| Improvement of cardiac function in mouse myocardial infarction after transplantation of epigenetically-modified bone marrow progenitor cells. | |
| | |
| Jump to Full Text | |
MedLine Citation:
|
PMID: 21799893 Owner: NLM Status: MEDLINE |
Abstract/OtherAbstract:
|
OBJECTIVE: To study usefulness of bone marrow progenitor cells (BPCs) epigenetically altered by chromatin modifying agents in mediating heart repair after myocardial infarction in mice. METHODS AND RESULTS: We tested the therapeutic efficacy of bone marrow progenitor cells treated with the clinically-used chromatin modifying agents Trichostatin A (TSA, histone deacetylase inhibitor) and 5Aza-2-deoxycytidine (Aza, DNA methylation inhibitor) in a mouse model of acute myocardial infarction (AMI). Treatment of BPCs with Aza and TSA induced expression of pluripotent genes Oct4, Nanog, Sox2, and thereafter culturing these cells in defined cardiac myocyte-conditioned medium resulted in their differentiation into cardiomyocyte progenitors and subsequently into cardiac myocytes. Their transition was deduced by expression of repertoire of markers: Nkx2.5, GATA4, cardiotroponin T, cardiotroponin I, α-sarcomeric actinin, Mef2c and MHC-α. We observed that the modified BPCs had greater AceH3K9 expression and reduced histone deacetylase1 (HDAC1) and lysine-specific demethylase1 (LSD1) expression compared to untreated BPCs, characteristic of epigenetic changes. Intra-myocardial injection of modified BPCs after AMI in mice significantly improved left ventricular function. These changes were ascribed to differentiation of the injected cells into cardiomyocytes and endothelial cells. CONCLUSION: Treatment of BPCs with Aza and TSA converts BPCs into multipotent cells, which can then be differentiated into myocyte progenitors. Transplantation of these modified progenitor cells into infarcted mouse hearts improved left ventricular function secondary to differentiation of cells in the niche into myocytes and endothelial cells. |
| | |
Authors:
|
Johnson Rajasingh; Jayakumar Thangavel; Mohammad R Siddiqui; Ignatius Gomes; Xiao-pei Gao; Raj Kishore; Asrar B Malik |
Related Documents
:
|
2373813 - Q waves in hypertrophic cardiomyopathy in relation to the distribution and severity of ... 8930743 - Predicting sudden cardiac death from t wave alternans of the surface electrocardiogram:... 1504973 - Ambulatory electrocardiography evaluation of asymptomatic, unstable, and stable coronar... |
Publication Detail:
|
Type: Journal Article; Research Support, N.I.H., Extramural; Research Support, Non-U.S. Gov't Date: 2011-07-22 |
Journal Detail:
|
Title: PloS one Volume: 6 ISSN: 1932-6203 ISO Abbreviation: PLoS ONE Publication Date: 2011 |
Date Detail:
|
Created Date: 2011-07-29 Completed Date: 2011-12-06 Revised Date: 2013-05-01 |
Medline Journal Info:
|
Nlm Unique ID: 101285081 Medline TA: PLoS One Country: United States |
Other Details:
|
Languages: eng Pagination: e22550 Citation Subset: IM |
Affiliation:
|
Department of Pharmacology and Center of Lung and Vascular Biology, University of Illinois College of Medicine, Chicago, Illinois, United States of America. rjohnson9@kumc.edu |
Export Citation:
|
APA/MLA Format Download EndNote Download BibTex |
| MeSH Terms | |
Descriptor/Qualifier:
|
Animals Azacitidine / analogs & derivatives, pharmacology Bone Marrow Cells / cytology* Cell Differentiation / drug effects Endothelial Cells / drug effects, pathology Epigenesis, Genetic* / drug effects Gene Expression Regulation / drug effects Heart / physiopathology* Hydroxamic Acids / pharmacology Inflammation / surgery Male Mice Mice, Inbred C57BL Myocardial Infarction / metabolism, pathology, physiopathology*, surgery* Myocytes, Cardiac / drug effects, pathology Neovascularization, Physiologic / drug effects Pluripotent Stem Cells / cytology, drug effects, metabolism, transplantation Stem Cell Transplantation* Stem Cells / cytology, drug effects, metabolism* Ventricular Dysfunction, Left / surgery |
| Grant Support | |
ID/Acronym/Agency:
|
R01 HL090152/HL/NHLBI NIH HHS; R01HL90152/HL/NHLBI NIH HHS; R21HL97349/HL/NHLBI NIH HHS |
| Chemical | |
Reg. No./Substance:
|
0/Hydroxamic Acids; 2353-33-5/decitabine; 320-67-2/Azacitidine; 3X2S926L3Z/trichostatin A |
| Comments/Corrections | |
| Full Text | |
|
Journal Information Journal ID (nlm-ta): PLoS One Journal ID (publisher-id): plos Journal ID (pmc): plosone ISSN: 1932-6203 Publisher: Public Library of Science, San Francisco, USA |
Article Information Download PDF ![]() Rajasingh et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Received Day: 24 Month: 5 Year: 2011 Accepted Day: 23 Month: 6 Year: 2011 collection publication date: Year: 2011 Electronic publication date: Day: 22 Month: 7 Year: 2011 Volume: 6 Issue: 7 E-location ID: e22550 ID: 3142193 PubMed Id: 21799893 Publisher Id: PONE-D-11-09606 DOI: 10.1371/journal.pone.0022550 |
| Improvement of Cardiac Function in Mouse Myocardial Infarction after Transplantation of Epigenetically-Modified Bone Marrow Progenitor Cells Alternate Title:Modified BPCs Restores Cardiac Function in mAMI | |
| Johnson Rajasingh1*¤ | |
| Jayakumar Thangavel1¤ | |
| Mohammad R. Siddiqui1 | |
| Ignatius Gomes1 | |
| Xiao-pei Gao1 | |
| Raj Kishore2 | |
| Asrar B. Malik1 | |
| Marcelo G. Boniniedit1 |
Role: Editor |
|
1Department of Pharmacology and Center of Lung and Vascular Biology, University of Illinois College of Medicine, Chicago, Illinois, United States of America |
|
|
2Feinberg Cardiovascular Research Institute, Northwestern University School of Medicine, Chicago, Illinois, United States of America |
|
| University of Illinois at Chicago, United States of America |
|
| Correspondence: * E-mail: rjohnson9@kumc.edu Contributed by footnote: Conceived and designed the experiments: JR RK ABM. Performed the experiments: JR JT MRS XG IG. Analyzed the data: JR ABM. Contributed reagents/materials/analysis tools: JR ABM. Wrote the paper: JR ABM. ¤Current address: Department of Internal Medicine, Cardiovascular Research Institute, University of Kansas Medical Center, Kansas City, Kansas, United States of America |
|
Bone marrow-derived progenitor cells (BPCs) and endothelial progenitor cells (EPCs) from the bone marrow can mediate neovascularization in the ischemic myocardium and improve pump function of the heart [1], [2]. However, stem cell therapy involving BPCs and EPCs has often produced small and variable effects and, importantly, it remains unclear whether these cells are capable of inducing myogenesis and myocardial regeneration [3], [4]. The protective effects also appear to be due to release of humoral factors [5]. Because of the variability of the responses using BPCs and EPCs [3]–[5], we addressed the question whether BPCs can be improved by modifying them pharmacologically such that there is improved engraftment and myocardial regeneration. Here we used the strategy of treating BPCs with available chromatin modifying agents prior to their transplantation. We used trichostatin A (TSA, a histone deacetylase inhibitor) and 5Aza-2-deoxycytidine (Aza, a DNA methylation inhibitor) [6] based on the precept that DNA demethylation and histone acetylation are key steps required for epigenetic modification of cells [7], [8]. These agents have been shown to alter cell fate [9], [10] and differentiate mesenchymal stem cells (MSCs) into cardiac myocytes (CMCs) [11]. We observed that these drugs used together induced conversion of BPCs to multipotent cells (referred to as eiBPCs). The cardiac progenitor cells generated from eiBPCs were used for transplantation into mouse infarcted hearts. We investigated how these agents converted BPCs into multipotent eiBPCs and effects of transplantation of cardiac progenitors derived from eiBPCs on cardiac function. We observed that combined Aza and TSA treatment of BPCs induced epigenetic changes characterized by greater AceH3K9 expression and reduced histone deacetylase1 (HDAC1) and lysine-specific demethylase 1 (LSD1) expression compared to untreated BPCs. These epigenetic changes induced expression of Oct4, Nanog and Sox2, transcription factors in BPCs. Transplantation of cardiac progenitors derived from eiBPCs into infarcted mouse hearts significantly improved left ventricular function that was coupled to differentiation of the injected cells into CMCs and endothelial cells at sites of transplantation.
Mouse bone marrow derived progenitor cell (BPC) culture was carried out as described [12]. Mononuclear cells isolated from the tibias and femurs of GFP-expressing transgenic C57BL/6-TgN (ACTbEGFP) mice were cultured in EBM-2 medium supplemented with (SingleQuot Kit; Clonetics) 5% FBS on cell-culture dishes coated with 0.1% rat vitronectin/gelatin. After 4 days in culture, the adherent cells were reseeded (5×104 cells/cm2) on 0.1% vitronectin/gelatin-coated 10 cm culture dishes and 4-well chamber slides and cultured for 3 additional days. Cells in 4-well slides were co-incubated with DiI-acLDL (Biomedical Technologies) for 1 hour, stained with fluorescein isothiocyanate–conjugated Banderia simplicifolia lectin 1 (FITC-BS1), and viewed under fluorescence microscope. Majority of these cells were double-stained with these markers defining them as endothelial-lineage cells [12]. These cells were further characterized by flow cytometry using stem and progenitor cell marker antibodies. Day-7 BPCs growing in 10 cm culture dishes were used for the chemical modification experiments using Aza and TSA described below.
Day-7 BPCs were treated with Aza (0, 10, 25, 50 and 100 nM) or TSA (0, 5, 10, 25 and 50 nM) or both drugs combined for 4 days. Total cellular RNA was obtained for qRT-PCR analysis to determine mRNA expression of pluripotency markers [13], [14]. The gene expression profiles of Primer and probe sequences specific for specific target genes are given in Table 1. Relative mRNA expression of target genes was normalized to endogenous 18S control gene (Applied Biosystems). Results were expressed as fold change in expression and values were calculated as ratio of induced expression-to-control expression.
Genomic DNA was obtained from tissue sections from un-injected (control) and BPC- and eiBPCs-derived cardiac progenitor-injected mouse hearts. Sections were stained with anti-EGFP antibody to identify areas of injected cells present in the myocardium and these sections were used for PCR analysis. Additionally, random samples of recipient spleen, lung, liver and kidney were also used for DNA extraction to compare with responses occurring in the heart. PCR was conducted for EGFP to identify DNA of EGFP-labeled transplanted cells. DNA was extracted with QIAamp DNA micro kit (Qiagen); 100 ng DNA was mixed with primers for EGFP (Table 1). Final PCR products were run on agarose gel for detection of bands corresponding to EGFP.
To determine differentiation potential of re-programmed BPCs, termed eiBPCs, into CMCs, the eiBPCs were cultured for 5 days in complete DMEM containing CMC induction medium with 5 ng/mL LIF and 3 ng/mL bone morphogenetic protein-2 (BMP-2) in 6-well culture plates (106 cells per well) as well as 4-well chamber slides (104 -cells per well) coated with 0.1% gelatin as in [13], [14]. Total cellular RNA was obtained from 6-well culture plates and qRT-PCR analysis of mRNA expression of CMC markers was carried out (Table 1); the markers used were GATA4, Nkx2.5, cardiotroponin T (CTT), CTI, α-sarcomeric actinin (α-SA), Mef2c, and MHC-α. For protein expression, cells were cultured for 10 days and protein expression was determined by immunochemical staining. For transplantation into myocardial infarction model, eiBPCs were cultured in CMC-conditioned medium for 24 hours to commit the cells towards CMC lineage [13] before transplantation.
Protein expression was evaluated by immunofluorescence staining as in [13], [14]. Briefly, cultured cells or cardiac tissue was rinsed once with phosphate-buffered saline (PBS) and fixed with 4% paraformaldehyde (Sigma) in PBS for 30 min, then rinsed three times with PBS, permeabilized with 0.3% Triton X-100 (Sigma) in PBS for 5 min, washed twice with PBS, and incubated overnight at 4°C with primary antibodies (against Oct4, Nkx2.5, Gata 4, MAP-2, MBP, GFAP, CTT, α-SA, GFP and Ki67) diluted with 1% FBS in PBS. After 3 washes with PBS, cells were incubated with specific secondary antibodies for 1 hour at 37°C, and cells were rinsed three times with PBS, stained with DAPI to visualize cell nuclei, rinsed 3 times with PBS, dried, and mounted in Vectashield mounting medium for fluorescent imaging. All immunofluorescence staining was photographed using either confocal and immunofluorescence microscope.
Immunoprecipitation and Western blot analyses of AceH3K9, HDAC1 and LSD1 proteins were performed in BPCs and eiBPCs as in [13] using antibodies purchased from Cell Signaling Technology, USA.
ChIp assay was performed for the Oct4 promoter in BPCs, eiBPCs and mouse ESCs as described [14], [15] to identify transcription factors binding to Oct4 following treatment with Aza and TSA.
Viability and proliferation of the modified BPCs was evaluated by Trypan-blue exclusion and MTT assays, respectively. BPCs were cultured with different concentrations of Aza and TSA in 12-well culture plates for 24 or 48 hours, cells were harvested, exposed to Trypan blue solution (final concentration 0.1%), and number of viable (unstained) and non-viable (stained) cells were counted with a hemocytometer. Effects of Aza and TSA on BPC proliferation was determined by 3, 4, 5-(dimethylthiazol-2-yl) 2, 5- diphenyl tetrazolium bromide (MTT) assay according to manufacturer's instruction (Cell Proliferation Assay kit Promega). Briefly, 105 cells were cultured in 96-well culture plate (200 ul/well) in DMEM containing 10% FBS in the presence of 0, 25, 50 and 100 ng/ml 5Aza or 0, 10, 25, 50 nm/ml TSA or combination of both for 48 hours at 37°C. MTT assay results were confirmed by manual cell counting under microscope.
All procedures were performed in accordance with guidelines of Institutional Animal Care and Use Committee of University of Illinois at Chicago (ACC No: 09-061 approved dated 05/08/2009). The study involved 8-week-old male C57BL/6J mice (n = 30); Jackson Laboratories). Mice underwent surgery to induce AMI by ligation of left anterior descending coronary artery [16], [17]. Animals subdivided into 3 groups received intramyocardial injection of 5×105 GFP+cardiac progenitors derived from eiBPCs (treated for 24 hours with cardiomyocyte specific medium), control BPCs, or saline, respectively, in a total volume of 10 uL at 5 sites (basal anterior, mid-anterior, mid-lateral, apical anterior and apical lateral) in the peri-infarct area immediately after surgery.
Mice underwent echocardiography just before MI (base level) and at 1, 2, and 4 weeks after AMI as described [16], [17]. Trans-thoracic echocardiography was performed with a 6- to 15-MHz transducer (SONOS 5500, Hewlett Packard). Two-dimensional images were obtained in the parasternal long and short axis and apical 4-chamber views. M-mode images of the left ventricular short axis were taken just below the level of mid-papillary muscles. Left ventricular end-diastolic and end-systolic dimensions were measured and functional shortening was determined according to modified recommendations of American Society of Echocardiography. A mean value of 3 measurements was determined for each time point. On day 28 post-AMI, mice were euthanized and aortas were perfused with saline, hearts were removed and sliced into 4 transverse sections from apex to base and fixed with 4% paraformaldehyde, methanol, or frozen in OCT compound and sectioned into 5-µm thickness slices. Immunofluorescence staining was performed to determine myocyte and endothelial cell differentiation of transplanted cells. For assessment of fibrosis, tissues sections were frozen in OCT compound and sectioned for elastic tissue/trichrome to measure average ratio of the external circumference of fibrosis area to left ventricular area.
To assess survival of transplanted cells as well as effects of cell transplantation on survival of resident myocytes, apoptosis assay was performed on heart tissue collected at different time points. Cell death was assessed using the TUNEL kit according to manufacturer's instruction (Roche Applied Science). After TUNEL assay staining, sections were examined by confocal fluorescence microscopy.
We measured mRNA levels of TNF-α, IL-1β, IL-6, MCP-1 and IL-10 in heart tissue bordering the infarcted myocardium as described [18].
De-paraffinized heart tissue section slides were incubated for 30 min in peroxidase suppressor to quench endogenous peroxidase activity. After washing slides two times for 3 min with a wash buffer, blocking buffer was added and then incubated for 30 min. The tissue was incubated for 30 min with anti-CD31 antibody and slides were washed two times for 3 min with wash buffer. Again the tissues were incubated for 30 min with HRP-conjugated secondary antibody and slides were washed 3 times for 3 min each with wash buffer. Finally, the metal enhanced DAB Substrate was added and incubated until the desired staining was achieved.
All experiments were made at least 3 times. Results are presented as mean+SEM. Comparisons were performed by ANOVA (GB-STAT; Dynamic Microsystems) or χ2 test for percentages. All tests were 2-sided, and probability value of <0.05 was considered as statistically significant.
On day 7, BPCs obtained from C57BL/6J mouse bone marrow as described [12] were analyzed by immunofluorescence and flowcytometry (Figure 1A, B). Most cells were positive for Dil-acLDL and showed binding to fluorescein isothicyanate-conjugated Banderia simplicifolia lectin 1 (FITC-BS1). FACS analysis also showed BPCs were a heterogeneous population. They were positive for progenitor cell markers such as CD34 (17%), CD133 (10%), Sca1 (100%), and c-kit (12%) and some were also positive for endothelial cell markers CD31 (10%) and VE-cadherin (16%). BPCs were treated for 4 days with Aza alone, TSA alone, or both Aza and TSA at various concentrations. BPCs treated with Aza or TSA alone (Figure 1C) or with both agents in combination induced expression of Oct4, Nanog and Sox2 (Figure 1D, p<0.001 control vs. Aza+TSA treatment group). Maximum expression of these factors occurred at combined concentrations of 50 nM Aza and 25 nM TSA. Immunofluorescence analysis of Oct4 expression showed that BPCs treated with Aza+TSA showed significantly up-regulated expression of pluripotent genes at passage 0 (Figure 1E) but expression decreased markedly by passage 6 (data not shown). The expression of Oct4 gene transcript was supported by Oct4 Western blot protein expression data (Figure 1F). The results shown in Figure 1A-E demonstrate that pluripotent genes in BPCs were activated by co-treatment with Aza and TSA in a concentration-dependent manner. We also observed by qRT-PCR that BPCs treated with 50 nM Aza and 25 nM TSA resulted in silencing of eNOS and VE-cadherin genes compared to control cells (Figure 1G), suggesting that these drugs promoted de-differentiation of endothelial cells present in the BPC population.
BPCs were cultured with different concentrations of Aza and TSA in 12-well culture plates for 24 or 48 hours, cells were harvested, exposed to Trypan blue solution (final concentration 0.1%), and number of viable (unstained) and non-viable (stained) cells were counted with a hemocytometer. Treatment with up to 50 nM Aza and 25 nM TSA had no effect on cell viability (Figure 2A, p = 0.09). The modified BPCs also showed normal ability to proliferate (Figure 2B, C p<0.05)
We determined whether Aza and TSA treatment of BPCs altered acetylation and methylation status of AceH3K9, HDAC1, and LSD1 proteins involved in induction of multipotency [19]. BPCs were treated with 5Aza and TSA, either alone or in combination for 2 days. As shown in Figure 3A, expression of acetylated H3 lysine9 (AceH3K9) protein was significantly increased in BPCs treated with TSA alone (p<0.01) or with Aza plus TSA (p<0.005) compared to controls. HDAC1 protein expression decreased after treatment of BPCs with either TSA alone (p<0.005) or combination of Aza+TSA (p<0.005) compared to control cells (Figure 3B). Compared to control BPCs, the treated BPCs displayed decreased LSD1 expression (p<0.05) (Figure 3C).
We also determined whether Aza and TSA induced changes in AceH3K9 protein interaction with Oct4 promoter [14] to assess whether these agents can epigenetically modify BPCs. As shown in Figure 3D, Oct4 promoter was highly acetylated in positive control mouse ESCs, whereas acetylation of H3 region in Oct4 promoter was not detected in untreated BPCs but it was much evident in the treated BPC (p<0.05).
To address whether Aza and TSA modified BPCs (eiBPCs) could give rise into myocyte progenitor lineage cells and cardiomyocytes, eiBPC were cultured for 5 or 10 days in CMC induction medium. We observed that cardiac progenitor cell markers Flk1 and c-kit were up-regulated as early as 24 hr after combined treatment with Aza and TSA compared to control or BPC treated with Aza or TSA alone (Figure 4A, B). Cardiomyocyte specific markers, GATA4, Nkx2.5, CTT, α-sarcomeric actinin, Mef2c, MHC-α and CTI were up-regulated after combined treatment of Aza and TSA at day 5 compared to BPCs treated with Aza or TSA alone (Figure 4C, D; P<0.001 control vs. cells treated with both Aza and TSA). eiBPCs or cardiac progenitor cells derived from eiBPCs failed to differentiate into endodermal lineage of cells and did not form teratomas in SCID mice (data not shown) suggesting that eiBPCs or cardiac progenitors derived from eiBPCs had been partially re-programmed but were not pluripotent.
We used a standardized mouse AMI model [16], [17] to test the efficacy of cardiac progenitors derived from eiBPCs (as described Methods) in improving LV function. Physiological assessment of LV function was made before AMI and on days 7, 14 and 28 post-AMI. The day 28 post-AMI echocardiography showed significantly improved LV diastolic dimensions (LVDd) and percentage of LV fractional shortening (%LVFS) in mice transplanted with eiBPCs and BPCs compared to saline control (Figure 5A, B). Mouse hearts treated cardiac progenitors derived from eiBPCs had better functional outcome post-AMI than BPC treatment alone. Myocardial regeneration was only seen in the infarcted myocardium in hearts treated with Aza- plus TSA-modified BPCs. Masson's trichrome-stained sections showed markedly enlarged LV in saline-injected AMI mice and LVs were less enlarged in mouse hearts injected with Aza- plus TSA-modified BPCs (Figure 5C). Heart sections were also quantified for % LV fibrosis as the ratio of length of fibrosis scar-to-LV circumference. We observed marked reduction in LV fibrosis in hearts treated with eiBPC-derived cardiac progenitors compared with hearts treated with BPCs or saline (Figure 5D). We also examined the capillary density in ischemic area by DAB staining using anti-CD31 antibody marking for capillaries (Figure 5E). Five randomly chosen sections were quantified in microscopic visual fields on each slide and mean was calculated. We observed a closely similar number of capillaries in BPC-transplanted hearts (28±3) and eiBPC-derived cardiac progenitor-transplanted hearts (25±2) (Figure 5E, P = 0.06), suggesting that propensity of BPCs to differentiate into endothelial cells was similar to cardiac progenitors from eiBPCs.
To determine effects of cardiac progenitors derived from eiBPCs on expression of pro-inflammatory and anti-inflammatory cytokines and chemokines (TNF-α, IL-1β, IL-6, MCP-1 and IL-10) in the myocardium at 3 days post-AMI was assessed by qRT-PCR. Expression of pro-inflammatory cytokines and chemokines was increased in myocardium of saline-treated and was decreased in BPC-treated (Figure 6A-D, p<0.01 vs. saline) and eiBPC-derived cardiac progenitor-treated myocardium (Figure 6A-D, p<0.005 vs. saline, P<0.05 vs. BPC). The anti-inflammatory cytokine IL-10 mRNA expression was increased in eiBPC-derived cardiac progenitor group compared to saline- or BPC-treated group (Figure 6E, p<0.01 vs. saline, p<0.05 vs. BPC) treated myocardium. Even in non-injected eiBPC-derived cardiac progenitors, there was increased IL-10 and IL-10R mRNA expression vs. BPCs (Figure 6F).
Immunofluorescence staining was performed to determine in situ differentiation of transplanted GFP+eiBPC-derived cardiac progenitors in the myocardium. The 28 days post-cell injected heart tissue sections were co-stained with CMC tissue markers cardiotroponin T (CTT) (Figure 7A) and α-SA (Figure 7B). The GPF+ cells (green) expressing the two CMC proteins (red) were double positive (yellow) merged images indicating the co-localization and differentiation of injected cells. Double positive cells were counted at 5 randomly chosen fields on each slide, and the mean is presented as double positive cells/mm2 (Figure 7C). As shown in Figure 7, transplantation of cardiac progenitors derived from eiBPCs induced differentiation of progenitor cells to CMCs in situ; transplantation of eiBPC-derived cardiac progenitors also showed greater number of cells co-expressing the CMC markers than transplantation of BPCs alone (p<0.01). Genomic DNA obtained from un-injected hearts and hearts from BPC-injected hearts and eiBPC-derived cardiac progenitor-injected hearts was also used for PCR analysis. Additionally, samples of spleen, lung, liver and kidney were used for DNA extraction. PCR for EGFP used to identify DNA of GFP-labeled transplanted cells in tissue. The bands on agarose gel corresponding to eGFP showed that green cells were present in heart tissue (Figure 7D) and bands from the other organs did not express GFP DNA (data not shown).
As shown in Figure 8, differentiation into GFP+CD31+ double positive cells was marginally increased in myocardial sections obtained from mouse hearts transplanted with BPCs (Figure 8A) compared to larger increase in mouse hearts transplanted with eiBPC-derived cardiac progenitors (Figure 8B). Endothelial differentiation in myocardial tissue was quantified by counting CD31+GFP+ cells (Figure 8C). Number of GFP+CD31+ cells similarly increased in both BPC-transplanted hearts (12±2) and eiBPC-derived cardiac progenitor transplanted hearts (10±1, P = 0.09).
Transplanted eiBPC-derived cardiac progenitors also showed evidence of proliferation in vivo, as determined by co-localization of GFP+ cells with nuclear proliferation antigen, Ki67, seen at day 28 post-transplantation (Figure 9A, C), whereas fewer GFP+Ki67+ cells were seen in BPC-transplanted hearts. This proliferative effect is consistent with the in vitro data above (Figure 2). In addition the number of apoptotic cells was less in eiBPC-derived cardiac progenitor transplanted group than in BPC-transplanted group (Figure 9 B, D).
Progress has been made recently in inducing cardiac regeneration aimed at repairing the damaged cardiac tissue [5], [20]. BPCs and EPCs have been extensively used in these studies [21]; however, the results have been variable and often improvements have been short-lived perhaps due to waning effects of the released humoral mediators from the transplanted cells and tissue and failure of effective engraftment [5]. In addition, it is not always clear whether transplanted cells differentiate into cardiac or endothelial cells and thus whether they have the capability to regenerate injured tissue. Cells such as BPCs also consist of heterogeneous population of bone marrow cells containing mesenchymal cells, EPCs, and mature endothelial cells [17]. These cells may not have trans-differentiation potential of cardiac progenitor cells [22], [23]. Here we demonstrate for the first time to our knowledge of the value of epigenetic modification of BPCs, which induces the BPCs to de-differentiate into multipotential cells, which we termed eiBPCs. Transplantation of cardiac progenitor cells derived from eiBPCs into mouse hearts induced significantly greater cardiac protection and myocyte regeneration in mice after myocardial infarction over that seen with BPCs alone. Based on these results, we posit that cardiac progenitor cells derived from epigenetic modification of autologous BPCs have promise for treating ischemic heart disease. These findings thus raise the possibility of converting BPCs into multipotent eiBPCs as a source of cardiac regenerating cells.
Epigenetic changes are defined as modifications of DNA or chromatin that do not involve alterations of the DNA sequence or genetic deletions [7], [24]. Recent studies into the mechanisms by which nuclear cloning and somatic-ESC fusion induce epigenetic changes in somatic cell nuclei suggest that the somatic cell chromatin is remodeled through chromatin condensation, DNA methylation/de-methylation, and histone modifications (acetylation/de-acetylation, phosphorylation, and methylation/de-methylation) [25], [26]. These histone and DNA modifications are functionally linked [7], [8]. DNA de-methylation/methylation is an essential epigenetic process required for gene activation or inactivation during development [27]. A change in DNA methylation pattern is also a principal epigenetic event underlying de-differentiation of somatic cells [28]–[30]. DNA methylation most often occurs on 5′-CpG-3′ dinucleotides [31]. DNA methyl transferase enzymes (dnmt 1, dnmt3a, dnmt 3b) attach a methyl group to the 5th carbon position of cytosine residues in the CG dinucleotide [30], the protein condenses into a protein complex consisting of methyl-binding proteins (MBD), HDACs, and repressor proteins at the methylated CpG sites [29], which leads to inhibition of gene expression [32]. In addition to DNA methylation, post-translational modifications of histone proteins regulate gene activity by modulating chromatin structure [33]. Acetylation of histone H3 and H4 generally correlates with gene activation whereas de-acetylation correlates with gene silencing [34].
Gene silencing is achieved by DNA methylation and histone deacetylation at the promoter region of genes [35] whereas gene activation is mediated by DNA demethylation and histone acetylation [36]. DNA demethylation and methylation are mediated and balanced by DNA demethyltransferases (DeMT) and DNA methyltransferases (Dnmts) respectively. In this study, we used Aza, an inhibitor for Dnmts, which blocks DNA methylation and thus promotes demethylation [6]. Likewise histone acetylation and deacetylation is mediated and balanced by the enzymes histone acetyltransferases (HATs) and histone deacetylases (HDACs), respectively. Here we also used TSA, a general inhibitor for HDACs that blocks deacetylation and promotes histone acetylation [6]. Our data show that BPCs treated with Aza plus TSA in a dose-dependent manner activated the pluripotent genes Oct4, Nanog and Sox2 and resulted in expression of these proteins [37]. However, we do not think that these cells became totipotent as defined earlier [37], since transplantation of these cells did not result in the formation of teratomas.
Transcriptional activation of pluripotent genes such as Oct4 requires acetylation of histone H3 at lysine 9 (aceH3K9), whereas histone deacetylation by HDACs 1, 2, 3, and 8 induces closed chromatin confirmation leading to repression of gene activity [38], [39]. Transcriptional activation is also modulated by histone demethylase activity of LSD1, a homolog of nuclear amine oxidase; however, depending on the cellular context, LSD1 can either repress transcription as a component of the CoREST transcriptional co-repressor complex [40], [41] or activate transcription by functioning as a co-activator [40]. Our results show that treatment of BPCs with Aza plus TSA induced modifications resulting in expression of genes associated with a multipotent phenotype. We observed decreases in HDAC1 and LSD1 protein expression and increase in AceH3K9 protein expression indicative of epigenetic changes at the level of histones. We also observed increased aceH3K9 protein expression and its interaction with Oct4 promoter demonstrating that Oct4 promoter region was acetylated in the Aza- and TSA-treated BPCs. Thus, the chromatin modifying agents Aza and TSA induced epigenetic modification of BPCs at least in part by histone modifications and chromatin remodeling leading to the activation of dormant pluripotent genes.
We further transplantation of cardiac progenitor cells derived from the modified BPCs induced cardiomyogenesis and angiogenesis in infarcted hearts. As new vessel formation following cardiac progenitor cell transplantation was similar to that seen with BPC transplantation, it appears that angiogenesis is due to EPCs present in the transplanted cell population that were not fully committed to their myocyte fate.
Importantly, we did not observe teratoma formation following injection of cardiac progenitors. This is consistent with the use of cardiac progenitors derived from epigenetically multipotent BPCs rather fully de-differentiated iPSCs [37], [42], [43]. We did not examine the in situ electrophysiological properties of the regenerated CMCs; thus, although LV function was improved after cell transplantation, we do know whether the myocytes formed a proper syncytium. In addition, we observed only up to 5% of transplanted cells were retained in the myocardium at day 28 in absence of significant apoptosis, suggesting that the injected cells may have transitioned into myocytes during this period. Also it is possible that secretion of factors by transplanted cells or host tissue may contribute to the improvement in cardiac function. We observed the production of IL-10, an anti-inflammatory cytokine, in cardiac tissue after transplantation, which could improve LV function and remodeling via activation of STAT3 and suppression of p38 MAPKs [18].
Our observations are consistent with recent studies showing the feasibility of reprogramming of somatic cells into the CMC lineage [44]. A recent study also demonstrated reprogramming of fibroblasts into multi-lineage hematopoietic progenitor cells and mature blood cells without establishing totipotency [45]. They accomplished this by ectopic expression of Oct4-activated hematopoietic transcription factors and treatment with specific cytokines. We showed differentiation of BPCs into cardiac progenitor cells expressing the CMC markers Gata4, Nkx2.5, CTT, and α-SA is possible using the chromatin modifying agents Aza and TSA.
In summary, we showed that treatment of BPCs with chromatin modifying agents Aza and TSA induced expression of pluripotent genes Sox2, Oct4 and Nanog in BPCs, which can then be further programmed to generate cardiac progenitor cells that give rise to cardiac and endothelial cells in situ. Transplantation of these epigenetically reprogrammed cardiac progenitors cells induced cardiomyogenesis and also improved LV function of infarcted mouse hearts suggesting the utility of this approach. We used available chromatin modifying drugs to achieve multipotency of BPCs suggests clinical applicability and value of this cell transplantation approach.
Notes
Competing Interests: The authors have declared that no competing interests exist.
Funding: This work was supported, in part, by American Heart Association Grant - Jon Holden DeHaan Foundation 10SDG2630181 and National Institutes of Health (NIH) grant R21HL97349 (to JR) and RO1HL90152 (to ABM). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
| 1. | Losordo DW,Dimmeler S. Year: 2004Therapeutic angiogenesis and vasculogenesis for ischemic disease: part II: cell-based therapies.Circulation1092692269715184293 |
| 2. | Jujo K,Ii M,Losordo DW. Year: 2008Endothelial progenitor cells in neovascularization of infarcted myocardium.J Mol Cell Cardiol4553054418755197 |
| 3. | Murry CE,Soonpaa MH,Reinecke H,Nakajima H,Nakajima HO,et al. Year: 2004Haematopoietic stem cells do not transdifferentiate into cardiac myocytes in myocardial infarcts.Nature42866466815034593 |
| 4. | Balsam LB,Wagers AJ,Christensen JL,Kofidis T,Weissman IL,et al. Year: 2004Haematopoietic stem cells adopt mature haematopoietic fates in ischemic myocardium.Nature42866867315034594 |
| 5. | Perin EC,Silva GV. Year: 2010Cell-based therapy for chronic ischemic heart disease-a clinical perspective.Cardiovasc Ther2921121720955540 |
| 6. | Ishimaru N,Fukuchi M,Hirai A,Chiba Y,Tamura T,et al. Year: 2010Differential epigenetic regulation of BDNF and NT-3 genes by trichostatin A and 5-aza-2′-deoxycytidine in Neuro-2a cells.Biochem Biophys Res Commun39417317720188708 |
| 7. | Trojer P,Reinberg D. Year: 2006Histone Lysine Demethylase and their impact on epigenetics.Cell12521321716630806 |
| 8. | Klose RJ,Bird AP. Year: 2006Genomic DNA methylation: the mark and its mediators.Trends Biochem Sci318997 Review. 16403636 |
| 9. | Ruau D,Ensenat-Waser R,Dinger TC,Vallabhapurapu DS,Rolletschek A,et al. Year: 2008Pluripotency associated genes are reactivated by chromatin-modifying agents in neurosphere cells.Stem Cells492092618203677 |
| 10. | Araki H,Yoshinaga K,Boccuni P,Zhao Y,Hoffman R,et al. Year: 2007Chromatin-modifying agents permit human hematopoietic stem cells to undergo multiple cell divisions while retaining their repopulating potential.Blood1093570357817185465 |
| 11. | Makino S,Fukuda K,Miyoshi S,Konishi F,Kodama H,et al. Year: 1999Cardiomyocytes can be generated from marrow stromal cells in vitro.J Clin Invest10369770510074487 |
| 12. | Asahara T,Masuda H,Takahashi T,Kalka C,Pastore C,et al. Year: 1999Bone marrow origin of endothelial progenitor cells responsible for postnatal vasculogenesis in physiological and pathological neovascularization.Circ Res8522122810436164 |
| 13. | Rajasingh J,Bord E,Hamada H,Lambers E,Qin G,et al. Year: 2007STAT3-dependent mouse embryonic stem cell differentiation into cardiomyocytes: analysis of molecular signaling and therapeutic efficacy of cardiomyocyte precommitted mES transplantation in a mouse model of myocardial infarction.Circ Res10191091817823373 |
| 14. | Rajasingh J,Lambers E,Hamada H,Bord E,Thorne T,et al. Year: 2008Cell-free Embryonic Stem Cell Extract-mediated derivation of Multipotent Stem Cells from NH3T3 Fibroblasts for Functional and Anatomical Ischemic Tissue Repair.Circ Res102e10711718483406 |
| 15. | Kishore R,Qin G,Luedemann C,Bord E,Hanley A,et al. Year: 2005The cytoskeletal protein ezrin regulates EC proliferation and angiogenesis via TNF-alpha-induced transcriptional repression of cyclin A.J Clin Invest1151785179615965500 |
| 16. | Kusano KF,Pola R,Murayama T,Curry C,Kawamoto A,et al. Year: 2005Sonic hedgehog myocardial gene therapy: tissue repair through transient reconstitution of embryonic signaling.Nat Med111197120416244652 |
| 17. | Iwakura A,Shastry S,Luedemann C,Hamada H,Kawamoto A,et al. Year: 2006Estradiol enhances recovery after myocardial infarction by augmenting incorporation of bone marrow-derived endothelial progenitor cells into sites of ischemia-induced neovascularization via endothelial nitric oxide synthase-mediated activation of matrix metalloproteinase-9.Circulation1131605161416534014 |
| 18. | Krishnamurthy P,Rajasingh J,Lambers E,Qin G,Losordo DW,et al. Year: 2009IL-10 Inhibits Inflammation and Attenuates Left Ventricular Remodeling After Myocardial Infarction via Activation of STAT3 and Suppression of HuR.Circ Res104e9e1819096025 |
| 19. | Nakayama J,Rice JC,Strahl BD,Allis CD,Grewal SIS. Year: 2001Role of Histone H3 Lysine 9 methylation in epigenetic control of heterochromatin assembly.Science29211011311283354 |
| 20. | Gupta R,Losordo DW. Year: 2010Challenges in; the translation of cardiovascular cell therapy.J Nucl Med51122S127S20395342 |
| 21. | Beitnes JO,Hopp E,Lunde K,Solheim S,Arnesen H,et al. Year: 2009Long-term results after intracoronary injection of autologous mononuclear bone marrow cells in acute myocardial infarction: the ASTAMI randomized, controlled study.Heart951983198919833610 |
| 22. | Schmidt-Lucke C,Rossig L,Fichtlscherer S,Vasa M,Britten M,et al. Year: 2005Reduced number of circulating endothelial progenitor cells predicts future cardiovascular events: proof of concept for the clinical importance of endogenous vascular repair.Circulation1112981298715927972 |
| 23. | Urbich C,Dimmeler S. Year: 2005Risk factors for coronary artery disease, circulating endothelial progenitor cells, and the role of HMG-CoA reductase inhibitors.Kidney Int6716721676 Review. 15840010 |
| 24. | Jenuwein T,Allis CD. Year: 2001Translating the histone code.Science29310741080 Review. 11498575 |
| 25. | Wu X,Li Y,Xue L,Wang L,Yue Y,et al. Year: 2010Multiple histone site epigenetic modifications in nuclear transfer and in vitro fertilized bovine embryos.Zygote8115 |
| 26. | Mali P,Chou BK,Yen J,Ye Z,Zou J,et al. Year: 2010Butyrate greatly enhances derivation of human induced pluripotent stem cells by promoting epigenetic remodeling and the expression of pluripotency-associated genes.Stem Cells2871372020201064 |
| 27. | Bui HT,Wakayama S,Kishigami S,Park KK,Kim JH,et al. Year: 2010Effect of trichostatin A on chromatin remodeling, histone modifications, DNA replication, and transcriptional activity in cloned mouse embryos.Biol Reprod8345446320505166 |
| 28. | Bird A. Year: 1999DNA methylation.Science2862287228810636791 |
| 29. | Shoemaker R,Wang W,Zhang K. Year: 2010Mediators and dynamics of DNA methylation.Wiley Interdiscip Rev Syst Biol Med328129820878927 |
| 30. | Han J,Sachdev PS,Sidhu KS. Year: 2010A combined epigenetic and non-genetic approach for reprogramming human somatic cells.PLoS One5e1229720808872 |
| 31. | Ng HH,Jeppesen P,Bird A. Year: 2000Active repression of methylated genes by the chromosomal protein MBD1.Mol Cell Biol41394140610648624 |
| 32. | Cheng X,Blumenthal RM. Year: 2010Coordinated chromatin control: structural and functional linkage of DNA and histone methylation.Biochemistry4929993008 Review. 20210320 |
| 33. | Lyko F. Year: 2001DNA methylation learns to fly.Trends Genet1716917211275305 |
| 34. | Fry CJ,Peterson CL. Year: 2001Chromatin remodeling enzymes: who's on first?Curr Biol11R18519711267889 |
| 35. | Curradi M,Izzo A,Badaracco G,Landsberger N. Year: 2002Molecular mechanisms of gene silencing mediated by DNA methylation.Mol Cell Biol223157317311940673 |
| 36. | Si J,Boumber YA,Shu J,Qin T,Ahmed S,et al. Year: 2010Chromatin remodeling is required for gene reactivation after decitabine-mediated DNA hypomethylation.Cancer Res706968697720713525 |
| 37. | Takahashi K,Tanabe K,Ohnuki M,Narita M,Ichisaka T,et al. Year: 2007Induction of pluripotent stem cells from adult human fibroblasts by defined factors.Cell13186187218035408 |
| 38. | Hansen JC,Tse C,Wolffe AP. Year: 1998Structure and function of the core histone N-termini: more than meets the eye.Biochemistry3717637176419922128 |
| 39. | Strahl BD,Allis CD. Year: 2000The language of covalent histone modifications.Nature403414510638745 |
| 40. | Shi Y,Matson C,Lan F,Iwase S,Baba T,et al. Year: 2005Regulation of LSD1 histone demethylase activity by its associated factors.Mol Cell1985786416140033 |
| 41. | Lan F,Nottke AC,Shi Y. Year: 2008Mechanisms involved in the regulation of histone lysine demethylases.Curr Opin Cell Biol3316325 Review. 18440794 |
| 42. | Huangfu D,Maehr R,Guo W,Eijkelenboom A,Snitow M,et al. Year: 2008Induction of pluripotent stem cells by defined factors is greatly improved by small-molecule compounds.Nat Biotechnol2679579718568017 |
| 43. | Yamashita T,Kawai H,Tian F,Ohta Y,Abe K. Year: 2010Tumorigenic Development of Induced Pluripotent Stem Cells in Ischemic Mouse Brain. Cell Transplant: Nov 5. [Epub ahead of print]. |
| 44. | Ieda M,Fu JD,Delgado-Olguin P,Vedantham V,Hayashi Y,et al. Year: 2010Direct reprogramming of fibroblasts into functional cardiomyocytes by defined factors.Cell14237538620691899 |
| 45. | Szabo E,Rampalli S,Risueño RM,Schnerch A,Mitchell R,et al. Year: 2010Direct conversion of human fibroblasts to multilineage blood progenitors.Nature46852152621057492 |
Figures
Tables
Table 1 Primers and Sequences.
| Primers used for qRT-PCR | |
| Gene name | Sequences |
| CTT | F: GACAGACTGGTCGGGAGATGA R: [gene: CCCCCATGTAGTCGATGTTCA] |
| C-Kit | F: TGGCTCTGGACCTG R: [gene: ACAATTCTTGGAGGCGAGGAA] |
| eNos | F: TCTGCGGCGATGTCACTATG R: [gene: CATGCCGCCCTCTGTTG] |
| Gata4 | F: GCGCCCCATCAAGACAGA R: [gene: GTGGCCGGACACAGTACTGA] |
| Nanog | F: GCTCAGCACCAGTGGAGTATCC R: [gene: TCCAGATGCGTTCACCAGATAG] |
| Nkx2.5 | F: CTTCAAGCAACAGCGGTACCT R: [gene: CGCTGTCGCTTGCACT] |
| Oct4 | F: TCGGACCAGGCTCAGAGGTA R: [gene: ATCCCTCCGCAGAACTCGTA] |
| Sox2 | F: AAACCAAGACGCTCATGAAGAAG R: [gene: CGCTCGCCATGCTGTTC] |
| VE-Cadherin | F: GTGGATGAGCCCCCTGTCT R: [gene: CAGCGGTTTCTTC] |
| Flk-1 | F: GAGCTCTCCGTGGATCTGAAA R: [gene: AACAAAGCCTGAG] |
| IL-10 | F: CAGCCGGGAAGACAATAACTG R: [gene: CCGCAGCTCTAGGAGCATGT] |
| IL-10R | F: TGTCTGTATGCAAAGCTTGGAAAT R: [gene: GTCTGTGCCCGCTTTCTCA] |
| TNF-α | F: GGCTGCCCCGACTACGT R: [gene: AGGTTGACTTTCTCCTGGTATGAGA] |
| MCP1 | F: CTTCCTCCACCACCATGCA R: CCAGCCGGC |
| IL-6 | F: TTCCATCCAGTTGCCTTCTTG R: [gene: GGGAGTGGTATCCTCTGTGAAGTC] |
| IL-1β | F: CTACAGGCTCCGAGATGAACAAC R: [gene: TCCATTGAGGTGGAGAGCTTTC] |
| Primers used for PCR | |
| eGFP (315 bp): | F: [gene: 5′- ATG GTG AGC AAG GGC GAG GAG CTG -3′] R: 5′[gene: - GCC GTC GTC CTT GAA GAA GAT GGT G] -3′ |
Article Categories:
|
|
Previous Document: Identification of RNF213 as a Susceptibility Gene for Moyamoya Disease and Its Possible Role in Vasc...
Next Document: Enzyme-linked immunosorbent assay-format tissue culture infectious dose-50 test for titrating dengue...









