupien M,Eeckhoute J,Meyer CA,Wang Q,Zhang Y,et al. Year: 2008FoxA1 translates epigenetic signatures into enhancer-driven lineage-specific transcription.Cell13295897018358809
38. Ellenrieder V,Hendler SF,Boeck W,Seufferlein T,Menke A,et al. Year: 2001Transforming growth factor beta1 treatment leads to an epithelial- mesenchymal transdifferentiation of pancreatic cancer cells requiring extracellular signal-regulated kinase 2 activation.Cancer Res614222422811358848
39. Bhowmick NA,Ghiassi M,Bakin A,Aakre M,Lundquist CA,et al. Year: 2001Transforming growth factor-beta1 mediates epithelial to mesenchymal transdifferentiation through a RhoA-dependent mechanism.Mol Biol Cell12273611160820
40. Xu J,Lamouille S,Derynck R. Year: 2009TGF-β-induced epithelial to mesenchymal transition.Cell Res1915617219153598

Figures

[Figure ID: pone-0035147-g001]
doi: 10.1371/journal.pone.0035147.g001.
Figure 1  Screening and identification of miRNA-584 and miRNA-1290 in CagA-transfected cells. A. Detection of cagA DNA fragments in transfected cells.

The standard calcium phosphate precipitation method was used to establish stable CagA-expressing gastric carcinoma AGS cells. Transfection was validated using PCR and DNA sequencing after cell clones had grown. AGS cells stably expressing the empty pEGFP-c1 vector were also established as a control. B. Detection of CagA protein in transfected cells. Stable CagA-expressing gastric carcinoma AGS cells were lysed with RIPA buffer. The lysates were subjected to SDS-PAGE and subsequently to western blot analysis to probe with anti-GFP antibodies. AGS cells stably expressing the empty pEGFP-c1 vector were also established as a control. C. Screening and identification of miRNA-84 and miRNA-290 in stable CagA-expressing AGS cells. Total RNA was extracted from stable CagA-expressing AGS cells and control cells. Mammalian miRNA expression profile microarray scanning and TaqMan real-time PCR were performed. The results showed that both miRNA-584 and miRNA-1290 were up-regulated in stable CagA-expressing AGS cells. D. Identification of miRNA-584 and miRNA-1290 in gastric carcinoma SGC7901 cells transiently expressing CagA. Total RNA from gastric carcinoma SGC7901 cells transfected with cagA/pEGFP-c1 plasmid was extracted and real-time PCR was performed. Both miRNA-584 and miRNA-1290 were up-regulated in transiently CagA-expressing SGC7901 cells. E. Identification of miRNA-584 and miRNA-1290 in gastric carcinoma AGS cells infected with H.pylori. Total RNA was extracted from AGS cells infected with H.pylori including NCTC11637 and 9 cagA– isolates for 7 h (MOI≈50) respectively, and TaqMan real-time PCR was performed. Both miRNA-584 and miRNA-1290 were up-regulated after infection of cagA+ H.pylori (all P <0.01, ANOVA). Data are represented as mean +/− s.e.m.



[Figure ID: pone-0035147-g002]
doi: 10.1371/journal.pone.0035147.g002.
Figure 2  miRNA-1290 was up-regulated in an Erk1/2-dependent manner and miRNA-584 was activated indirectly by miRNA-1290. A. Determination of transactivities of Elk-1.

AGS cells were transiently transfected with pGL3-Elk-1 plasmid for 24 h and subsequently infected with H.pylori including NCTC11637 and 7 cagA+ isolates for additional 7 h (MOI≈50) respectively. Cells were lysed and the lysates were collected for determination of luminescent intensities by dual-luciferase ÿreporter assay. The results showed that transactivities of Elk-1 was up-regulated after infection of cagA+ H.pylori (P <0.01, ANOVA). B. Determination of luciferase activations containing promoter region of miRNA-584 and miRNA-1290. Plasmids containing Elk-1 or cagA were co-transfected with recombinant luciferase reporters containing promoter regions of miRNA-584 and miRNA-1290 (≈2000 bp) respectively into 293T cells for 24 h (Elk-1/cagA: luciferase reporters: Renilla luciferase = 3∶1∶0.01). Cells were lysed and the lysates were collected for determination of luminescent intensities by dual-luciferase_reporter assay. The results showed that miRNA-1290 was up-regulated by both Elk-1 and CagA (P <0.01, ANOVA), whereas miRNA-584 was not affected. C. Determination of miRNA-584 in stable miRNA-1290–expressing cells. To determine miRNA-584 in stable miRNA-1290–expressing cells, total RNA from stable miRNA-1290–expressing cells were isolated and real-time PCR was performed for miRNA-584. The results showed that miRNA-584 was up-regulated in stable miRNA-1290–expressing cells. D. Expression of miRNA-1290 enhanced NF-κB activities. miRNA-1290 was co-transfected with NF-κB reporter into SGC7901 cells for 24 h (miRNA-1290: luciferase reporters: Renilla luciferase = 3∶1∶0.01). Cells were lysed and the lysates were collected for determination of luminescent intensities by dual- luciferase_reporter assay. The results showed that miRNA-1290 enhanced NF-κB activities (P <0.01, ANOVA). E. Detection of NKRF protein in transfected cells. miRNA-1290-expressing gastric carcinoma SGC7901 cells were lysed and subsequently were subjected to western blot analysis to probe with anti-NKRF antibodies. SGC7901 cells expressing the empty vector were also established as a control. F. Knockdown of NKRF increased NF-κB activities.NKRF shRNA plasmid (Santa Cruz) was co-transfected with NF-κB reporters into SGC7901 cells for 48 h (NKRF shRNA plasmid: NF-κB reporters: Renilla luciferase = 3∶1∶ 0.1). Cells were lysed and the lysates were collected for determination of luminescent intensities. The results showed that knockdown of NKRF increased NF-κB activities (P <0.01, ANOVA). G. Activation of NF-κB upregulated miRNA-584.NKRF shRNA plasmid was co-transfected with recombinant luciferase reporters containing promoter regions of miRNA-584 into SGC7901 cells for 48 h (NKRF shRNA plasmid: luciferase reporters: Renilla luciferase = 3∶1∶ 0.1). Cells were lysed and the lysates were collected for determination of luminescent intensities. The results showed that NF-κB up-regulated miRNA-584 (P <0.01, ANOVA). H. Overexpression of c-Rel upregulated miRNA-584.c-Rel plasmid was co-transfected with recombinant luciferase reporters containing promoter regions of miRNA-584 into SGC7901 cells for 48 h (c-Rel plasmid: luciferase reporters: Renilla luciferase = 3∶1∶ 0.1). Cells were lysed and the lysates were collected for determination of luminescent intensities. The results showed that Overexpression of c-Rel upregulated miRNA-584 (P <0.01, ANOVA). Data are represented as mean +/− s.e.m.



[Figure ID: pone-0035147-g003]
doi: 10.1371/journal.pone.0035147.g003.
Figure 3  cagA+ H.pylori activated Erk1/2 kinases and miRNA-584 sustained Erk1/2 activities through inhibition of PPP2a. A. Erk1/2 kinases were activated by CagA.

AGS cells were infected with H.pylori including NCTC11637 and 9 cagA– and 7 cagA+ isolates for 7 h (MOI≈50) respectively. Cells were collected and lysed at 24 h after transfection. The lysates were co-precipitated with agarose-conjugated anti-Erk1/2 antibodies, and after washing 5 times, the beads were mixed with recombinant Elk-1 and ATP. Mixtures were subjected to SDS-PAGE after denaturing and subsequently western blot analysis probed with antibodies against phosph-Elk-1. Uninfected AGS cells were also established as a control. B. Determination of miRNA-584 and miRNA-1290 in transiently transfected cells. Total RNA was extracted from gastric carcinoma AGS cells transiently transfected with plasmids containing miRNA-584 or miRNA-1290 at 24 h after transfection. Real-time PCR was performed for determination of miRNA-584 and miRNA-1290. C. Detection of Erk1/2 activities. Gastric carcinoma AGS cells were transiently transfected with plasmids containing miRNA-584 or miRNA-1290. Cells were collected and the lysates were co-precipitated with agarose-conjugated anti-Erk1/2 antibodies, and after washing 5 times, the beads were mixed with recombinant Elk-1 and ATP at 30°C for 30 min. Mixtures were subjected to SDS-PAGE after denaturing and subsequently western blot analysis probed with antibodies against phosph-Elk-1. The empty vector was also established as a control. D. Detection of PPP2ca expression. Gastric carcinoma SGC7901 cells were transiently transfected with plasmids containing miRNA-584 or miRNA-1290. Cells were collected and lysed at 24 h after transfection. Lysates were subjected to SDS-PAGE after denaturing and subsequently western blot analysis probed with antibodies against PPP2ca. Data are represented as mean +/− s.e.m.



[Figure ID: pone-0035147-g004]
doi: 10.1371/journal.pone.0035147.g004.
Figure 4  Foxa1 is a target of miRNA-584 and miRNA-1290 and knockdown of Foxa1 promotes EMT. A. Schematic of potential target screening strategy. B. Transcription factor targets of miRNA-584 and miRNA-1290.

Transcription factors targeted by miRNA-584 and miRNA-1290 expressed in AGS cells were predicted by TargetScan (www. targetscan.org). C. Determination of pMIR-report luciferase activity. The recombinant plasmid pMIR-Foxa1 report was co-transfected with pcDNA6.2-GW/EmGFP-miR containing miRNA-584 or miRNA-1290 into AGS gastric cancer cells for 48 h. Cells were lysed and luciferase activity was determined by dual-luminescence reporter assay. Co-transfection of miRNA-584 or miRNA-1290 with pMIR-Foxa1 inhibited more than 90% of firefly luciferase activity (all P <0.001, ANOVA), indicating that miRNA-584 and miRNA-1290 target Foxa1 mRNA. D. Detection of Foxa1 in cells transiently expressing miRNA-584 and miRNA-1290. pcDNA6.2-GW/EmGFP-miR containing miRNA-584 or miRNA -1290 was transfected into SW620 colon cancer cells for 48 h. Cells (1×106) were lysed and the supernatant was subjected to western blot analysis. The results showed that the expression of Foxa1 protein was down-regulated about 50% after transfection of miRNA-584 or miRNA-1290. These results indicate that Foxa1 is a target of miRNA-584 and miRNA-1290. E. Analysis of the percentage of CD44+CD133+ cells. SW620 colon cancer cells were infected with recombinant Foxa1 shRNA lentivirus. Infected SW620 cells were digested and resuspended at 1×106 per 100 µL of PBS containing 2% FBS, and labeling antibodies (APC-CD44 and PE-CD133) were added at 4°C for 30 min in the dark. After two washes, cells were analyzed using a FACSAria. An empty vector control was also established. The percentage of CD44+CD133+ cells significantly decreased after Foxa1 knockdown (P <0.05, ANOVA). The supernatant from SW620 colon cancer cells with Foxa1 knockdown was subjected to western blot for detection of Bmi1. F. Foxa1 knockdown promotes EMT. The supernatant from SW620 colon cancer cells with Foxa1 knockdown was subjected to SDS-PAGE, and proteins were transferred onto a nitrocellulose membrane for western blotting for Foxa1, E-cadherin, and vimentin. G. Detection of E-cadherin in cells with stable expression of miRNA-584 or/and miRNA-1290. pcDNA6.2-GW/EmGFP-miR containing miRNA-584 or/and miRNA -1290 was transfected into SW620 colon cancer cells. Cells were separated at 24 h after transfection and screened by 5 µg/mL puromycin for 7 days. Survival clones were picked up and amplified respectively for 4 weeks. Cells were lysed and the supernatant was detected for E-cadherin. GAPDH was as controls.



[Figure ID: pone-0035147-g005]
doi: 10.1371/journal.pone.0035147.g005.
Figure 5  Overexpression of miRNA-584 and miRNA-1290 induced intestinal metaplasia in knock-in mice. A. Determination of miRNA-584 and miRNA-1290 in knock-in mice.

Total RNA was extracted from minced tissues of mice by Trizol reagent. Real-time PCR was performed for determination of miRNA-584 and miRNA-1290. The results showed miRNA-584 and miRNA-1290 increased in knock-in mice. Data are represented as mean +/− s.e.m. B. Morphological observation of knock-in mice. Obvious morphological alterations were not observed at the 12th week in knock-in mice. However, gastric mucosa layers were significantly thinned and flattened, and rugal folds had disappeared at the 72nd week C. H&E staining of gastric mucosa. Obvious morphological alterations were not observed at the 12th week in knock-in mice. However, gastric epitheliums were replaced by intestinal metaplasia under light microscopy (×100). D. Determination of Muc 2 and Muc 6. Total RNA was extracted from minced gastric tissues of mice by Trizol reagent. Real-time PCR was performed for determination of Muc2 and Muc6. The results showed Muc2 was significantly increased while Muc6 was significantly decreased in transgenic mice (all P <0.01, ANOVA). Data are represented as mean +/−s.e.m. E. PAS staining. Gastric mucosa from transgenic mice at 72nd W were checked by PAS staining (×100). The results showed that PAS-positive cells were increased in in transgenic mice.



Article Categories:
  • Research Article
Article Categories:
  • Medicine
    • Gastroenterology and Hepatology
      • Gastrointestinal Cancers
      • Gastrointestinal Infections
      • Stomach and Duodenum
    • Infectious Diseases
      • Bacterial Diseases
      • Gastrointestinal Infections
    • Oncology
      • Cancer Risk Factors
        • Genetic Causes of Cancer
      • Cancers and Neoplasms
        • Gastrointestinal Tumors
          • Gastric Cancer


Previous Document:  De novo transcriptomic analysis of an oleaginous microalga: pathway description and gene discovery f...
Next Document:  Heritability and genetic correlations of fear-related behaviour in Red Junglefowl--possible implicat...