| Lack of association of conjunctival MALT lymphoma with Chlamydiae or Helicobacter pylori in a cohort of Chinese patients. | |
| | |
| Jump to Full Text | |
MedLine Citation:
|
PMID: 22293871 Owner: NLM Status: MEDLINE |
Abstract/OtherAbstract:
|
BACKGROUND: This study was conducted to detect microbial pathogens in conjunctival mucosa-associated lymphoid tissue (MALT) lymphoma specimens in an attempt to determine possible associations between conjunctival MALT lymphoma and microbial infections. MATERIAL/METHODS: Using PCR technique, freshly obtained tumor specimens from 16 cases of conjunctival MALT lymphoma, as confirmed by postoperative pathology, were analyzed for DNA of Chlamydia psittaci (C. psittaci), Chlamydia trachomatis (C. trachomatis), Chlamydia pneumoniae (C. pneumoniae) and Helicobacter pylori (H. pylori). Synthetic C. psittaci, C. trachomatis, C. pneumoniae and H. pylori DNA were used as positive control, and blank plasmid DNA as negative control. RESULTS: Electrophoresis showed that no bands corresponding to the positive control were observed in the specimens, indicating that no DNA of the 4 microorganisms was detected in the specimens of the 16 cases of conjunctival MALT lymphoma. CONCLUSIONS: The PCR technique was able to detect the positive control quickly and accurately, but the results of PCR in analyzing the 16 specimens were negative, indicating that there is no association between conjunctival MALT lymphoma and the 4 microorganisms in Chinese patients. |
| | |
Authors:
|
Ji-Ping Cai; Jin-Wei Cheng; Xiao-Ye Ma; Yu-Zhen Li; You Li; Xiao Huang; Rui-Li Wei |
Publication Detail:
|
Type: Journal Article; Research Support, Non-U.S. Gov't |
Journal Detail:
|
Title: Medical science monitor : international medical journal of experimental and clinical research Volume: 18 ISSN: 1643-3750 ISO Abbreviation: Med. Sci. Monit. Publication Date: 2012 Feb |
Date Detail:
|
Created Date: 2012-02-01 Completed Date: 2012-05-29 Revised Date: 2013-04-25 |
Medline Journal Info:
|
Nlm Unique ID: 9609063 Medline TA: Med Sci Monit Country: Poland |
Other Details:
|
Languages: eng Pagination: BR84-88 Citation Subset: IM |
Affiliation:
|
Department of Ophthalmology, Shanghai Changzheng Hospital, 2nd Military Medical University, Shanghai, China. |
Export Citation:
|
APA/MLA Format Download EndNote Download BibTex |
| MeSH Terms | |
Descriptor/Qualifier:
|
Base Sequence China Chlamydia / genetics, isolation & purification* Cohort Studies Conjunctival Neoplasms / microbiology* DNA Primers DNA, Bacterial / analysis Helicobacter pylori / genetics, isolation & purification* Humans Lymphoma, B-Cell, Marginal Zone / microbiology* Polymerase Chain Reaction |
| Chemical | |
Reg. No./Substance:
|
0/DNA Primers; 0/DNA, Bacterial |
| Full Text | |
|
Journal Information Journal ID (nlm-ta): Med Sci Monit Journal ID (iso-abbrev): Med. Sci. Monit Journal ID (publisher-id): Medical Science Monitor ISSN: 1234-1010 ISSN: 1643-3750 Publisher: International Scientific Literature, Inc. |
Article Information Download PDF ![]() © Med Sci Monit, 2012 License: Received Day: 05 Month: 3 Year: 2011 Accepted Day: 03 Month: 11 Year: 2011 collection publication date: Year: 2012 Electronic publication date: Day: 01 Month: 2 Year: 2012 Volume: 18 Issue: 2 First Page: BR84 Last Page: BR88 PubMed Id: 22293871 ID: 3560575 Publisher Id: 882462 |
| Lack of association of conjunctival MALT lymphoma with Chlamydiae or Helicobacter pylori in a cohort of Chinese patients | |
| Ji-Ping Cai*ABCDEF | |
| Jin-Wei ChengABCDEF | |
| Xiao-Ye MaBCD | |
| Yu-Zhen LiBCD | |
| You LiBCD | |
| Xiao HuangBCD | |
| Rui-Li WeiAEFG | |
| Department of Ophthalmology, Shanghai Changzheng Hospital, 2nd Military Medical University, Shanghai, China |
|
| Correspondence: Rui-Li Wei, Department of Ophthalmology, Shanghai Changzheng Hospital, #415 Fengyang Road, Shanghai 200003, China, e-mail: ruiliwei@gmail.com *Ji-Ping Cai and Jin-Wei Cheng contributed equally to this work AStudy Design BData Collection CStatistical Analysis DData Interpretation EManuscript Preparation FLiterature Search GFunds Collection |
|
Chlamydiae are prokaryotic organisms that differ from both bacteria and viruses [1]. There are 3 known types of chlamydiae associated with human diseases: Chlamydia psittaci (C. psittaci), Chlamydia trachomatis (C. trachomatis) and Chlamydia pneumoniae (C. pneumoniae). They may cause multiple diseases, including pneumonia, trachoma, cervicitis, pelvic inflammatory disease, urethritis and epididymitis [2]. Recent studies in other countries revealed a close association between C. psittaci and ocular adnexal MALT lymphoma [3–6], but no such association has been reported in China.
MALT lymphoma is an extra-nodal marginal zone B cell lymphoma, and is the second most common inert tumor originating from mucosa-associated lymphoid tissue. There is definite evidence that occurrence of some B-cell lymphomas is associated with long-term chronic stimulation of microbials or autologous pathogens, which is most clearly exemplified by H. pylori-associated gastric MALT lymphoma [7–9].
Similar to the association of gastric MALT lymphoma with chronic stimulation of H. pylori, many pathogenic microbials, especially Chlamydiae, are also reported to be associated with the formation of MALT lymphoma. Italian researchers were the first to study ocular MALT lymphoma, and detected C. psittaci DNA in 80% of their ocular adnexal lymphoma specimens. They found that the tumor subsided after C. psittaci was eliminated with medical treatment, thus confirming a close correlation [3,4]. However, the results of subsequent similar studies in different parts of the world were controversial – there were great differences in the detection rate of C. psittaci DNA from ocular adnexal lymphoma specimens, seemingly suggesting a regional correlation [10–14].
The present study used the PCR method to detect C. psittaci, C. trachomatis, C. pneumoniae and H. pylori DNA in specimens of conjunctival MALT lymphoma freshly obtained from Chinese patients in our hospital to determine if these microorganisms were present Chinese patients with conjunctival MALT lymphoma.
Genomic DNA Mini Preparation Kit was purchased from MN NucleoSpin®, Germany. Tissue 740952 and Hotstart Taq were the products of TaKaRa DR028 (Dalian, China). All materials used, including tubes and pipette tips, were imported from AXYGEN. C. psittaci, C. trachomatis, C. pneumoniae and H. pylori DNA positive controls were synthesized in our laboratory.
Patient and sample collection: The study was approved by the local Ethics Review Board. Conjunctival MALT lymphoma specimens in the present study were from 14 patients (16 eyes) who were admitted at Shanghai Changzheng Hospital of the Second Military Medical University (Shanghai, China) between January 2008 and December 2009, all of whom were Han ethnicity and resided mainly in East China, without histories of keeping birds or having close contacts with birds. The patients included 9 males and 5 females who ranged in aged from 14 to 83 years, with a mean age of 55±16.76 years. Of the 2 patients with both eyes infected, both were female. The common presentation of the condition included the presence of subconjunctival (especially subfornical) pink tumors (salmon patch), whose course ranged from 3 months to 2 years. No history of lymphoma was elicited, nor was any tumor detected in another part of the body on physical examination. All patients received surgical treatment, and postoperative pathology and immunohistochemistry confirmed the diagnosis of MALT lymphoma in all patients. The tumor tissues, about 5mm in diameter, were obtained surgically, immediately washed with normal saline, stored in tubes and plunged directly in liquid nitrogen. The whole procedure was completed within 5 min. After 2–4 h preservation in liquid nitrogen, the 16 specimens were transferred to a −80°C freezer for preservation until later use.
Genome extraction of the specimens was performed according to the manufacturer’s instructions. In brief, about 25 mg of freshly obtained MALT lymphoma tissue was cut off, digested in 180 μl T1 and 25 μl proteinase K at 56°C for 3 h, boiled in 200 μl B3 at 70°C for 10 min, and added to 210 μl ethanol. The mixture was put into the column, centrifuged at 11000g for 1 min, washed with 500 μl BW once, and again with 600 μl B5. The column was spun without loading for 1 min to dry the membrane, and was put into BE which had been preheated up to 70°C, and then centrifuged at 11,000g for 1 min. Purity of the extracted DNA was measured by spectrophotometry, and integrity was measured by electrophoresis.
The 16S rRNA sequences of C. psittaci, C. trachomatis, C. pneumoniae and H. pylori were from NCBI DataBank and the previous literature [16]. Primer design was according to microbial 16S rRNA gene sequences.
- Expected length of C. trachomatis product: 315 bp
C. trachomatis p5 5′ GGCGATATTTGGGCATCCGAGTAACG 3′
C. trachomatis p3 5′ TCAAATCCAGCGGGTATTAACCGCCT 3′ - Expected length of C. pneumoniae product: 197 bp
C. pneumoniae p5 5′ GGTCTCAACCCCATCCGTGTCGG 3′
C. pneumoniae p3 5′ TGCGGAAAGCTGTATTTCTACAGTT 3′ - Expected length of C. psittaci: 111 bp
C. psittaci p5 5′ CCCAAGGTGAGGCTGATGAC 3′
C. psittaci p3 5′ CAAACCGTCCTAAGACAGTTA 3′ - Expected length of H. pylori: 305bp
H. pylori p5 5′ TGGCGTGTCTATTGACAGCGA-3′
H. pylori p3 5′ CCTGCTGGGCATACTTCACCA-3′
The above primers were synthesized by Shanghai Bioengineering Co., Shanghai, China.
We used 100 ng of tissue from each specimen as the template, and C. psittaci as touchdown of each 0.25°C cycle from 62°C to 50°C, pre-degeneration at 95°C for 5 min, and 45 cycles.
PCR cycling of C. pneumoniae, C. trachomatis and H. pylori: annealing at 55°C for 20 s, degeneration for 20 s, extension for 30 s, and 45 cycles. Electrophoresis was performed after PCR.
No C. psittaci, C. trachomatis and C. pneumoniae DNA of the 16 MALT lymphoma specimens from our patients were detected by PCR assay. The results are shown in Figures 1–4.
We observed that the electrophoretic bands of PCR amplification of specimens No. 8 and 16 C. trachomatis were similar to those of H. pylori, and there was a suspected band at the place corresponding to the positive control. There was also a suspected band in specimen No. 13 C. psittaci. Sequencing after gel cutting and recovery revealed that they were not significantly correlated with the 16S rRNA sequences of C. trachomatis, H. pylori and C. psittaci reported. This meant that there was no target product detected in these suspected bands and indicated that the results of these specimens were also negative. Appearance of such bands might be related to the environment of the templates themselves.
Research on the transformation of lymphocytes to cancer cells due to chronic microbial stimulation is of intense scientific interest world-wide. To confirm their correlation, it is necessary to detect the microorganisms in tumor tissues. In previous similar studies, DNA extraction was mostly from paraffin-embedded tumor pathologic specimens, and some of these tissues had been preserved for years before research; therefore, a portion of the DNA may have been degraded. The present study was a prospective study, different from previous reports in that the specimens used in the present study were freshly obtained from surgically resected and immediately frozen tumor tissues. Specimen collection and preservation were completed by the same person, thus minimizing DNA degradation and inter-specimen differences arising from personal influences, thereby maximizing the detection rate of the target DNA.
There is ample clinical and experimental evidence that H. pylori is the causative agent of gastric MALT lymphoma [7,8]. But there have been controversies over the conclusions in the research on ocular adnexal lymphoma. In 2004, Chan et al. [16] detected positive H. pylori in 4 (80%) of their 5 specimens of ocular adnexal lymphoma. Lee et al. [17] reported a 100% detection rate of H. pylori (15/15). Both studies pointed out that there might be a correlation between this agent and H. pylori. However, Sjo et al. [18] reported a conflicting result, finding that no H. pylori DNA was detected in their 13 specimens of ocular adnexal lymphoma. The present study searched for the presence of H. pylori in our MALT lymphoma specimens, and the results were negative in all specimens. Based on other related studies and reports [19–21], our conclusion seems to support that H. pylori infection is unlikely to be associated with the occurrence of ocular adnexal MALT lymphoma.
MALT lymphoma is the most common pathology in ocular adnexal lymphoma, accounting for 50–78% in developed countries [22–26], 80–90% in South Korea and Japan [27,28], and more than 80% in China [29–31]. Ocular adnexa include the eyelid, conjunctiva, orbit and lacrimal apparatus, of which the conjunctiva is most frequently exposed to the external environment directly, and therefore most susceptible to infection by microbial pathogens. If microbial infection is truly associated with ocular adnexal MALT lymphoma, the occurrence of the tumor is most likely to be related to chronic stimulation by exogenous microbials. Knowing that the incidence of conjunctival MALT lymphoma has been rising annually in recent years, we selected it as the subject of research in the present study, hoping to discover pathologic factors related to the etiology of the tumor in a limited number of cases. To our knowledge, this is the first study in China using fresh specimens of conjunctival MALT lymphoma from a cohort of Chinese patients to explore possible correlations between MALT lymphoma and microbial infections.
Italian researchers reported the presence of C. psittaci in 32 (80%) of their 40 specimens of ocular adnexal lymphoma [3], which aroused much attention at the time of the discovery. Later, South Korean [5] and Austrian [6] researchers confirmed this correlation. However, American [32], Dutch [10] and Japanese [11] research groups did not find any evidence to confirm the correlation between ocular adnexal lymphoma and C. psittaci. Husain et al. [33] published an overview of related studies and concluded that there were serious controversies over C. psittaci DNA detection in ocular adnexal lymphoma specimens. Out of 458 cases of ocular adnexal lymphoma that they reviewed, positive C. psittaci was detected in 104 cases (23%), but 90% of the 104 cases were from 3 of the 12 reports reviewed. A recent study [14] indicates that the C. psittaci detection rate in ocular adnexal lymphoma specimens varied from place to place: 17% in Italy and 0% in Kenya. The positive rate is geographically biased: it is relatively high in Italy and South Korea, relatively low in the United States and Japan, and 0% in our study. Interestingly, the prevalent rate of C. psittaci infection in MALT lymphoma was 11% in specimens from Southern China in a study whose results showed that C. psittaci was associated with ocular adnexal MALT lymphoma and that this association was variable in 6 different geographical areas [13]. The glaring difference between the only 2 studies in Chinese patients is that the cases in this present study resided mainly in East China, while most of the samples in the other study were collected from Southern China. A similar situation occurred in the studies of Italian patients. The C. psittaci detection rate in ocular adnexal lymphoma specimens varied from study to study (from 13% to 80%) [3,13,14].
Although we cannot deny possible errors and differences arising from specimen selection and detection methodology, the main problem is that we can neither rule out nor confirm the cause-effect relationship between them. In addition, C. psittaci infection is most likely to occur in luminal mucosa that has the contact with the external environment, such as the respiratory, reproductive and urinary tracts. It is therefore difficult to explain how MALT lymphoma in the deep orbit is caused by C. psittaci infection. The correlation between gastric MALT lymphoma and H. pylori infection has been confirmed [7,8]. This is understandable, because H. pylori exists extensively in normal human gastric mucosa, while C. psittaci is not commonly parasitic in human ocular adnexa. However, positive detection of C. psittaci is an objective finding, suggesting that C. psittaci infection may be one of the pathogenetic factors contributing to ocular adnexal MALT lymphoma. Whether it is an initiating factor or a predisposing factor needs further study.
No C. psittaci, C. trachomatis, C. pneumoniae or H. pylori DNA was detectable in the 16 freshly obtained specimens of conjunctival MALT lymphoma in the present study. There is no evidence to confirm the correlation between the above 4 microorganisms and conjunctival MALT lymphoma in patients from the East China area.
Notes
fn9-medscimonit-18-2-br84Source of support: Departmental sources
| 1. | Wyrick PB. Intracellular survival by ChlamydiaCell MicrobiolYear: 200022758211207584 |
| 2. | Byrne GI,Ojcius DM. Chlamydia and apoptosis: life and death decisions of an intracellular pathogenNat Rev MicrobiolYear: 20042802815378044 |
| 3. | Ferreri AJ,Guidoboni M,Ponzoni M,et al. Evidence for an association between Chlamydia psittaci and ocular adnexal lymphomasJ Natl Cancer InstYear: 2004965869415100336 |
| 4. | Ferreri AJ,Ponzoni M,Guidoboni M,et al. Regression of ocular adnexal lymphoma after Chlamydia psittaci-eradicating antibiotic therapyJ Clin OncolYear: 20052350677315968003 |
| 5. | Yoo C,Ryu MH,Huh J,et al. Chlamydia psittaci infection and clinicopathologic analysis of ocular adnexal lymphomas in KoreaAm J HematolYear: 200788212317570512 |
| 6. | Aigelsreiter A,Leitner E,Deutsch AJ,et al. Chlamydia psittaci in MALT lymphomas of ocular adnexals: The Austrian experienceLeuk ResYear: 20083212929418061259 |
| 7. | Zullo A,Hassan C,Cristofari F,et al. Gastric low-grade mucosal-associated lymphoid tissue-lymphoma: Helicobacter pylori and beyondWorld J Gastrointest OncolYear: 201021818621160595 |
| 8. | Stolte M. Helicobacter pylori gastritis and gastric MALT-lymphomaLancetYear: 1992339745461347613 |
| 9. | Bertoni F,Zucca E. State-of-the-art therapeutics: marginal-zone lymphomaJ Clin OncolYear: 20052364152016155028 |
| 10. | Mulder MM,Heddema ER,Pannekoek Y,et al. No evidence for an association of ocular adnexal lymphoma with Chlamydia psittaci in a cohort of patients from the NetherlandsLeuk ResYear: 2006301305716420962 |
| 11. | Daibata M,Nemoto Y,Togitani K,et al. Absence of Chlamydia psittaci in ocularadnexal lymphoma from Japanese patientsBr J HaematolYear: 20061326515216445841 |
| 12. | Matthews JM,Moreno LI,Dennis J,et al. Ocular adnexal lymphoma: no evidence for bacterial DNA associated with lymphoma pathogenesisBr J HaematolYear: 20081422464918492114 |
| 13. | Chanudet E,Zhou Y,Bacon CM,et al. A Chlamydia psittaci is variably associated with ocular adnexal MALT lymphoma in different geographical regionsJ PatholYear: 20062093445116583361 |
| 14. | Carugi A,Onnis A,Antonicelli G,et al. Geographic variation and environmental conditions as cofactors in Chlamydia psittaci association with ocular adnexal lymphomas: a comparison between Italian and African samplesHematol OncolYear: 201028202619728399 |
| 15. | Madico G,Quinn TC,et al. Touchdown Enzyme Time Release-PCR for Detection and Identification of Chlamydia trachomatis, C. pneumoniae, and C. psittaci Using the 16S and 16S–23S Spacer rRNA GenesJ Clin MicrobiolYear: 20003810859310699002 |
| 16. | Chan CC,Smith JA,Shen DF,et al. Helicobacter pylori (H. pylori) molecular signature in conjunctival mucosa-associated lymphoid tissue (MALT) lymphomaHistol HistopatholYear: 20041912192615375765 |
| 17. | Lee SB,Yang JW,Kim CS. The association between conjuctival MALT lymphoma and Helicobacter pyloriBr J OphthalmolYear: 2008925343618369070 |
| 18. | Sjo NC,Foegh P,Juhl BR,et al. Role of Helicobacter pylori in conjunctival mucosa-associated lymphoid tissue lymphomaOphthalmologyYear: 20071141828617198854 |
| 19. | Ferreri AJ,Ponzoni M,Viale E,et al. Association between Helicobacter pylori infection and MALT-type lymphoma of the ocular adnexa: clinical and therapeutic implicationsHematol OncolYear: 200624333716385613 |
| 20. | Gruenberger B,Woehrer S,Troch M,et al. Assessment of the role of hepatitis C, Helicobacter pylori and autoimmunity in MALT lymphoma of the ocular adnexa in 45 Austrian patientsActa OncolYear: 2008473555917957504 |
| 21. | Chan CC,Shen D,Mochizuki M,et al. Detection of Helicobacter pylori and Chlamydia pneumoniae genes in primary orbital lymphomaTrans Am Ophthalmol SocYear: 2006104627017471326 |
| 22. | Mannami T,Yoshino T,Oshima K,et al. Clinical, histopathological, and immunogenetic analysis of ocular adnexal lymphoproliferative disorders: characterization of malt lymphoma and reactive lymphoid hyperplasiaMod PatholYear: 2001146414911454995 |
| 23. | White WL,Ferry JA,Harris NL,Grove AS Jr. Ocular adnexal lymphoma. A clinicopathologic study with identification of lymphomas of mucosa-associated lymphoid tissue typeOphthalmologyYear: 1995102199420069098307 |
| 24. | Sjö LD. Ophthalmic lymphoma: epidemiology and pathogenesisActa OphthalmolYear: 20098712019178392 |
| 25. | Auw-Haedrich C,Coupland SE,Kapp A,et al. Long-term outcome of ocular adnexal lymphoma subtyped according to the REAL classification. Revised European and American LymphomaBr J OphthalmolYear: 200185636911133714 |
| 26. | Jakobiec FA. Ocular Adnexal Lymphoid Tumors: Progress in Need of ClarificationAm J OphthalmolYear: 20081459415018405875 |
| 27. | Nakata M,Matsuno Y,Katsumata N,et al. Histology according to the Revised European-American Lymphoma Classification significantly predicts the prognosis of ocular adnexal lymphomaLeuk LymphomaYear: 1999325334310048426 |
| 28. | Cho EY,Han JJ,Ree HJ,et al. Clinicopathologic Analysis of Ocular Adnexal Lymphomas: Extranodal Marginal Zone B-Cell Lymphoma Constitutes the Vast Majority of Ocular Lymphomas Among Koreans and Affects Younger PatientsAm J HematolYear: 200373879612749009 |
| 29. | You QS,Li B,Zhou XG,et al. Clinical and pathological features of 112 cases with ocular adnexal lymphoproliferative lesionsChin J OphthalmolYear: 20054187176 |
| 30. | Bi YW,Chen RJ,Hou YY,et al. Clinicopathologic Analysis of Primary Ocular MALT Extranodal Marginal Zone B-Cell LymphomaChin J PatholYear: 20073641415 |
| 31. | He WM,Luo QL,Xia RN. Histopathological studies on 114 cases of ocular adnexal lymphoid hyperplasiChin J Prac OphthalmolYear: 2001196870 |
| 32. | Rosado MF,Byrne GE Jr,Ding F,et al. Ocular adnexal lymphoma: A clinicopathologic study of a large cohort of patients with no evidence for an association with Chlamydia psittaciBloodYear: 20061074677216166588 |
| 33. | Husain A,Roberts D,Pro B,et al. Meta-analyses of the Association Between Chlamydia psittaci and Ocular Adnexal Lymphoma and the Response of Ocular Adnexal Lymphoma to AntibioticsCancerYear: 20071108091517594698 |
Article Categories:
Keywords: ocular adnexal MALT lymphoma, Chlamydia, Helicobacter pylori. |
|
Previous Document: Changes in chemiluminescence of whole blood of COPD patients treated with Hypoxen and effects of C??...
Next Document: Postcardiac injury syndrome. Part II.
