| Improved production of biohydrogen in light-powered Escherichia coli by co-expression of proteorhodopsin and heterologous hydrogenase. | |
| | |
| Jump to Full Text | |
MedLine Citation:
|
PMID: 22217184 Owner: NLM Status: Publisher |
Abstract/OtherAbstract:
|
ABSTRACT: BACKGROUND: Solar energy is the ultimate energy source on the Earth. The conversion of solar energy into fuels and energy sources can be an ideal solution to address energy problems. The recent discovery of proteorhodopsin in uncultured marine gamma-proteobacteria has made it possible to construct recombinant Escherichia coli with the function of light-driven proton pumps. Protons that translocate across membranes by proteorhodopsin generate a proton motive force for ATP synthesis by ATPase. Excess protons can also be substrates for hydrogen (H2) production by hydrogenase in the periplasmic space. In the present work, we investigated the effect of the co-expression of proteorhodopsin and hydrogenase on H2 production yield under light conditions. RESULTS: Recombinant E. coli BL21(DE3) co-expressing proteorhodopsin and [NiFe]-hydrogenase from Hydrogenovibrio marinus produced ~1.3-fold more H2 in the presence of exogenous retinal than in the absence of retinal under light conditions (70 umole photon/(m2.s)). We also observed the synergistic effect of proteorhodopsin with endogenous retinal on H2 production (~1.3-fold more) with a dual plasmid system compared to the strain with a single plasmid for the sole expression of hydrogenase. The increase of light intensity from 70 to 130 umole photon/(m2.s) led to an increase (~1.8-fold) in H2 production from 287.3 to 525.7 mL H2/L-culture in the culture of recombinant E. coli co-expressing hydrogenase and proteorhodopsin in conjunction with endogenous retinal. The conversion efficiency of light energy to H2 achieved in this study was ~3.4%. CONCLUSION: Here, we report for the first time the potential application of proteorhodopsin for the production of biohydrogen, a promising alternative fuel. We showed that H2 production was enhanced by the co-expression of proteorhodopsin and [NiFe]-hydrogenase in recombinant E. coli BL21(DE3) in a light intensity-dependent manner. These results demonstrate that E. coli can be applied as light-powered cell factories for biohydrogen production by introducing proteorhodopsin. |
| | |
Authors:
|
Jaoon Y H Kim; Byung Hoon Jo; Younghwa Jo; Hyung Joon Cha |
Related Documents
:
|
18760214 - Tibiofemoral compression force differences using laxity- and force-based initial graft ... 15351444 - The relation between force magnitude, force steadiness, and muscle co-contraction in th... 10575644 - Normalized forces and active range of motion in unilateral radial epicondylalgia (tenni... 1420874 - Effect of small release on force during sarcomere-isometric tetani in frog muscle fibers. 9457514 - A computer-controlled system for measuring dark adaptation and other psychophysical fun... 18760214 - Tibiofemoral compression force differences using laxity- and force-based initial graft ... |
Publication Detail:
|
Type: JOURNAL ARTICLE Date: 2012-1-4 |
Journal Detail:
|
Title: Microbial cell factories Volume: 11 ISSN: 1475-2859 ISO Abbreviation: - Publication Date: 2012 Jan |
Date Detail:
|
Created Date: 2012-1-5 Completed Date: - Revised Date: - |
Medline Journal Info:
|
Nlm Unique ID: 101139812 Medline TA: Microb Cell Fact Country: - |
Other Details:
|
Languages: ENG Pagination: 2 Citation Subset: - |
Export Citation:
|
APA/MLA Format Download EndNote Download BibTex |
| MeSH Terms | |
Descriptor/Qualifier:
|
|
| Full Text | |
|
Journal Information Journal ID (nlm-ta): Microb Cell Fact Journal ID (iso-abbrev): Microb. Cell Fact ISSN: 1475-2859 Publisher: BioMed Central |
Article Information Download PDF ![]() Copyright ©2012 Kim et al; licensee BioMed Central Ltd. open-access: Received Day: 22 Month: 12 Year: 2011 Accepted Day: 4 Month: 1 Year: 2012 collection publication date: Year: 2012 Electronic publication date: Day: 4 Month: 1 Year: 2012 Volume: 11First Page: 2 Last Page: 2 ID: 3311610 Publisher Id: 1475-2859-11-2 PubMed Id: 22217184 DOI: 10.1186/1475-2859-11-2 |
| Improved production of biohydrogen in light-powered Escherichia coli by co-expression of proteorhodopsin and heterologous hydrogenase | |
| Jaoon YH Kim1 | Email: jaoon@postech.ac.kr |
| Byung Hoon Jo2 | Email: animanga@postech.ac.kr |
| Younghwa Jo1 | Email: jyh0715@postech.ac.kr |
| Hyung Joon Cha12 | Email: hjcha@postech.ac.kr |
|
1Department of Chemical Engineering, Pohang University of Science and Technology, Pohang 790-784, Korea |
|
|
2School of Interdisciplinary Bioscience and Bioengineering, Pohang University of Science and Technology, Pohang 790-784, Korea |
|
Since the Industrial Revolution, energy consumption has increased exponentially and most energy has been derived from fossil fuels. Currently, we still depend on fossil fuels for more than 80 percent of our demands for electricity, transportation, and industries, although concerns about the exhaustion of fossil fuels and global warming have led to increased attention to renewable energy [1]. Among various renewable energy sources, solar energy is the most abundant and ultimate source. The total amount of solar energy absorbed by the Earth's surface is 1.74 × 105 terawatts (TW) [2], which is a tremendous amount compared to the world's energy consumption (~13 TW) [1]. Thus, the conversion of solar energy to fuels may constitue the most sustainable way to solve the energy crisis.
In the field of biotechnology, the photosynthetic process in algae and cyanobacteria has been actively investigated for the conversion of solar energy to useful biofuels [3-5]. Photosynthesis requires a highly complex photosystem composed of numerous proteins and photosynthetic enzymes, such as Rubisco [1]. In addition, many challenges still remain for engineering photosynthetic microorganisms [1,6]. Recently, a new type of rhodopsin, called proteorhodopsin, was discovered in the metagenome of uncultured marine γ-proteobacteria [7]. Proteorhodopsin can be heterologously expressed in Escherichia coli to possess proton-pumping activity [7], which is different from bacteriorhodopsin found in halobacteria [1,8]. This property of proteorhodopsin enables the investigation of its impact on cellular energy and phototrophy [8]. There have also been reports of the enhancement of cell viability or growth via light-driven proton pumping by proteorhodopsin under nutrient-limited conditions [9-11]. However, there have been no substantial applications in biofuel production using proteorhodopsin, although this potential has been mentioned recently [1].
Hydrogen (H2) has been recognized as one promising alternative energy source to fossil fuels. It does not emit carbon dioxide during combustion and can be easily converted to electricity using fuel cells. In addition, it has a higher energy density than other energy sources. Although the current production of H2 mainly depends on thermochemical methods using fossil fuels [12], biological approaches have been actively investigated to generate H2 in a more sustainable manner [13-17]. Among them, photobiological H2 production has attracted great attention due to its eco-friendly properties, such as its usage of solar energy and carbon assimilation. Nevertheless, there are still many obstacles to overcome, including slow cell growth, the low conversion efficiency of light to H2, the inhibitory effect of oxygen on hydrogenase activity, and others [16,17].
E. coli has been used widely as a cell factory for many types of bio-products (including biofuels), but it cannot utilize light energy. Therefore, constructing E. coli capable of absorbing light energy and converting it to other biofuels through the introduction of proteorhodopsin might increase biofuel production efficiency. It has been shown that protons generated by rhodopsin can migrate along the membrane surface [18] and thus, they can act as substrates of hydrogenase for H2 evolution. Thus, in the present work, for the first time (to our knowledge), we introduced proteorhodopsin into E. coli, generating bacteria capable of utilizing light and investigated its effect on H2 production yield using the previously constructed recombinant E. coli expressing Hydrogenovibrio marinus-originated [NiFe]-hydrogenase [15].
E. coli does not have an intrinsic ability to absorb light energy. We constructed a plasmid, pACYC-RDS including 6 genes (crtE, B, I, Y, b-diox, and pR), that are required for the functional heterologous expression of proteorhodopsin in E. coli (Figure 1). The recombinant E. coli BL21(DE3) harboring pACYC-RDS was cultured, and protein expression was induced under exposure to 70 μmol photon/(m2·s) light. From the harvested cell pellet, we observed that the cells expressing proteorhodopsin with endogenous retinal have a distinctively reddish color compared to wild-type cells (Figure 2A). In addition, we confirmed that the membrane fraction, including recombinant proteorhodopsin (generated by the expression of a single pR gene), absorbs light at a specific wavelength of 520 nm in the presence of exogenous retinal, indicating the functional expression of recombinant proteorhodopsin in E. coli (Figure 2B).
After confirmation of proteorhodopsin function in recombinant E. coli, we investigated the effect of co-expressing proteorhodopsin and H. marinus [NiFe]-hydrogenase on H2 production. We used two kinds of expression systems: a single plasmid system of pET-HmH/pR (without endogenous retinal) and a dual plasmid system of pET-HmH and pACYC-RDS (with endogenous retinal) (Figure 1). E. coli BL21(DE3) transformed with pET-HmH/pR or cotransformed with pET-HmH and pACYC-RDS was cultured in 125 mL serum bottles under exposure to 70 μmol photon/(m2·s) light. We found that E. coli with pET-HmH/pR produced more H2 after retinal addition under light than the cells without retinal (Figure 3A). This result indicates that the gained function of recombinant proteorhodopsin by the addition of retinal has a synergistic effect on H2 production with the heterologous expression of hydrogenase. A negative control strain containing the parent vector (pET-21b) did not produce H2 under the same conditions. Using the dual plasmid system for endogenous retinal biosynthesis, we also observed similar results (Figure 3B). The BL21(DE3) strain with the dual plasmid system (pET-HmH and pACYC-RDS) also produced ~1.3-fold more H2 compared to the strain expressing hydrogenase (pET-HmH) alone. Although the strain harboring two plasmids showed lower H2 production than the strain expressing only hydrogenase at 12 h, its production rapidly increased and surpassed the H2 production of the hydrogenase-only strain after 19 h (Figure 3B).
To investigate the effect of light energy on H2 production by the co-expression of proteorhodopsin and hydrogenase, light intensity was changed during the culture. We increased light intensity from 70 μmole photon/(m2·s) to 130 μmole photon/(m2·s) at the middle part of culture bottles by changing the light source from two 20 W fluorescent lamps to two 30 W fluorescent lamps. We observed that the cells cultured at a light intensity of 130 μmole photon/(m2·s) produced more H2 than those cultured at 70 μmole photon/(m2·s) (Figure 4). At 24 h after induction, the cells grown under 130 μmole/(m2·s) light produced 184 ± 8.9 mL H2 while cells grown under 70 μmole photon/(m2·s) light produced 100.5 ± 0.8 mL H2, corresponding to yields of 525.7 ± 25.4 mL H2/L-culture and 287.3 ± 2.1 mL H2/L-culture, respectively. A production rate of 21.9 mL H2/(L-culture·h) was achieved from the culture for 24 h at a light intensity of 130 μmole photon/(m2·s). Cell growth was similar between the two cultures under different light conditions (data not shown). This indicated that improved H2 production (0.0835 L H2, equivalent to 0.902 kJ) was derived from enhanced light energy (60 μmole photon/(m2·s) for 24 h, equivalent to 26.579 kJ). Thus, we might determine that the conversion efficiency of light energy to H2 was ~3.4% in the present work using recombinant E. coli BL21 expressing both proteorhodopsin and H. marinus [NiFe]-hydrogenase.
E. coli is a chemotroph that cannot utilize light energy. Bacteriorhodopsins, including proteorhodopsin, are the simplest molecules that enable microorganisms to utilize solar energy to create a proton gradient and generate ATP. In addition, protons translocated by rhodopsin can migrate along the membrane [18] and might be substrates of hydrogenase for the evolution of H2 (Figure 5). Thus, we tried to convert light energy to H2 by exploiting the light-driven proton-pumping function of proteorhodopsin in recombinant E. coli expressing hydrogenase.
We observed functional expression of proteorhodopsin in the recombinant E. coli BL21(DE3) and thus investigated the effect of co-expressing proteorhodopsin and H. marinus [NiFe]-hydrogenase on H2 production. Using a single plasmid system expressing both hydrogenase and proteorhodopsin without biosynthesis of endogenous retinal, we found that H2 production was improved by ~29% in the presence of added retinal under light. This indicates that proteorhodopsin function, gained with exogenous retinal, provided a synergistic effect on H2 production through the supplementation of protons. Similarly to the single plasmid system, we also observed a positive effect of proteorhodopsin using a dual plasmid system. H2 production levels of cells co-expressing hydrogenase, proteorhodopsin, and retinal synthesis proteins was ~1.3-fold higher at the final time point than that of the cells expressing only hydrogenase. It is noteworthy that H2 production from the strain co-expressing proteorhodopsin and hydrogenase quickly surpassed H2 production from the strain expressing only hydrogenase at a late phase. This retarded H2 production profile of the dual plasmid system might be attributed to the metabolic burden caused by the over-expression of multiple proteins required for the biosynthesis of retinal and proteorhodopsin.
Because the function of proteorhodopsin is driven by the absorption of light energy, light intensity can be a key factor for H2 production. We found that the H2 production from cells co-expressing hydrogenase and proteorhodopsin with endogenous retinal is strongly dependent on light intensity. Increasing the light intensity from 70 μmole photon/(m2·s) to 130 μmole photon/(m2·s) increased H2 production yield ~1.8-fold. However, cell growth was not different in the two cultures under different light conditions. This tendency was consistent with a previous report that proteorhodopsin contributes to cell growth only under nutrient-limited conditions [9]. Thus, this indicates that H2 production was improved by the absorption of enhanced light energy through the proton-pumping function of proteorhodopsin. In the present study, it seems that the reduction from proton to H2 mediated by hydrogenase generates additional proton gradient, driving proteorhodopsin to pump protons, the substrates for hydrogenase. When we calculated the production rate per culture volume (21.9 mL H2/(L-culture·h)) and the conversion efficiency of light energy to H2 (~3.4%), the levels achieved in this study were comparable to the results of photobiological hydrogen production in previous studies: H2 production rate in green algae, 0.048-4.48 mL H2/(L-culture·h), cyanobacteria, 4.03-13 mL H2/(L-culture·h), photosynthetic bacteria, 7.6-131 mL H2/(L-culture·h), and light conversion efficiency in photoautotrophs, 3-10% with removal of O2 or 1-2%, and photoheterotrophs, 0.308-9.23%) [17,19]. Although cell growth was mainly supported by exogenous nutrients in this system, these results are quite meaningful for the development of an E. coli system that can utilize light energy as a supplementary source.
Here, we demonstrated the substantial application of proteorhodopsin for light-driven biohydrogen production in a recombinant E. coli system. E. coli engineered to express H. marinus [NiFe]-hydrogenase and proteorhodopsin produced more H2 with the existence of retinal under light conditions. Engineered strains also produced more H2 as light intensity increased, although there was no difference in cell growth. These results suggest that our system works for converting light energy to H2 via the cooperation of proteorhodopsin and hydrogenase. In addition, engineering E. coli as light-powered cell factories could provide a solution for developing potential strategies for photobiological H2 production.
E. coli Top10 (Invitrogen, USA) was used for the manipulation and cloning of target genes. E. coli BL21(DE3) (Novagen, USA) was used for expression of recombinant proteins. We used LB medium including proper antibiotics (50 μg/mL ampicillin and 30 μg/mL chloramphenicol) for genetic manipulation. For protein expression, 1 mM (as a final concentration) of isopropyl-β-D-thiogalactopyranoside (IPTG; BioBasic, Canada) was added to each culture medium. For in vivo H2 production, cells were grown in M9 minimal medium (6 g/L Na2HPO4, 3 g/L KH2PO4, 1 g/L NH4Cl, 0.5 g/L NaCl, and 1 mg/L thiamine supplemented with 240.73 mg/L MgSO4, 11.09 mg/L CaCl2) including 5 g/L casamino acids and 5 g/L glucose. 0.1 M of FeSO4 and 1 M of NiSO4 solutions were added to M9 medium at a concentration of 30 μM for the functional expression of H. marinus [NiFe]-hydrogenase. All cultures were maintained under normal aerobic or micro-aerobic conditions [14]. Cells were grown in serum bottles (125 or 500 mL; Wheaton, USA) sealed with rubber stoppers and aluminum capping at 37°C in an air-shaking incubator (Jeiotech, Korea) at a gyration rate of 200-230 rpm. For the assessment of the functional activity of proteorhodopsin, cells were irradiated by 20 W or 30 W fluorescent lamps. The light intensity (400-700 nm) at a given location in the culture was measured using a light meter (Apogee, USA) in units of μmol photon/(m2·s).
For the expression of proteorhodopsin in E. coli BL21(DE3), four genes (Erwinia uredovora crt E, B, I, Y; Genbank: D90087) for β-carotene synthesis and β-diox gene for the conversion of β-carotene to retinal (mouse β-carotene-15,15'-dioxygenase; Genbank: AF271298) were obtained from pORANGE and β-plasmid (a kind gift from Dr. J. von Lintig), respectively [20]. pR gene coding for proteorhodopsin (Genbank: AF279106) was also obtained from BAC clone EBAC31A08 (a kind gift from Dr. E. Delong) [7]. All six genes above were amplified by polymerase chain reaction (PCR) using the primers in Table 1 and cloned into the pACYCDuet-1 (Novagen) vector to construct pACYC-RDS (Figure 1), which is compatible with the pET vector. For the expression of H. marinus [NiFe]-hydrogenase genes, the pET-HmH vector was used [15]. To analyze the effect of functional proteorhodopsin with retinal, the proteorhodopsin gene (pR), without the genes for retinal synthesis, was cloned into the pET-HmH vector to construct pET-HmH/pR (Figure 1).
H2 gas produced in cell culture was obtained from the headspace of a sealed serum bottle (125 or 500 mL). Usually, 20-100 μL of the gas sample was analyzed using a gas chromatograph (GC; Younglin Instrument, Korea) equipped with a carboxen-1010 PLOT column (0.53 mm × 30 m, Supelco, USA) and pulsed discharge detector (Valco Instrument, USA). Elution was performed using helium as a carrier gas at a flow rate of 10 mL/min, and the temperatures of the injector, detector, and oven were set to 130, 250, and 100°C, respectively. The H2 concentration in the gas sample was calculated using a standard curve. The H2 amount was determined based on the H2 concentration and gas volume of headspace (including expanded volume).
The absorption spectrum of cells expressing proteorhodopsin was measured using spectrophotometry [7]. To prepare crude membrane fractions, recombinant E. coli were harvested by centrifugation at 4°C and 4,000 rpm for 15 min. The cell pellet was resuspended in 50 mM Tris-Cl (pH 6.8) and disrupted with a sonic dismembrator (Fisher Scientific, USA) for 10 min at 50% power (5 sec pulse on and 2 sec pulse off). The disrupted cell suspension (total cell lysate) was centrifuged at 4°C and 10,000 g for 20 min. The resultant supernatant (crude extract) was centrifuged at 4°C and 120,000 g for 120 min. The pellet was resuspended in 50 mM Tris-Cl (pH 8.0) and 5 mM MgCl2, which is regarded as the crude membrane. The absorption spectrum was measured at spectrum mode using a spectrophotometer (Shimadzu, Japan) after the addition of 20 μM of all-trans-retinal (Sigma).
The conversion efficiency of light energy to H2 was calculated using the following equation: conversion efficiency (%) = (H2 production amount × H2 energy content)/absorbed light energy × 100, where H2 energy content = 10.8 kJ/L (lower heating value of H2) [19]. Absorbed light energy was calculated using the equation absorbed light energy (kJ/s) = 0.2176 IoSA, where Io = incident light intensity (μmol/(m2·s) measured by light meter, and SA = illuminated surface area (m2) = π × d × h (d = 0.075 m, h = 0.1 m for the culture in a 500 mL serum bottle) [21].
The authors declare that they have no competing interests.
JYHK and HJC designed research. JYHK, BHJ, and YJ performed and analyzed biohydrogen production in recombinant E. coli. JYHK and HJC wrote the paper. All authors have read and approved the final version of the manuscript.
This work was supported by the Manpower Development Program for Marine Energy funded by the Ministry of Land, Transport and Maritime Affairs, Korea and the National Research Foundation Grant (NRF-2009-0093214) and the Brain Korea 21 Program funded by the Ministry of Education, Science and Technology, Korea. We thank Dr. Johannes von Lintig (Case Western Reserve Univ.) and Dr. Edward DeLong (MIT) for their gifts of plasmids.
References
| Walter JM,Greenfield D,Liphardt J,Potential of light-harvesting proton pumps for bioenergy applicationsCurr Opin BiotechnolYear: 20102126527010.1016/j.copbio.2010.03.00720371172 | |
| Bhattacharya S,Schiavone M,Nayak A,Bhattacharya SK,Biotechnological storage and utilization of entrapped solar energyAppl Biochem BiotechnolYear: 200512015916710.1385/ABAB:120:3:15915767690 | |
| Atsumi S,Liao JC,Direct photosynthetic recycling of carbon dioxide to isobutyraldehydeNat BiotechnolYear: 2009271177118010.1038/nbt.158619915552 | |
| Hu Q,Sommerfeld M,Jarvis E,Ghirardi M,Posewitz M,Seibert M,Darzins A,Microalgal triacylglycerols as feedstocks for biofuel production: perspectives and advancesThe Plant JYear: 20085462163910.1111/j.1365-313X.2008.03492.x | |
| Eroglu E,Melis A,Photobiological hydrogen production: recent advances and state of the artBioresour TechnolYear: 20111028403841310.1016/j.biortech.2011.03.02621463932 | |
| Beer LL,Boyd ES,Peters JW,Posewitz MC,Engineering algae for biohydrogen and biofuel productionCurr Opin BiotechnolYear: 2009202647110.1016/j.copbio.2009.06.00219560336 | |
| Béjà O,Aravind L,Koonin EV,Suzuki MT,Hadd A,Nguyen LP,Jovanovich SB,Gates CM,Feldman RA,Spudich JL,Spudich EN,DeLong EF,Bacterial rhodopsin: evidence for a new type of phototrophy in the seaScienceYear: 20002891902190610.1126/science.289.5486.190210988064 | |
| DeLong EF,Béjà O,The light-driven proton pump proteorhodopsin enhances bacterial survival during tough timesPLoS BiolYear: 20108e100035910.1371/journal.pbio.100035920436957 | |
| Gomez-Consarnau L,Gonzalez JM,Coll-Llado M,Gourdon P,Pascher T,Neutze R,Pedros-Alio C,Pinhassi J,Light stimulates growth of proteorhodopsin-containing marine FlavobacteriaNatureYear: 200744521021310.1038/nature0538117215843 | |
| Walter JM,Greenfield D,Bustamante C,Liphardt J,Lightpowering Escherichia coli with proteorhodopsinProc Natl Acad Sci USAYear: 20071042408241210.1073/pnas.061103510417277079 | |
| Johnson ET,Baron DB,Naranjo B,Bond DR,Schmidt-Dannert C,Gralnick JA,Enhancement of survival and electricity production in an engineered bacterium by light-driven proton pumpingAppl Environ MicrobiolYear: 2010764123412910.1128/AEM.02425-0920453141 | |
| Park JH,Lee D,Lee HC,Park ED,Steam reforming of liquid petroleum gas over Mn-promoted Ni/γ-Al2O3 catalystsKorean J Chem EngYear: 2010271132113810.1007/s11814-010-0212-9 | |
| Kim JYH,Jung HJ,Cha HJ,Universal degenerate oligonucleotide-primed polymerase chain reaction for detection and amplification of NiFe-hydrogenase genesEnzyme Microb TechnolYear: 2007421510.1016/j.enzmictec.2007.07.011 | |
| Kim JYH,Jo BH,Cha HJ,Production of biohydrogen by recombinant expression of [NiFe]-hydrogenase 1 in Escherichia coliMicrobial Cell FactYear: 201095410.1186/1475-2859-9-54 | |
| Kim JYH,Jo BH,Cha HJ,Production of biohydrogen by heterologous expression of oxygen-tolerant Hydrogenovibrio marinus [NiFe]-hydrogenase in Escherichia coliJ BiotechnolYear: 201115531231910.1016/j.jbiotec.2011.07.00721794837 | |
| McKinlay JB,Harwood CS,Photobiological production of hydrogen gas as a biofuelCurr Opin BiotechnolYear: 20102124425110.1016/j.copbio.2010.02.01220303737 | |
| Dasgupta CN,Gilbert J,Lindblad P,Heidorn T,Borgvang SA,Skjanes K,Das D,Recent trends on the development of photobiological processes and photobioreactors for the improvement of hydrogen productionInt J of Hydrogen EnergYear: 2011351021810238 | |
| Heberle J,Riesle J,Thiedemann G,Oesterhelt D,Dencher NA,Proton migration along the membrane surface and retarded surface to bulk transferNatureYear: 199437037938410.1038/370379a08047144 | |
| Akkerman I,Janssenb M,Rochac J,Wijlels RH,Photobiological hydrogen production: photochemical efficiency and bioreactor designInt J Hydrogen EnergYear: 2002271195120810.1016/S0360-3199(02)00071-X | |
| Von Lintig J,Vogt K,Filling the gap in vitamin A research. Molecular identification of an enzyme cleaving β-carotene to retinalJ Biol ChemYear: 2000275119151192010.1074/jbc.275.16.1191510766819 | |
| Ogbonna JC,Yada H,Masui H,Tanaka H,A Novel internally illuminated stirred tank photobioreactor for large-scale cultivation of photosynthetic cellsJ Ferment BioengYear: 199682616710.1016/0922-338X(96)89456-6 |
Figures
Tables
Primer sequences for amplification of genes related to β-carotene synthesis, retinal synthesis, and proteorhodopsin
| Primer name | Sequence (5'→3') (___: ribosome binding site,:___restriction site) |
|---|---|
| crtE forward | GCCCATGGATGACGGTCTGCGCAAAAAAACACG |
|
|
|
| crtE reverse | GCGAATTCTTAACTGACGGCAGCGAGTTTTTTG |
|
|
|
| crtB forward | CCGAATTCAAGGAGATATACCAATGAATAATCCGTCGTTACT CAATCATGC |
|
|
|
| crtB reverse | CGGTCGACCTAGAGCGGGCGCTGCCAGAG |
|
|
|
| crtI forward | CCGTCGACAAGGAGATATACAAATGAAACCAACTACGGTAAT TG |
|
|
|
| crtI reverse | CGAAGCTTTCATATCAGATCCTCCAGCATC |
|
|
|
| crtY forward | CCAAGCTTGAAGGAGATATACCAATGCAACCGCACTATGATC TGATTCTC |
|
|
|
| crtY reverse | GCCTTAAGTTAGCGATGAGTCGTCATAATGGC |
|
|
|
| β-diox forward | GGAGATCTAAGGAGATATACATATGGAGATAATATTTGGCCA GAATAAG |
|
|
|
| β-diox reverse | CCGGTACCTTAAAGACTTGAGCCACCATGACCC |
|
|
|
| pR forward | CCGGTACCAAGGAGATATACAAATGGGTAAATTATTACTGAT ATTAGGTAG CCGCGGCCGCAAGGAGATATACAAATGGGTAAATTATTACTGAT ATTAGGTAG |
|
|
|
| pR reverse | GCCTCGAGTTAAGCATTAGAAGATTCTTTAACAGCAAC |
Article Categories:
Keywords: biohydrogen, Escherichia coli, proteorhodopsin, light-driven proton pump, light-powered cell factory. |
|
Previous Document: Altered networks in bothersome tinnitus: a functional connectivity study.
Next Document: Hearing outcome of recurrent sudden deafness: Ipsilateral versus contralateral types.
