Document Detail

Inhibition of MicroRNA miR-92a Inhibits Cell Proliferation in Human Acute Promyelocytic Leukemia.
Jump to Full Text
MedLine Citation:
PMID:  24385779     Owner:  NLM     Status:  PubMed-not-MEDLINE    
Abstract/OtherAbstract:
OBJECTIVE: MicroRNAs (miRNAs) are endogenous non-coding RNAs, 19-25 nucleotides in length involved in post-transcriptional regulation of gene expression in a considerable majority of mRNAs. In many tumors, up- or down-regulation of different miRNAs has been reported. In acute myeloid leukemia up-regulation of miR-92a has been reported in humans in vitro studies. In this study it is mainly aimed to assess the effect of inhibition of miR-92a in viability of acute promyelocytic leukemia (APL).
MATERIALS AND METHODS: We performed inhibition of miR-92a in an acute promyelocytic leukemia (APL) cell line (HL-60) using locked nucleic acid (LNA) antagomir. At different time points after LNA-anti-miR92a transfection, miR-92a quantitation and cell viability were assessed by qRT-real-time-polymerase chain reaction (PCR) and MTT assays. The data was processed using the ANOVA test.
RESULTS: Down-regulation of miR-92a in APL cell line (HL-60) by LNA antagomir extensively decreased cell viability in APL. Cell viability gradually decreased over time as the viability of LNA-anti-miR transfected cells was less than 50% of untreated cells at 72 h post-transfection. The difference of cell viability between LNA-anti-miR and control groups was statistically significant (p<0.024).
CONCLUSION: Based on our findings, it is concluded that inhibition of miR-92a may represent a potential novel therapeutic approach for treatment of APL.
CONFLICT OF INTEREST: None declared.
Abstract available from the publisher.
Authors:
Mohammadreza Sharifi; Rasoul Salehi; Yousof Gheisari; Mohammad Kazemi
Related Documents :
23118219 - The high and low molecular weight forms of hyaluronan have distinct effects on cd44 clu...
25036279 - Phospholipid polymer-based antibody immobilization for cell rolling surfaces in stem ce...
23746399 - Enhanced oh radical generation by dual-frequency ultrasound with tio2 nanoparticles: it...
24912029 - The common antitussive agent dextromethorphan protects against hyperoxia-induced cell d...
18008349 - Case report and review of lupus erythematosus cells in cytology fluids.
23088909 - Synthesis of retinoid enhancers based on 2-aminobenzothiazoles for anti-cancer therapy.
20232349 - Characterization of uptake of folates by rat and human blood-brain barrier endothelial ...
16804009 - Map kinases and heat shock-induced hormesis in human fibroblasts during serial passagin...
20153499 - On the role of metabolic activity on the transport und deposition of pseudomonas fluore...
Publication Detail:
Type:  Journal Article     Date:  2013-06-05
Journal Detail:
Title:  Turkish journal of haematology : official journal of Turkish Society of Haematology     Volume:  30     ISSN:  1300-7777     ISO Abbreviation:  Turk J Haematol     Publication Date:  2013 Jun 
Date Detail:
Created Date:  2014-01-03     Completed Date:  2014-01-03     Revised Date:  2014-07-31    
Medline Journal Info:
Nlm Unique ID:  9606065     Medline TA:  Turk J Haematol     Country:  Turkey    
Other Details:
Languages:  eng     Pagination:  157-62     Citation Subset:  -    
Export Citation:
APA/MLA Format     Download EndNote     Download BibTex
MeSH Terms
Descriptor/Qualifier:

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine

Full Text
Journal Information
Journal ID (nlm-ta): Turk J Haematol
Journal ID (iso-abbrev): Turk J Haematol
Journal ID (publisher-id): TJH
ISSN: 1300-7777
ISSN: 1308-5263
Publisher: Galenos Publishing
Article Information
Download PDF
© Turkish Journal of Hematology, Published by Galenos Publishing.
open-access:
Received Day: 10 Month: 11 Year: 2012
Accepted Day: 31 Month: 12 Year: 2012
Print publication date: Month: 6 Year: 2013
Electronic publication date: Day: 5 Month: 6 Year: 2013
Volume: 30 Issue: 2
First Page: 157 Last Page: 162
PubMed Id: 24385779
ID: 3878471
DOI: 10.4274/Tjh.2012.0171
Publisher Item Identifier: 1147

Inhibition of MicroRNA miR-92a Inhibits Cell Proliferation in Human Acute Promyelocytic Leukemia
Mohammadreza Sharifi1
Rasoul Salehi1*
Yousof Gheisari1
Mohammad Kazemi1
1 Mohammadreza Sharifi, Rasoul Salehi, Yousof Gheisari, Mohammad Kazemi Pediatrics Inherited Diseases Research Center & Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfhan, Iran
Correspondence: * Address for Correspondence: Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, 81744-176, Iran Phone: +98 311 792 24 87 E-mail: r_salehi@med.mui.ac.ir

INTRODUCTION

MicroRNAs (miRNAs) are post-transcription regulators of gene expression involved in many cellular biological and pathological activities [1]. Initially discovered in 1993 in Caenorhabditis elegans should be italicized, miRNAs were next revealed in many other organisms, including human beings, and proved to play crucial roles in regulation of gene expression. They are composed of the short ribonucleic acid (RNA) chain of 19-25 nucleotides [2]. MiRNAs are involved in various biological processes, including the cell cycle, differentiation, growth and development, metabolism, aging and apoptosis [3,4,5,6,7]. Deregulation of miRNAs expression, including both down- and up-regulation of their biogenesis, mimics the phenomenon attributed to the oncogenes and tumor suppressor genes, depending on the target mRNA regulated by particular species of miRNAs [8,9,10,11,12]. In addition, many reports favoring their essential function In addition, many reports favor their essential function in a wide range of diseases, including heart and cardiovascular diseases; rheumatological, infectious, inflammatory, autoimmune, metabolic disorders and cancers [8,13,14].

Acute myeloid leukemia (AML) is a disorder of hematopoietic stem cells, accompanied with obstruction in hematopoietic cell differentiation and increased clonal neoplastic proliferation. If remained untreated, this malignancy leads to death within a few weeks to several months [15]. Despite extensive studies, the biological and pathophysiological of AML are not yet clearly known [16]. MiRNAs as influential players in cell function can potentially shed light on the pathogenesis of this disorder and could be considered as a potential novel therapeutic option, especially in cases where conventional therapies are less beneficial [17,18,19].

Recent studies on miRNAs in relation to AML revealed many up- and down-regulation events, some correlated with particular cytogenetic aberrations. It has been shown that there is an increased expression of miR-92a in AML[20,21]. In addition, this miRNA has been shown to negatively regulate p63 in CD32 cells (a murine myeloid cell line) leading to increased proliferation of these cells [22]. MiR-92a is a member of the miR-17-92 cluster located on chromosome 13q31.3. It has been suggested that this cluster may function as the oncogene in some other malignancies, including chronic myelocytic leukemia [23].

Based on this evidence, we have proposed to examine the effects of miR-92a inhibition on HL-60 cell line proliferation and viability as a basic preliminary step in developing a novel therapeutic strategy for AML. According to the American-French-British (FAB) classification, AML is divided into eight subtypes, M0-M7 [15]. HL-60 cells are suitable in vitro model of AML-M3, also known as acute promyelocytic leukemia (APL).


MATERIALS AND METHODS

Cell Culture

The HL-60 cell line (Human Promyelocytic Leukemia: APL) was purchased from the National Cell Bank of Iran (NCBI; Pasteur Institute, Iran) with Cytogenetic: 44,X,-X,-5,dic(5;17)(q11;p11)del(7)(p?),der(7)t(5;7)(q11;q?31)t(5;16)(q11;?),add(8)(?),der(9)del(9)(p2?)t(9;14)(q2?;q2?),del(10)(p?),ins(11;8)(q13?;?),der(14)t(14;15)(q1?;q?),15,der(16)(5;16)(q?;q?22~24),der(16)t(7;16)(?;q?22~24),+18. The cell culture was maintained in Roswell Park Memorial Institute (RPMI) 1640 (Gibco, Paisley, UK) supplemented with fetal calf serum (FCS; Gibco, Paisley, UK) 15% v/v, 100 U/mL of penicillin and 100 μg/mL of streptomycin (Gibco, Paisley, UK) in an air-saturated and humid atmosphere consisting of 5% CO2 in 25-cm2 culture flasks (Nunc, Roskilde, Denmark) at 37°C. The cells were passaged twice weekly to maintain an exponential growth phase.

Cell Transfection

The nucleotide sequences of miR-92a were obtained from www.mirbase.org as UAUUGCACUUGUCCCGGCCUGU (accession number MIMAT0000092). The miRCURY LNA microRNA Inhibitor™ for hsa-miR-92a and microRNA inhibitor negative control (scrambled) oligonucleotides were purchased from Exiqon, Denmark. Both oligonucleotides were labeled at the 5´ end with fluorescent dyes, 6-FAM, for subsequent detection of transfected cells.

HL-60 cell transfection was performed by using the X-treme GENE siRNA Transfection Reagent™ (Roche, Mannheim, Germany) according to the manufacturer instructions. Briefly, 5x105 cells in the exponential growth phase were cultured in six-well culture plates (Nunc, Roskilde, Denmark) containing 1.8 mL RPMI 1640 per well without antibiotics and FCS. The 50 pmol miRCURY LNA microRNA inhibitor™ was mixed with 5 µL X-treme GENE siRNA Transfection Reagent™ in 200 µl Opti-MEM I Medium™ (Gibco, Paisley, UK) and incubated for 15 min at room temperature. The complex was then added to the cells and swirled cautiously to ensure even distribution over the entire plate surface. After 8 h of incubation, the FCS and antibiotics were added, and the cells were incubated for the 24, 48, and 72 h. Untreated cells and cells transfected with scrambled-LNA were cultured parallel to the LNA-anti-miR transfected cells. Efficiency of the transfection was examined by flow cytometry and fluorescent microscopy. LNA was conjugated with 6-FAM™ Fluorescein (6-carboxyfluorescein) in order to detect and quantify LNA transfected cells by fluorescent microscopy and FACSCalibur flow cytometer (BD, USA).

Reverse Transcriptase microRNA Real Time Polymerase Chain Reaction

Reverse transcriptase (RT) microRNA real time polymerase chain reaction (PCR) was performed to determine the efficiency of miR-92a inhibition by LNA-anti-miR. Briefly, the total cellular RNA was extracted 24, 48, and 72 h post transfection with the miRCURY RNA Isolation Kit™ (Exiqon, Copenhagen, Denmark) and cDNA was synthesized with the Universal cDNA Synthesis Kit™ (Exiqon, Copenhagen, Denmark). Real time PCR was performed by using SYBR® Green Master Mix Kit™ (Exiqon, Copenhagen, Denmark) and specific miR-92a primers (all consumables in this section were from Exiqon, Copenhagen, Denmark). Synthetic RNA spike-in templates and their primers (Exiqon, Denmark) were used for RT-PCR internal control. The ABI Step One Plus (ABI, USA) instrument was used for real time PCR experiments and the ΔΔCt method for data calculation.

Cells Viability Assay

The viability of cells were assessed by the MTT (3-[4, 5 dimethylthiazol-2-yl]-2, 5-diphenyl tetrazolium bromide) assay, which is based on reduction of MTT by the mitochondrial dehydrogenase of intact cells to purple formazan products. The conversion is directly related to the number of living cells. The MTT assay was performed at the time intervals of 48, and 72 h post transfection. Two hundred microliters of MTT (Sigma-Aldrich, USA) at the concentration of 50 mg/mL was added to 5x105 HL-60 cells suspended in 2 mL of RPMI 1640 medium and incubated for

4 h at 37 °C in the dark. Two hundred microliters of dimethyl sulfoxide (DMSO; Sigma-Aldrich, USA) was added to each well and was shaken until dissolution of crystals. Blank samples were prepared using exactly the same procedure with an exception of cell incorporation. Absorbance was measured by using a spectrophotometer (PG Instrument T80, England) at 570 nm. Reading was converted to the percentage of the controls.

Statistical Analysis

All the experiments were carried out in triplicate. The results were calculated by using the SPSS (version 16) software. The ANOVA test was used to assess differences the between the groups. Data were presented as mean±SD. Statistical significance was defined as p<0.05.


RESULTS

miRCURY LNA microRNA Inhibitor™ Strongly Inhibits miR-92a

For inhibition of miR-92a, the miRCURY LNA microRNA Inhibitor™ was transfected to HL-60 cells with the X-tremeGENE siRNA Transfection Reagent. On the basis of the initial optimization experiments, transfection was performed with 50 pM of LNA-anti-miR and 5 μL of the transfection reagent. As the transfected oligonucleotides were fluorochrome-conjugated, transfection efficiencies were assessed by fluorescence microscopy and flow cytometry. Carefully optimized protocol produced transfection efficiency of 90% [Figure 1].

Expression of miR-92a was evaluated by reverse transcriptase microRNA real time PCR in HL-60 cells transfected with the miRCURY LNA microRNA Inhibitor™ (LNA-anti-miR group), the microRNA inhibitor scrambled oligonucleotides (scrambled LNA group), and untreated HL-60 cells (untreated groups), at 24, 48, and 72 h post-transfection. Although, miR-92a expression was a little lower in the scrambled LNA-transfected cells compared to the untreated cells, the differences were not statistically significant. However, in all three time points, the expression of miR-92a was considerably lower in the LNA-anti-miR group compared to the control groups (p<0.025). The expression of miR-92a was at the lowest level 24 h after transfection and gradually increased in the next two time points [Figure 2].

Inhibition of miR-92a Decreased Viable HL-60 Cells

To assess the effect of miR-92a inhibition on cell viability, the MTT assay was performed 24, 48, and 72 h after transfection. Cell viability was lower in the scrambled-LNA group compared to the untreated cells at 48 and 72 h after transfection (p<0.05). Cell viability of HL-60 cells was considerably decreased LNA-anti-miR post-transfection. The effect of LNA-anti-miR transfection on the cell viability gradually increased over time as the viability of the LNA-anti-miR transfected cell was less than 50% of the untreated cells at 72 h post-transfection [Figure 3]. The difference of the cell viability between the LNA-anti-miR and both control groups (untreated and scrambled treated) was statistically significant (p<0.024) at all three time points [Figure 3].


DISCUSSION

AML, a prevalent malignancy of myeloid cells, is associated with a high rate of morbidity and mortality [16, 15]. In spite of recent progresses, the therapeutic options for this disorder are still suboptimal and, therefore, novel therapeutic options are urgently needed [16,24,15]. MiRNAs are known to function as either oncogenes (oncomiRs) or tumor suppressors [25]. Reversal of the deregulated miRNAs normalized their cellular levels and hence provides blockage of the pathological pathways resulted from miRNAs ill expression, which is an alternative novel therapeutic option [21].

In this study, we have used LNA-anti-miR to the inhibition of miR-92a in APL (AML-M3) cell line. Real time PCR data confirmed that this miRNA was almost entirely down-regulated after LNA-anti-miR transfection. As well, the MTT assay showed that inhibition of miR92a is associated with decreased cell viability after 24, 48, and 72 h. Although, probably due to the transfection reagent toxicity, cell viability was minimally decreased in the scrambled LNA transfected cells compared to the normal controls (untreated cells) but this difference was not statistically significant.

MiR-92a is traced to be involved in various leukemia, including AML and ALL, hepatocellular carcinoma (HCC), and several other cancers [26]. It is suggested that miR-92a target’s estrogen receptor (ERβ1) mRNA hence down regulating its expression in breast cancer [27]. In AML, miR-92a overexpression was observed, as well as its inverse relationship with p63 protein expression in murine CD32myeloid cells [22, 21].

There are a number of studies on oncomiRs as an approach to cancer treatment by employing an appropriate inhibitory molecule to down-regulate specific cellular miRNAs [28,29,30]. These studies are rapidly expanding into advanced phases expecting to generate a new path in challenges like chemo resistant cases or circumstances needing augmentation of weak response to therapies [25]. One of the technologies employed in oncomiRs inhibition is the LNA technology [31]. In this study, we used the same technology to suppress already up-regulated miR-92a in an APL cell line. Prevention of cellular proliferation subsequent to the LNA transfection is indicative of successful inhibition of miR92a in the cell line under study. Based on the fact that cytogenetic abnormality of APL is really complex and needs careful karyotype examination for patient’s stratification and design of the therapeutic plan, blockage of APL proliferation by inhibition of just one miRNA is a big achievement. Manni et al. reported in a mouse acute myeloid leukemia cell line that miR-92 inhibits p63 expression and that this protein has an important role in cell proliferation [22]. Perhaps in human APL, p63 expression is inhibited by miR-92a and induces the cell proliferation. Chemotherapy is a routine approach for AML treatment [15, 16], However, in many cases, chemo resistance does not allow effective treatment and cell proliferation would not relief, as it is frequently exemplified by resistance to all-trans retinoic acid (ATRA) [24]. On the other hand, there are some instances that oncomiR inhibition acts to sensitize the cells to chemotherapy agents, making this combination therapy more effective than any one of the strategies used alone [32,33].

As a conclusion, taken together, our data suggest that inhibition of miR-92a with LNA-anti-miR may provide an alternative approach for the treatment of APL. It can be used alone or in combination with current therapies to reduce the existing limitations in the treatment of this malignancy. We realize that further in vivo studies are definitely required to assess the feasibility of this strategy. However, efficient in vivo delivery of anti-miR oligonucleotides remains an obstacle to be tackled before we can move to clinical trials.


CONFLICT OF INTEREST STATEMENT

The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.


References
1. Ruan K,Fang X,Ouyang G. MicroRNAs: novel regulators in the hallmarks of human cancerCancer LettYear: 200928511612619464788
2. Reddy SD,Gajula RP,Pakala SB,Kumar R. MicroRNAs and cancer therapy: the next wave or here to stay?Cancer Biol TherYear: 2010947948220190563
3. Fabbri M,Garzon R,Andreeff M,Kantarjian H,Garcia-Manero G,Calin G. MicroRNAs and noncoding RNAs in hematological malignancies: molecular, clinical and therapeutic implicationsLeukemiaYear: 2008221095110518323801
4. Alvarez-Garcia I,Miska EA. MicroRNA functions in animal development and human diseaseDevelopmentYear: 20051324653466216224045
5. Griffiths-Jones SM. The microRNA sequence databaseMethods Mol BiolYear: 200634212913816957372
6. Baltimore DB. MicroRNAs in Inflammation and their disregulation in cancer and autoimmune diseaseAnnual Review of Immunology.Year: 201230
7. Rottiers V,Näär AM. MicroRNAs in metabolism and metabolic disordersNat Rev Mol Cell BiolYear: 20121323925022436747
8. Barh D,Malhotra R,Ravi B,Sindhurani P. MicroRNA let-7: an emerging next-generation cancer therapeuticCurr OncolYear: 201017708020179807
9. Drakaki A,Iliopoulos D. MicroRNA gene networks in oncogenesisCurr GenomicsYear: 200910354119721809
10. George G,Mittal RD. MicroRNAs: Potential biomarkers in cancerIndian J Clin BiochemYear: 20102541423105877
11. Seto AG. The road toward microRNA therapeuticsInt J Biochem Cell BiolYear: 2010421298130520227519
12. Gu J,Zhu X,Li Y,Dong D,Yao J,Lin C,Huang K,Hu H,Fei J. miRNA-21 regulates arsenic-induced anti-leukemia activity in myelogenous cell linesMed OncolYear: 20112821121820143188
13. Spizzo R,Rushworth D,Guerrero M,Calin GA. RNA inhibition, microRNAs, and new therapeutic agents for cancer treatmentClin Lymphoma MyelomaYear: 20099(Suppl 3)313318
14. rang P,Weidhaas J,Slack F. MicroRNAs as potential cancer therapeuticsOncogeneYear: 200827S525719956180
15. Richard A. McPherson RA,Pincus MR. Henry’s. Clinical Diagnosis and Management by Laboratory MethodsPhiladelphiaSaundersYear: 2007
16. Shipley JL,Butera JN. Acute myelogenous leukemiaExp HematolYear: 20093764965819463767
17. Umezu T,Ohyashiki K,Kuroda M,Ohyashiki JH. Leukemia cell to endothelial cell communication via exosomal miRNAsOncogeneYear: 2012
18. Wieser R,Scheideler M,Hackl H,Engelmann M,Schneckenleithner C,Hiden K,Papak C,Trajanoski Z,Sill H,Fonatsch C. microRNAs in acute myeloid leukemia: Expression patterns, correlations with genetic and clinical parameters, and prognostic significanceGenes Chromosomes CancerYear: 20104919320320013895
19. Zhang H,Chen YQ. New insight into the role of miRNAs in leukemiaSci China C Life SciYear: 20095222423119294347
20. Tanaka M,Oikawa K,Takanashi M,Kudo M,Ohyashiki J,Ohyashiki K,Kuroda M. Down-regulation of miR-92 in human plasma is a novel marker for acute leukemia patientsPLoS OneYear: 20094e5532e553219440243
21. Ohyashiki JH,Umezu T,Kobayashi C,Hamamura RS,Tanaka M,Kuroda M,Ohyashiki K. Impact on cell to plasma ratio of miR-92a in patients with acute leukemia: in vivo assessment of cell to plasma ratio of miR-92aBMC Res NotesYear: 2010334734721182798
22. Manni I,Artuso S,Careccia S,Rizzo MG,Baserga R,Piaggio G,Sacchi A. The microRNA miR-92 increases proliferation of myeloid cells and by targeting p63 modulates the abundance of its isoformsThe FASEB JYear: 20092339573966
23. Uziel T,Karginov FV,Xie S,Parker JS,Wang YD,Gajjar A,He L,Ellison D,Gilbertson RJ,Hannon G,Roussel MF. The miR-17~92 cluster collaborates with the Sonic Hedgehog pathway in medulloblastomaProc Natl Acad Sci U S AYear: 20091062812281719196975
24. Estey EH. Acute myeloid leukemia: 2012 update on diagnosis, risk stratification, and managementAm J HematolYear: 201287899922180162
25. Iorio MV,Croce CM. MicroRNA dysregulation in cancer: diagnostics, monitoring and therapeuticsA comprehensive review. EMBO Mol MedYear: 20124143159
26. Hu G,Drescher KM,Chen XM. Exosomal miRNAs: biological properties and therapeutic potentialFront GenetYear: 20123565622529849
27. Al-Nakhle H,Burns PA,Cummings M,Hanby AM,Hughes TA,Satheesha S,Shaaban AM,Smith L,Speirs V. Estrogen receptor β1 expression is regulated by miR-92 in breast cancerCancer ResYear: 2010704778478420484043
28. Zhou T,Zhang G,Liu Z,Xia S,Tian H. Overexpression of miR-92a correlates with tumor metastasis and poor prognosis in patients with colorectal cancerInt J Colorectal DisYear: 201328192422772712
29. Zhao X,Yang L,Hu J,Ruan J. miR-138 might reverse multidrug resistance of leukemia cellsLeuk ResYear: 2010341078108219896708
30. Saito Y,Friedman JM,Chihara Y,Egger G,Chuang JC,Liang G. Epigenetic therapy upregulates the tumor suppressor microRNA-126 and its host gene EGFL7 in human cancer cellsBiochem Biophys Res CommunYear: 200937972673119116145
31. Ørom UA,Kauppinen S,Lund AH. LNA-modified oligonucleotides mediate specific inhibition of microRNA functiongeneYear: 200637213714116503100
32. Yuan Y,Zeng ZY,Liu XH,Gong DJ,Tao J,Cheng HZ,Huang SD. MicroRNA-203 inhibits cell proliferation by repressing ΔNp63 expression in human esophageal squamous cell carcinomaBMC CancerYear: 201111575721299870
33. Li X,Liu J,Zhou R,Huang S,Huang S,Chen XM. Gene silencing of MIR22 in acute lymphoblastic leukaemia involves histone modifications independent of promoter DNA methylationBr J HaematolYear: 2010148697919807731

Article Categories:
  • Research Article

Keywords: microRNA, miR-92a, Acute promyelocytic leukemia, Locked Nucleic Acid.

Previous Document:  Clinical significance of reticulocyte hemoglobin content in the diagnosis of iron deficiency anemia.
Next Document:  Trends in transfusion transmitted infections among replacement blood donors in karachi, pakistan.