| Identification and functional analysis of the genes encoding Delta6-desaturase from Ribes nigrum. | |
| | |
| Jump to Full Text | |
MedLine Citation:
|
PMID: 20231328 Owner: NLM Status: MEDLINE |
Abstract/OtherAbstract:
|
Gamma-linolenic acid (gamma-linolenic acid, GLA; C18:3 Delta(6, 9, 12)) belongs to the omega-6 family and exists primarily in several plant oils, such as evening primrose oil, blackcurrant oil, and borage oil. Delta(6)-desaturase is a key enzyme involved in the synthesis of GLA. There have been no previous reports on the genes encoding Delta(6)-desaturase in blackcurrant (Ribes nigrum L.). In this research, five nearly identical copies of Delta(6)-desaturase gene-like sequences, named RnD8A, RnD8B, RnD6C, RnD6D, and RnD6E, were isolated from blackcurrant. Heterologous expression in Saccharomyces cerevisiae and/or Arabidopsis thaliana confirmed that RnD6C/D/E were Delta(6)-desaturases that could use both alpha-linolenic acids (ALA; C18:3 Delta(9,12,15)) and linoleic acid (LA; C18:2 Delta(9,12)) precursors in vivo, whereas RnD8A/B were Delta(8)-sphingolipid desaturases. Expression of GFP tagged with RnD6C/D/E showed that blackcurrant Delta(6)-desaturases were located in the mitochondrion (MIT) in yeast and the endoplasmic reticulum (ER) in tobacco. GC-MS results showed that blackcurrant accumulated GLA and octadecatetraenoic acids (OTA; C18:4 Delta(6,9,12,15)) mainly in seeds and a little in other organs and tissues. RT-PCR results showed that RnD6C and RnD6E were expressed in all the tissues at a low level, whereas RnD6D was expressed at a high level only in seeds, leading to the accumulation of GLA and OTA in seeds. This research provides new insights to our understanding of GLA synthesis and accumulation in plants and the evolutionary relationship of this class of desaturases, and new clues as to the amino acid determinants which define precise enzyme activity. |
| | |
Authors:
|
Li-Ying Song; Wan-Xiang Lu; Jun Hu; Yan Zhang; Wei-Bo Yin; Yu-Hong Chen; Shan-Ting Hao; Bai-Lin Wang; Richard R-C Wang; Zan-Min Hu |
Related Documents
:
|
3217958 - Reduction of 3 alpha-hydroxy-5 beta-chol-6-en-24-oic acid to lithocholic acid in rats. 7937978 - Indigeneity of organic matter in fossils: a test using stable isotope analysis of amino... 15549788 - Synthesis, basicity, and dynamics of a perfluorocyclohexenyl anion. 7648198 - Conversion of aldonic acids to their corresponding 2-keto-3-deoxy-analogs by the non-ca... 19418488 - Are nociceptin(1-13)nh2 and its structural analogue [orn(9)]nociceptin(1-13)nh2 able to... 10826498 - Regulation by carnitine of myocardial fatty acid and carbohydrate metabolism under norm... |
Publication Detail:
|
Type: Journal Article; Research Support, Non-U.S. Gov't Date: 2010-03-15 |
Journal Detail:
|
Title: Journal of experimental botany Volume: 61 ISSN: 1460-2431 ISO Abbreviation: J. Exp. Bot. Publication Date: 2010 Jun |
Date Detail:
|
Created Date: 2010-04-13 Completed Date: 2010-07-01 Revised Date: 2010-09-30 |
Medline Journal Info:
|
Nlm Unique ID: 9882906 Medline TA: J Exp Bot Country: England |
Other Details:
|
Languages: eng Pagination: 1827-38 Citation Subset: IM |
Affiliation:
|
Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing 100101, China. |
Export Citation:
|
APA/MLA Format Download EndNote Download BibTex |
| MeSH Terms | |
Descriptor/Qualifier:
|
Amino Acid Sequence Fatty Acid Desaturases / chemistry, genetics, metabolism* Gas Chromatography-Mass Spectrometry Molecular Sequence Data Plants, Genetically Modified / enzymology*, genetics, metabolism Ribes / enzymology*, genetics, metabolism Sequence Homology, Amino Acid Tobacco / enzymology, genetics, metabolism |
| Chemical | |
Reg. No./Substance:
|
EC 1.14.19.-/Fatty Acid Desaturases |
| Comments/Corrections | |
| Full Text | |
|
Journal Information Journal ID (nlm-ta): J Exp Bot Journal ID (hwp): jexbot Journal ID (publisher-id): exbotj ISSN: 0022-0957 ISSN: 1460-2431 Publisher: Oxford University Press |
Article Information Download PDF ![]() ? 2010 The Author(s). open-access: Received Day: 5 Month: 12 Year: 2009 Revision Received Day: 9 Month: 2 Year: 2010 Accepted Day: 16 Month: 2 Year: 2010 Print publication date: Month: 6 Year: 2010 Electronic publication date: Day: 15 Month: 3 Year: 2010 pmc-release publication date: Day: 15 Month: 3 Year: 2010 Volume: 61 Issue: 6 First Page: 1827 Last Page: 1838 ID: 2852672 PubMed Id: 20231328 DOI: 10.1093/jxb/erq051 |
| Identification and functional analysis of the genes encoding ?6-desaturase from Ribes nigrum? | |
| Li-Ying Song15 | |
| Wan-Xiang Lu12 | |
| Jun Hu1 | |
| Yan Zhang1 | |
| Wei-Bo Yin1 | |
| Yu-Hong Chen1 | |
| Shan-Ting Hao1 | |
| Bai-Lin Wang3 | |
| Richard R-C Wang4? | |
| Zan-Min Hu1* | |
|
1Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing 100101, China |
|
|
2College of Horticulture and Landscape Architecture, Southwest University, Chongqing 400716, China |
|
|
3Horticulture Division, Heilongjiang Agriculture Academy, Harbin 150069, China |
|
|
4USDA-ARS, FRRL, Utah State University, Logan, UT 84322-6300, USA |
|
|
5Graduate University of Chinese Academy of Sciences, Beijing 100049, PR China |
|
| *To whom correspondence should be addressed: zmhu@genetics.ac.cn ?This work was carried out at the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China. GenBank accession numbers: RnD8A, GU198924; RnD8B, GU198925; RnD8C, GU198926; RnD8D, GU198927; RnD8E, GU198928. |
|
Gamma-linolenic acid (?-linolenic acid, GLA; C18:3, ?6,9,12) is an essential fatty acid (EFA) of the omega-6 family and exists primarily in a few plant-based oils, such as evening primrose oil, blackcurrant oil, and borage oil (Sayanova et al., 1997; Das, 2006). GLA was also found in considerable quantities in Spirulina, a cyanobacterium (Subudhi et al., 2008), some species of Primula (Sayanova et al., 1999a), and fungi (Sperling et al., 2000; Na-Ranong et al., 2005). However, there is no GLA in the major oil crops (Reddy and Thomas, 1996; Sayanova et al., 1999b), such as oilseed rape, soybean, peanut, and palm. GLA may be helpful in the prevention and/or treatment of diabetes, eye disease, osteoporosis, premenstrual syndrome (PMS), eczema, allergies, rheumatoid arthritis, high blood pressure, and heart disease (Horrobin, 1992).
?6-desaturase is classified as an acyl-lipid desaturase that introduces a double bond between the pre-existing double bond and the carboxyl (front) end of the fatty acid (Qi et al., 2004). It is critical for the metabolic conversion of linoleic acid (LA; C18:2 ?9,12) and ?-linolenic acids (ALA; C18:3 ?9,12,15) into GLA and octadecatetraenoic acids (OTA; C18:4 ?6,9,12,15), respectively (Horrobin, 1992; Reddy and Thomas, 1996). The cytochrome b5 (Cyt b5) domain is essential for the borage ?6-desaturase (Sayanova et al., 1999b), and three conserved His boxes of the enzyme are also proved to be essential for its function (Sayanova et al., 2001).
In the last 20 years, a number of ?6-desaturase genes, from cyanobacterium (Reddy et al., 1993), fungi (Sakuradani and Shimizu, 2003), plants (Sayanova et al., 1997, 1999a; Sperling et al., 2000; Whitney et al., 2003), and animals (Napier et al., 1998; Seiliez et al., 2001), were isolated and characterized. Accumulation, function, and expression of ?6-desaturase genes had been investigated in only a few higher plants synthesizing GLA. In Borago officinalis, GLA is accumulated up to 23.1% of the total fatty acids in mature seeds, and more than 8.0% in other tissues. The ?6-desaturase gene is expressed but at different levels in all tissues: higher in seeds, young leaves, and roots, and lower in mature leaves and flowers (Sayanova et al., 1999c). In Anemone leveillei, GLA and OTA are absent in seeds, but are readily detectable in leaves. The ?6-desaturase gene is expressed at the highest level in leaves, a moderate level in seeds, and is completely absent in roots (Whitney et al., 2003). In Primula, different species accumulated varying levels of GLA and OTA. In the species with a high level of ?6-fatty acids, GLA and OTA accumulated mainly in the leaves and seeds, and relatively little in roots (Sayanova et al., 1999a).
It was recently reported that there were two nearly identical copies of the ?6-desaturase gene, which differ by nine silent mutations, in the marine microalga Glossomastix chrysoplasta (Hsiao et al., 2007). While, in the higher plants that had been investigated, there were no instances of several different active ?6-desaturase genes being found in the same organism.
?6-desaturases from some organisms exhibited substrate selectivity. The ?6-desaturase of moss (Ceratodon purpureus) preferred C16:1 ?9 over C18:1 ?9 (Sperling et al., 2000), whereas the ?6-desaturase from Mucor rouxii had a strong preference for the C18:1 ?9 (Na-Ranong et al., 2005). In Boraginaceae, the ?6-desaturase from Macaronesian Echium gentianoides preferred the LA substrate over the ALA substrate (Garc?a-Maroto et al., 2006). ?6-desaturases from different Primula species had different substrate preferences; for example, the ?6-desaturase from Primula vialii had a very strong preference for ALA compared with LA (Sayanova et al., 2003), whereas that from Primula cortusoides mainly desaturated LA (Sayanova et al., 2006).
The fatty acid-synthesizing and desaturation system had been widely known to exist in chloroplasts and the endoplasmic reticulum (ER) in higher plants. It had been confirmed by using the [14C]linoleoyl phosphatidylcholine that the microsomal membrane, prepared from the developing cotyledons, contained an active ?6-desaturase, which catalysed the conversion of linoleate into ?-linolenate (Stymne and Stobart, 1986). Since then, front-end desaturases were generally thought to locate in the ER (Napier et al., 1999). To date, however, there has been no direct evidence for subcellular localization to locate plant ?6-desaturases.
Blackcurrant seed oil, typically containing 15?20% GLA, is known to be one of the available natural sources of GLA (Traifler et al., 1988). However, until now, the ?6-desaturase blackcurrant gene has not been reported.
In this research, GLA was detected mainly in seeds and rarely in other organs of blackcurrant. Three genes were cloned (RnD6C, RnD6D, and RnD6E) encoding ?6-desaturases and two genes (RnD8A, RnD8B) encoding ?8-sphingolipid desaturases in blackcurrant. RnD6C, RnD6D, and RnD6E could use both LA and ALA as substrate. RnD6C/D/E was located in the mitochondrion (MIT) in yeast and the ER in tobacco. RnD6C and RnD6E were expressed in all the tissues at a low level, whereas RnD6D was expressed at a high level but only in seeds. This research should provide a useful addition to the previously identified orthologues from other plants and may well prove to be useful for biotechnological applications. Furthermore, this research may also provide not only new insights into the evolutionary relationship of this class of desaturases but also some new clues as to the amino acid determinants which define the precise enzyme activity (i.e. either ?6-desaturase or ?8-sphingolipid desaturase).
Blackcurrant (Ribes nigrum L. var. BR?DTORP), a Finnish variety (Wassenaar and Hofman, 1966) was used in this research.
Genomic DNA was extracted by a DNA extraction kit (Biomed-tech, Beijing, China) from young leaves of blackcurrant. The DNA fragments of putative cytochrome b5 fusion desaturase genes were amplified from the genomic DNA by using degenerated primers designed according to the sequence of conserved histidine boxes of known Cyt b5 fusion desaturases (Reddy and Thomas, 1996; Whitney et al., 2003; Sayanova et al., 2003). The primer sequences were: PL, 5?-TTGGGTGAAAGACCATCCA(T)GGT(A)GG-3? PR, 5?-GGGAAACAAA(G)TGA(G)TGCTCAACCTG-3?. Five amplified products (about 1032 bp) were cloned into the pEASY-Blunt vector (TransGen Biotech, Beijing, China) and sequenced. The 5? and 3? extension of these fragments were obtained by the genomic walking method using the BD GenomeWalker? Universal Kit (BD Biosciences, Palo Alto, CA, USA). Conserved genomic walking primers were: 5GSP1 (480), GACATTGTCTG(A/G)TAATGCCCAGAATC; 5GSP2 (270), CCTATAATCTTTGGATACATCTG(A/g)GA(C/t); 3GSP1(702), AGGAA(A/G)TTGGAGTTTGATGCTTTTGCTAGGTTC; 3GSP2(1078), CG(T/C)CTTGGATGGATTGGTTTCATGGTGG. The PCR products were cloned into the pEASY-Blunt vector (TransGen Biotech) and sequenced. Five sequences similar to ?front-end? ?6-desaturase or ?8-sphingolipid desaturase genes were obtained and named RnD8A, RnD8B, RnD6C, RnD6D, and RnD6E.
The five sequences similar to ?front-end? ?6-desaturase or ?8-sphingolipid desaturase genes were purified from 1% agarose gel, digested with the restriction enzymes HindIII and SacI (the restriction sites of the enzymes had been designed in the primers), cloned into the corresponding sites of the yeast expression vector pYES2 (Invitrogen, UK), and sequenced. The five construct plasmids (pRnD8A, pRnD8B, pRnD6C, pRnD6D, and pRnD6E) were transformed into S. cerevisiae strain INV Sc 1 (Invitrogen) by using the lithium acetate method.
The RnD8A/B-transformed yeasts were grown in SC-U, containing 1% raffinose and 1% (w/v) tergitol NP-40 (Sigma, Germany), and induced with 2% (w/v) galactose. The yeast cells were cultivated for an additional 72 h at 20 ?C, and then harvested and dried at 50 ?C. 100 mg dried cells were used to prepare the long chain bases (LCBs) from glycerolipids for subsequent analysis by HPLC as previously described (Markham et al., 2006) and phytosphinganine (t18:0) (Sigma) was used as the standard. Briefly, induced yeast cells (100 mg, dried weight) were grounded into a fine powder, and subjected to strong alkaline hydrolysis in 2 ml of 10% (w/v) aqueous Ba(OH)2 and 2 ml of dioxane for 16 h at 110 ?C. After hydrolysis, 2 ml of 2% (w/v) ammonium sulphate was added, and the liberated sphingolipid long chain bases were extracted with 2 ml of diethylether. The upper phase was removed to a second tube, dried under nitrogen, and derivatized with o-phthaldialdehyde (OPA) (Invitrogen) as previously described (Merrill et al., 2000). Individual LCBs were separated by reversed phase HPLC (Waters 600E, USA) using Penomenex C18 column (250?4.6 mm, 5 ?m). Elution was carried out at 1.5 ml min?1 with 20% solvent RA (5 mM potassium phosphate, pH 7), 80% solvent RB (100% methanol) for 7 min, increasing to 90% solvent RB by 15 min, returning to 80% solvent RB and re-equilibrating for 2 min (Markham et al., 2006). Fluorescence was excited at 340 nm and detected at 455 nm.
Heterologous expression of RnD6C/D/E was induced under transcriptional control of the yeast GAL1 promoter. Yeast cultures were grown to logarithmic phase at 30 ?C in SC-U containing 1% (w/v) raffinose, 0.67% (w/v) yeast nitrogen and 0.1% (w/v) tergitol NP-40 (sigma), supplemented with 0.5 mM LA (Sigma). The cells were induced by the addition of 2% (w/v) galactose and cultivated for an additional 72 h at 20 ?C. Subsequently, cells were harvested by centrifugation, and washed three times with sterile distilled water. The cells were dried and ground into a fine powder. Then the fatty acid analysis was performed using the following method.
RnD6C/D/E cDNA under the control of the duplicated CaMV 35S (D35S) promoter and nos terminator were constructed in the binary vector pGI0029 (John Innes Centre, UK). The inserts were sequenced to ensure that undesired mutations were not introduced during the PCR reactions. Agrobacterium tumefaciens strain LBA4404 containing the helper plasmid pSoup (John Innes Centre, UK) was used as the host of the pGI0029 vectors containing the ?6-desaturase gene. Arabidopsis thaliana (ecotype Columbia) was used for plant transformation with the floral dip method (Clough and Bent, 1998). T1 seeds were plated out on selective media containing kanamycin (50 mg l?1), and then the selected transformed plants were transferred to soil. The harvested seeds were selected for another two generations, and the fixed transformants were selected.
Cellular fatty acid was extracted by incubating 50 mg yeast powder or 200 mg fresh leaves of transformed A. thaliana or different blackcurrant tissues (young root, young stem, leaves, flowers, ripening exocarp, and ripening seeds) in 3 ml of 7.5% (w/v) KOH in methanol for saponification at 70 ?C for 3 h. After the pH was adjusted to 2.0 with HCl, the fatty acid was subjected to methyl-esterification with 2 ml 14% (w/v) boron trifluoride in methanol at 70 ?C for 1.5 h. Then 1 ml of 0.9% (w/v) NaCl was added and mixed well. Subsequently, fatty acid methyl esters (FAME) were extracted with 2 ml hexane. The upper phase was removed to a second tube, dried under nitrogen and dissolved in acetic ether. Qualitative analysis of FAME was performed by GC-MS (gas chromatography-mass spectrometry, TurboMass, PerkinElmer, USA) with the capillary column (BPX-70, 30 m?0.25 mm?0.25 ?m). FAME were analysed and identified by the comparison of their peaks with those of standards: LA, ALA, and GLA (Sigma).
To determine its subcelluar location, RnD6C/D/E had been cloned in-frame at the 5? end and 3? end with the GFP gene in the pYES2 vector and expressed in the yeast strain INV Sc 1. Live yeast cells were incubated with MitoTrackerRed and/or ER-trackerBlue as described in experimental protocol of ?MitoTracker? and MitoFluor? Mitochondrion-Selective Probes? and ?ER-Tracker? Dyes for Live-Cell Endoplasmic Reticulum Labeling? (Invitrogen). The localization of RnD6C/D/E-GFP was determined by using a fluorescence microscope (Olympus, Tokyo, Japan). The desaturation function of the fused proteins was identified by GC-MS.
Wild-type Nicotiana benthamiana was grown as previously described (Ruiz et al., 1998; Voinnet et al., 1998). A. tumefaciens strain LBA4404 with plastids containing RnD6C/D/E-GFP or GFP-RnD6C/D/E and the strain carrying the p19 construct (Voinnet et al.., 2003) were grown at 28 ?C in YEB supplemented with 50 mg l?1 kanamycin and 5 mg l?1 tetracycline to the stationary phase. Bacterial cells were precipitated by centrifugation at 5000 g for 15 min at room temperature and resuspended in 10 mM MgCl2 and 150 mg l?1 acetosyringone. Cells were left in this medium for 3 h and then infiltrated into the abaxial air spaces of 2?4-week-old N. benthamiana plants. The culture of Agrobacterium was brought to an optical density of 1.0 (OD600) to avoid toxicity (Voinnet et al., 2000). Transient co-expression of the RnD6C/D/E-GFP or GFP-RnD6C/D/E and the mCherry-tagged ER marker (Nelson et al., 2007) and p19 constructs was at OD600 1.0 (Voinnet et al., 2003). The localization of RnD6C/D/E tagged with GFP was determined under a confocal microscope (Leica TCS SP5, Leica Microsystems, Bensheim, Germany).
Total RNA from different tissues was extracted using a RNA extraction kit (Biomed-tech, Beijing, China). cDNA was synthesized from total RNA using a reverse transcriptional kit (Toyobo, Osaka, Japan). The RT-PCR primers for detecting our cloned genes from blackcurrant were listed in Table 1. The housekeeping actin gene was used as the control in the RT-PCR reactions. The reaction was denatured at 95 ?C for 3 min, followed by 30 cycles of 30 s at 95 ?C, 30 s at 60 ?C, 1 min at 72 ?C, and then 7 min at 72 ?C.
Nucleotide sequences of the desaturases were aligned by using the program ClustalX 2.0.10 (Thompson et al., 1994) and manual adjustment. The phylogenetic tree was generated using the alignment output based on the Minimum evolution method (Rzhetsky and Nei, 1992), as implemented in the Mega 4.1 (Kumar et al., 2001). The complete deletion option and the Jukes and Cantor metric were used, and confidence of the tree branches was checked by bootstrap generated from 1000 replicates.
The fatty acid compositions from young roots and stems, flowers, mature leaves, ripening exocarp, and seeds of blackcurrant were determined by GC-MS. The results showed that all the detected tissues except ripening exocarp contained GLA and OTA. There was very little GLA (<1.1% of total fatty acid) and OTA (<0.4% of total fatty acid) in young roots and stems, flowers and mature leaves, but abundant GLA (>12% of total fatty acid) and OTA (>2.6% of total fatty acid) in ripening seeds (Table 2).
Using the genomic DNA walking method, five DNA sequences (1347 bp in length) were cloned and sequenced. They were very similar in DNA sequences (>85% identity) and encoded five distinct deduced polypeptides of 448 amino acids. All of them had an N-terminal Cyt b5 domain as the heme-binding region and three conserved histidine boxes which exist in all membrane-bound desaturases (Fig. 1) (Shanklin et al., 1994). These five DNA sequences could be grouped into two classes. One included two sequences that showed high identities (>69%) to the DNA sequence of ?8-sphingolipid desaturase from borage (Sperling et al., 1998). They were designated as RnD8A and RnD8B and registered in GenBank as GU198924 and GU198925, respectively. The other contained three sequences showing slightly lower identities (>60%) to the DNA sequence of ?6-desaturase from borage. They were designated as RnD6C, RnD6D, and RnD6E, which were registered in GenBank as GU198926, GU198927, and GU198928, respectively. The deduced amino acid sequences of the RnD6C, RnD6D, and RnD6E proteins shared a 93% identity to each other and a 70% identity to the sequence of ?6-desaturase from borage. And the predicted amino acid sequences of RnD8A and RnD8B shared a 92% identity to each other and 61% to the sequence of ?8-sphingolipid desaturase from borage (Sperling et al., 2001).
To validate the putative ?6-desaturase activity of RnD6C, RnD6D, and RnD6E, they were expressed in S. cerevisiae. The fatty acid compositions of transformants and the control were analysed by GC-MS, respectively. In the control, no conversion into non-native products was found by feeding potential fatty acid precursors LA (Fig. 2) or ALA (data not shown) to the yeast cells transformed with empty vector pYES2. By contrast, yeast cells transformed with RnD6C, RnD6D or RnD6E could utilize two precursor forms LA (Fig. 2) and ALA (data not shown), to produce a new product GLA (Fig. 2) or OTA (data not shown), respectively. There were no significant difference in ?6-desaturase activity among RnD6C, RnD6D, and RnD6E.
To identify the functions of RnD8A and RnD8B, they were expressed in S. cerevisiae under the control of the GAL1 promoter. Besides the phytosphinganine, cis- and trans-desaturated sphingoid bases were found in the transformed yeast cells with RnD8A or RnD8B by detecting their LCBs with HPLC (Fig. 3) using the method described in the Materials and methods (Markham et al., 2006). The results indicated that RnD8A and RnD8B were ?8-sphingolipid desaturases.
The cDNAs of RnD6C, RnD6D, and RnD6E were individually expressed in Arabidopsis thaliana. The transgenic plants were verified by PCR using two primers targeting the internal sequence of the genes. The fatty acid profile of lipids from leaves of transgenic plants was determined. Figure 4 showed the fatty acid compositions in leaves of 3-week-old seedling of T3 RnD6C transgenic plants. Compared with the wild type, the leaves of the transgenic plants had an altered fatty acid profile containing two additional peaks corresponding to GLA and OTA. There were no significant differences in the production efficiency of GLA and OTA among transgenic RnD6C, RnD6D, and RnD6E lines (data not shown).
The ?6-desaturase RnD6C/D/E was tagged with GFP in both the N-terminal and C-terminal, and expressed in S. cerevisiae and N. benthamiana. RnD6C/D/E led to similar results and the representative results are shown. The results showed that RnD6C/D/E was localized in mitochondria when introduced into yeast cells (Fig. 5) and ER in tobacco epidermal cells (Fig. 6).
The fused protein also showed ?6-desaturase activity in yeast. However, RnD6C/D/E-GFP had a relatively lower level ?6-desaturase activity than RnD6C/D/E and GFP-RnD6C/D/E and the representative results are shown in Fig. 7.
RT-PCR was used to investigate the expression profiles of RnD8A, RnD8B, RnD6C, RnD6D, and RnD6E. The sequence identity between RnD8A and RnD8B is 91.6%, and that between RnD6C and RnD6E is 97.1%. Thus, the expression of RnD8A and RnD8B, and that of RnD6C and RnD6E, were investigated together. The results showed that RnD8A&RnD8B and RnD6C&RnD6E were expressed in all the tissues at a low level, while RnD6D was expressed only in seeds at a high level (Fig. 8). Using genomic walking, a seed specific expression promoter upstream of RnD6D has been cloned and sequenced (data not shown).
In a few previously studied higher plants, the profiles of the GLA and OTA accumulation were different. GLA is accumulated in mature seeds and in other tissues in Borago officinalis at a high level (Sayanova et al., 1999c), but was absent in seeds and was at a high level in leaves in Anemone leveillei (Whitney et al., 2003). In some primula species, GLA and OTA were accumulated mainly in leaves and seeds, and were relatively low in roots (Sayanova et al., 1999a). In blackcurrant, mature seeds (Traifler et al., 1988) and ripening seeds accumulate GLA and OTA at a high level, while other tissues contained very little GLA and OTA.
In Borago officinalis, Anemone leveillei, and some species of primula with high GLA, a single gene encoding ?6-desaturase had been identified and characterized. In this research on blackcurrant, three genes encoding ?6-desaturase (namely RnD6C, RnD6D, and RnD6E) had been cloned. Their desaturase activities were similar in yeast and Arabidopsis. However, their expression profiles were different. RnD6C&RnD6E was expressed in all the tissues at a low level, while RnD6D expressed only in seeds. RnD6D may mainly contribute to the accumulation of GLA and OTA in the seeds of blackcurrant.
It is widely believed that the ?6-desaturases, which were only found in some plants, have evolved from ?8-sphingolipid desaturases that existed in nearly all plants (Libisch et al., 2000; Sperling et al., 2003). Cladistic analysis of ?6-desaturases and ?8-sphingolipid desaturases genes (Fig. 9) revealed that ?6-desaturases and ?8-sphingolipid desaturase genes from the same plants clustered together, rather than being separated into two groups, for example, Ribes nigrum and Anemone lendsquerelli. The ?6-desaturases and ?8-sphingolipid desaturases genes of Primula vialli (Pv), and Primula farinose (Pf) clustered in two groups as the two species belong to the same genus. The only exception is Borago officinalis in which the genes were not clustered together due to the greater difference between the two desaturases than that in other plant species. The sequence identity of ?6-desaturase and ?8-sphingolipid desaturase in Borago officinalis is 58%, suggesting that the ?6-desaturase and ?8-sphingolipid desaturase separated much earlier in Borago officinalis than those in other species. The identity of ?6-desaturases and ?8-sphingolipid desaturases is more than 80% in blackcurrant and the distance between them is much shorter than that in other species. Furthermore, among the plant species with reported ?6-desaturase genes, blackcurrant is the only one in which several functional genes or copies of ?6-desaturase have been found. These genes have identities higher than 92% based on the amino acid sequences. The existence of three such genes may have resulted from a recent gene duplication event, as the delta desaturases were thought to be conserved in evolution until now (Libisch et al., 2000). It is speculated that ?6-desaturase genes in blackcurrant may have evolved later than those in other species.
?6-desaturases from previously reported plants always exhibited different substrate selectivity. Some prefer LA (Garc?a-Maroto et al., 2006; Sayanova et al., 2006) and some prefer ALA as the substrate (Sayanova et al., 2003). In the present study, the three ?6-desaturases, RnD6C, RnD6E, and RnD6D from blackcurrant can use both LA and ALA as the substrates, but their substrate selectivity needs to be confirmed by future studies.
Front-end desaturases are generally thought to locate in the ER, although the actual location is unknown (Hsiao et al., 2007). Expression of GFP-tagged RnD6C/D/E in yeast and tobacco could facilitate the visualization of its exact location. The present study provides the unequivocal evidence that RnD6C/D/E is located in the ER in tobacco, but it is located in mitochondria when introduced into yeast.
The effect of the fusion of GFP with ?6-desaturases on their enzyme activity has not been reported. Results from the present study indicate that the yeast cells containing RnD6C/D/E-GFP accumulated a lower level of GLA than those containing GFP-RnD6C/D/E or RnD6C/D/E and there were no significant differences between GFP-RnD6C/D/E and RnD6C/D/E (Fig. 7). It is shown that the GFP tagged with ?6-desaturases in the N-terminal (GFP-RnD6C/D/E) had no effect on the activity of ?6-desaturases, but tagged with C-terminal (RnD6C/D/E-GFP) could decrease the activity of ?6-desaturases. This reduced activity may result from the alteration of the three-dimensional structure of the C-terminal when the protein is tagged with GFP at that end. The results suggested that the three-dimensional structure of the C-terminal of ?6-desaturases should be important for their enzyme activity. However, the effect of the three-dimensional structure of the C-terminal of ?6-desaturases on their enzyme activity is worthy of further investigation.
In conclusion, three genes encoding ?6-desaturases (RnD6C/D/E) and two encoding ?8-sphingolipid desaturases (RnD8A/B) from blackcurrant that were very similar in their sequences have been isolated and characterized. RnD6C and RnD6E was expressed in all the tissues at a low level, while RnD6D was expressed only in seeds. RnD6D could mainly contribute to the accumulation of GLA and OTA in blackcurrant seeds. To the authors? knowledge, this is the first report of the identification of several ?6-desaturases in a single plant species and of finding a ?6-desaturase gene expressed specifically in seeds. Blackcurrant ?6-desaturases were confirmed to localize in the ER of plant cells and in the mitochondria of yeast cells. It is speculated that the evolution of ?6-desaturase genes from ?8-sphingolipid desaturase genes in blackcurrant occurred more recently than that in other species.
| Abbreviations | |
|---|---|
| GLA | ?-linolenic acid |
| EFA | essential fatty acid |
| ALA | ?-linolenic acids |
| LA | linoleic acid |
| OTA | octadecatetraenoic acids |
| MIT | mitochondrion |
| ER | endoplasmic reticulum |
| FAME | fatty acid methyl esters |
| GC-MS | gas chromatography-mass spectrometry |
| Cyt b5 | cytochrome b5 |
| PMS | premenstrual syndrome |
| LCBs | long chair bases |
| OPA | o-phthaldialdehyde |
| GFP- | Green fluorescence protein tagged in C-terminal |
| -GFP | Green fluorescence protein tagged in N-terminal |
We thank Dr Chengcai Chu and Dr Yiqin Wang, Institute of Genetics and Developmental Biology, CAS, for their help with the HPLC analyses. This research was supported by project (No. 2008ZX08009-003) from the Ministry of Agriculture of China for transgenic research, project KSCX-YW-N-009 from the Chinese Academy of Sciences, and project 2006AA10A113 from the Ministry of Science and Technology of China.
References
| Clough SJ,Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thalianaThe Plant JournalYear: 19981673574310069079 | |
| Das UN. Essential fatty acids: biochemistry, physiology and pathologyBiotechnology JournalYear: 2006142043916892270 | |
| Garc?a-Maroto F,Manas-Fernandez A,Garrido-C?rdenas JA,Alonso DL. Substrate specificity of acyl-?6-desaturases from Continental versus Macaronesian Echium speciesPhytochemistryYear: 20066754054416455116 | |
| Horrobin DF. Nutritional and medical importance of gamma-linolenic acidProgress in Lipid ResearchYear: 1992311631941334266 | |
| Hsiao TY,Holmes B,Blanch HW. Identification and functional analysis of a delta-6 desaturase from the marine microalga Glossomastix chrysoplastaMarine BiotechnologyYear: 2007915416517256083 | |
| Kumar S,Tamura K,Jakobsen IB,Nei M. MEGA2: molecular evolutionary genetics analysis softwareYear: 2001Arizona State University, Tempe, Arizona, USA | |
| Libisch B,Michaelson LV,Lewis MJ,Shewry PR,Napier JA. Chimeras of ?6-fatty acid and ?8-sphingolipid desaturasesBiochemical and Biophysical Research CommunicationsYear: 200027977978511162428 | |
| Markham JE,Li J,Cahoon EB,Jaworski JG. Separation and identification of major plant sphingolipid classes from leavesJournal of Biological ChemistryYear: 2006281226842269416772288 | |
| Merrill AH,Caligan TB,Wang E,Peters K,Ou J. Analysis of sphingoid bases and sphingoid base 1-phosphates by High-Performance Liquid ChromatographyMethods in EnzymologyYear: 20003123911070857 | |
| Napier JA,Hey SJ,Lacey DJ,Shewry PR. Identification of a Caenorhabditis elegans ?6-fatty-acid-desaturase by heterologous expression in Saccharomyces cerevisiaeBiochemical JournalYear: 19983306116149480865 | |
| Napier JA,Sayanova O,Sperling P,Heinz E. A growing family of cytochrome b5-domain fusion proteinsTrends in Plant ScienceYear: 1999424 | |
| Na-Ranong S,Laoteng K,Kittakoop P,Tantichareon M,Cheevadhanarak S. Substrate specificity and preference of ?6-desaturase of Mucor rouxiiFEBS LettersYear: 20055792744274815862319 | |
| Nelson BK,Cai X,Nebenf?hr A. A multicolored set of in vivo organelle markers for co-localization studies in Arabidopsis and other plantsThe Plant JournalYear: 2007511126113617666025 | |
| Qi B,Fraser T,Mugford S,Dobson G,Sayanova O,Butler J,Napier JA,Stobart AK,Lazarus CM. Production of very long chain polyunsaturated omega-3 and omega-6 fatty acids in plantsNature BiotechnologyYear: 200422739745 | |
| Reddy AS,Nuccio ML,Gross LM,Thomas TL. Isolation of a ?6-desaturase gene from the cyanobacterium Synechocystis sp. strain PCC6803 by gain-of-function expression in Anabaena sp. strain PCC7120Plant Moleclular BiologyYear: 199322293300 | |
| Reddy AS,Thomas TL. Expression of a cyanobacterial ?6-desaturase gene results in ?-linolenic acid production in transgenic plantsNature BiotechnologyYear: 199614639642 | |
| Ruiz MT,Voinnet O,Baulcombe DC. Initiation and maintenance of virus-induced gene silencingThe Plant CellYear: 1998109379469634582 | |
| Rzhetsky A,Nei M. A simple method for estimating and testing minimum evolution treesMolecular Biology and EvolutionYear: 19929945967 | |
| Sakuradani E,Shimizu S. Gene cloning and functional analysis of a second ?6-fatty acid desaturase from an arachidonic acid-producing Mortierella fungusBioscience, Biotechnology, and BiochemistryYear: 200367704711 | |
| Sayanova O,Beaudoin F,Libisch B,Castel A,Shewry PR,Napier JA. Mutagenesis and heterologous expression in yeast of a plant ?6-fatty acid desaturaseJournal of Experimental BotanyYear: 2001521581158511457919 | |
| Sayanova OV,Beaudoin F,Michaelson LV,Shewry PR,Napier JA. Identification of primula fatty acid ?6-desaturases with n-3 substrate preferencesFEBS LettersYear: 200354210010412729906 | |
| Sayanova O,Haslam R,Venegas-Caler?n M,Napier JA. Identification of primula ?front-end? desaturases with distinct n-6 or n-3 substrate preferencesPlantaYear: 20062241269127716773377 | |
| Sayanova O,Shewry PR,Napier JA. Histidine-41 of the cytochrome b5 domain of the borage ?6 fatty acid desaturase is essential for enzyme activityPlant PhysiologyYear: 1999b12164164610517856 | |
| Sayanova O,Shewry PR,Napier JA. Characterization and expression of a fatty acid desaturase from Borago officinalisJournal of Experimental BotanyYear: 1999c50411412 | |
| Sayanova O,Smith MA,Lanpinskas P,et al. ?6-Unsaturated fatty acids in species and tissues of the PrimulaceaePhytochemistryYear: 1999a52419422 | |
| Sayanova O,Smith MA,Lapinskas P,Stobart AK,Dobson G,Christie WW,Shewry PR,Napier JA. Expression of a borage desaturase cDNA containing an N-terminal cytochrome b5domain results in the accumulation of high levels of ?6-desaturated fatty acids in transgenic tobaccoProceedings of the National Academy of Sciences, USAYear: 19979442114216 | |
| Seiliez I,Panserat S,Kaushik S,Bergot P. Cloning, tissue distribution and nutritional regulation of a ?6-desaturase-like enzyme in rainbow troutComparative Biochemistry and Physiology Part B: Biochemistry and Molecular BiologyYear: 20011308393 | |
| Shanklin J,Whittle E,Fox BG. Eight histidine residues are catalytically essential in a membrane-associated iron enzyme, stearoyl-CoA desaturase, and are conserved in alkane hydroxylase and xylene monooxygenaseBiochemistryYear: 19943312787127947947684 | |
| Sperling P,Z?hringer UZ,Heinz E. A sphingolipid desaturase from higher plantsThe Journal of Biological ChemistryYear: 199827323590285969722599 | |
| Sperling P,Lee M,Girke T,Z?hringer U,Stymne S,Heinz E. A bifunctional ?6-fatty acyl acetylenase/desaturase from the moss Ceratodon purpureusEuropean Journal of BiochemistryYear: 20002673801381110848999 | |
| Sperling P,Libisch B,Z?hringer U,Napier JA,Heinz E. Functional identification of a ?8-sphingolipid desaturase from Borago officinalisArchives of Biochemistry and BiophysicsYear: 200138829329811368168 | |
| Sperling P,Ternes P,Zank TK,Heinz E. The evolution of desaturasesProstaglandins, Leukotrienes and Essential Fatty AcidsYear: 2003687395 | |
| Stymne S,Stobart AK. Biosynthesis of ?-linolenic acid in cotyledons and microsomal preparations of the developing seeds of common borage (Borago officinalis)Biochemical JournalYear: 19862403853933028375 | |
| Subudhi S,Kurdrid P,Hongsthong A,Sirijuntarut M,Cheevadhanarak S,Tanticharoen M. Isolation and functional characterization of Spirulina D6D gene promoter: role of a putative GntR transcription factor in transcriptional regulation of D6D gene expressionBiochemical and Biophysical Research CommunicationsYear: 200836564364918022383 | |
| Thompson JD,Higgins DG,Gibson TC. CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choiceNucleic Acids ResearchYear: 199422467346807984417 | |
| Traifler H,Wille HJ,Studer A. Fractionation of blackcurrant seed oilJournal of the American Oil Chemists? SocietyYear: 198865755760 | |
| Voinnet O,Lederer C,Baulcombe DC. A viral movement protein prevents systemic spread of the gene silencing signal in Nicotiana benthamianaCellYear: 200010315716711051555 | |
| Voinnet O,Rivas S,Mestre P,Baulcombe DC. An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virusThe Plant JournalYear: 20033394995612609035 | |
| Voinnet O,Vain P,Angell S,Baulcombe DC. Systemic spread of sequence-specific transgene RNA degradation is initiated by localised introduction of ectopic promoterless DNACellYear: 1998951771879790525 | |
| Wassenaar LM,Hofman K. Description and identification of blackcurrant varieties by winter charactersEuphyticaYear: 196615117 | |
| Whitney HM,Michaelson LV,Sayanova O,Pickett JA,Napier JA. Functional characterisation of two cytochrome b5-fusion desaturases from Anemone leveillei: the unexpected identification of a fatty acid ?6-desaturasePlantaYear: 200321798399212898253 |
Figures
Tables
Primers (from 5? to 3?) used in RT-PCR
| Primer name | Sequences |
| RTDL94 | GGTAAGGTTTACAATGTCACCC |
| RTDR830 | CGCTTTGAGAGCAACATG |
| RTA&BL420 | ATG(C/T)(T/G)TTGTGGAGGCTTA |
| RTA&BR1077 | AGCATGAAATATCTATAGTCCCTT |
| RTC&EL322 | GAAAGGGCATGGTGTTTTC |
| RTC&ER864 | CAA(A/G)AGTCTGTTGGGTACTTTTTT |
| Actin L | CATCAGGAAGGACTTGTACGG |
| Actin R | GATGGACCTGACTCGTCATAC |
Fatty acid composition of different blackcurrant tissues
| Young root | Young stem | Leaf | Flower | Ripening exocarp | Ripening seeds | |
| 16:0 | 32.3?0.7 | 30.4?0.7 | 17.2?0.6 | 34.7?1.5 | 35.0?0.2 | 10.1?0.0 |
| 16:1 | 23.4?0.9 | ? | 1.7?0.0 | ? | ? | ? |
| 16:2 | ? | ? | 1.2?0.0 | ? | ? | ? |
| 16:3 | ? | ? | 5.0?0.2 | ? | ? | ? |
| 18:0 | 14.3?0.6 | 11.2?0.8 | 2.5?0.3 | 11.1?0.6 | 19.5?1.0 | 3.9?0.0 |
| 18:1 | 6.5?0.2 | 2.9?0.3 | 1.7?0.1 | 9.9?0.5 | 4.6?0.3 | 12.6?0.2 |
| LA | 16.7?0.3 | 30.8?1.2 | 10.7?0.4 | 24.6?1.3 | 22.2?0.8 | 42.7?0.1 |
| GLA | 0.8?0.0 | 1.1?0.0 | 0.4?0.0 | 0.3?0.1 | ? | 12.7?0.2 |
| ALA | 3.6?0.0 | 20.7?0.5 | 57.1?1.3 | 16.9?1.2 | 16.7?0.7 | 13.4?0.1 |
| OTA | 0.4?0.0 | 0.9?0.0 | 0.4?0.0 | 0.3?0.0 | ? | 2.6?0.1 |
The levels of individual fatty acids were determined by GC-MS and expressed as mole% of the total. Values given represent means ?SE obtained from three independent experiments.
Article Categories:
Keywords: ?6-desaturase, ?8-sphingolipid desaturase, functional analysis, Ribes nigrum, subcellular localization. |
|
Previous Document: Specific expression of apomixis-linked alleles revealed by comparative transcriptomic analysis of se...
Next Document: My favourite flowering image.





