Document Detail

Human polyomaviruses in children undergoing transplantation, United States, 2008-2010.
Jump to Full Text
MedLine Citation:
PMID:  23017293     Owner:  NLM     Status:  MEDLINE    
Abstract/OtherAbstract:
Immunocompromised patients are at risk for disease caused by infection by some polyomaviruses. To define the prevalence of polyomaviruses in children undergoing transplantation, we collected samples from a longitudinal cohort and tested for the 9 known human polyomaviruses. All were detected; several were present in previously unreported specimen types.
Authors:
Erica A Siebrasse; Irma Bauer; Lori R Holtz; Binh-minh Le; Sherry Lassa-Claxton; Charles Canter; Paul Hmiel; Shalini Shenoy; Stuart Sweet; Yumirle Turmelle; Ross Shepherd; David Wang
Related Documents :
23100693 - Detection of human rotavirus in hospitalized diarrheic children in central india.
7712623 - Plasma vigabatrin enantiomer ratios in adults and children.
14966823 - Late presentation of congenital cystic adenomatoid malformation of lung in ten-year-old...
Publication Detail:
Type:  Journal Article; Research Support, N.I.H., Extramural; Research Support, Non-U.S. Gov't; Research Support, U.S. Gov't, Non-P.H.S.    
Journal Detail:
Title:  Emerging infectious diseases     Volume:  18     ISSN:  1080-6059     ISO Abbreviation:  Emerging Infect. Dis.     Publication Date:  2012 Oct 
Date Detail:
Created Date:  2012-09-28     Completed Date:  2013-02-19     Revised Date:  2013-03-01    
Medline Journal Info:
Nlm Unique ID:  9508155     Medline TA:  Emerg Infect Dis     Country:  United States    
Other Details:
Languages:  eng     Pagination:  1676-9     Citation Subset:  IM    
Affiliation:
Washington University School of Medicine, St. Louis, Missouri 63110, USA.
Export Citation:
APA/MLA Format     Download EndNote     Download BibTex
MeSH Terms
Descriptor/Qualifier:
Bone Marrow Transplantation / adverse effects*
Child
Child, Preschool
Female
Humans
Immunocompromised Host
Male
Organ Transplantation / adverse effects*
Polymerase Chain Reaction
Polyomavirus / classification,  genetics*,  isolation & purification
Polyomavirus Infections / epidemiology*,  virology
Prevalence
United States / epidemiology
Grant Support
ID/Acronym/Agency:
KL2 RR024994/RR/NCRR NIH HHS; KL2RR024994/RR/NCRR NIH HHS; ULIRR024992//PHS HHS
Comments/Corrections

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine

Full Text
Journal Information
Journal ID (nlm-ta): Emerg Infect Dis
Journal ID (iso-abbrev): Emerging Infect. Dis
Journal ID (publisher-id): EID
ISSN: 1080-6040
ISSN: 1080-6059
Publisher: Centers for Disease Control and Prevention
Article Information
Download PDF

Print publication date: Month: 10 Year: 2012
Volume: 18 Issue: 10
First Page: 1676 Last Page: 1679
PubMed Id: 23017293
ID: 3471627
Publisher Id: 12-0359
DOI: 10.3201/eid1810.120359

Human Polyomaviruses in Children Undergoing Transplantation, United States, 2008–2010 Alternate Title:Polyomaviruses in Children Undergoing Transplantation
Erica A. Siebrasse
Irma Bauer
Lori R. Holtz
Binh-minh Le
Sherry Lassa-Claxton
Charles Canter
Paul Hmiel
Shalini Shenoy
Stuart Sweet
Yumirle Turmelle
Ross Shepherd
David Wang
Washington University School of Medicine, St. Louis, Missouri, USA
Correspondence: Address for correspondence: David Wang, Washington University School of Medicine, Campus Box 8230, 660 S. Euclid Ave, St. Louis, MO 63110, USA; email: davewang@borcim.wustl.edu

BK and JC polyomaviruses (BKPyV, JCPyV) cause disease in immunocompromised persons. Both are double-stranded DNA viruses in the family Polyomaviridae. Seven additional human polyomaviruses were discovered during 2007–2011: KI polyomavirus (KIPyV) (1), WU polyomavirus (WUPyV) (2), Merkel cell polyomavirus (MCPyV) (3), human polyomavirus 6 (HPyV6) (4), human polyomavirus 7 (HPyV7) (4), trichodysplasia spinulosa-associated polyomavirus (TSPyV) (5), and human polyomavirus 9 (HPyV9) (6).

The 7 novel polyomaviruses have been detected in various specimen types; detection has been extensively reviewed for KIPyV, WUPyV, and MCPyV (7). Polyomaviruses HPyV6, HPyV7, TSPyV, and HPyV9 have been detected in skin (4,5,8); TSPyV and HPyV9 have also been detected in urine, and HPyV9 was detected in serum (6). However, only 2 of these recently identified viruses have been specifically implicated in human diseases; MCPyV is associated with Merkel cell carcinoma (3), and TSPyV has been linked to trichodysplasia spinulosa (5). Immunosuppression is a likely cofactor in both diseases. The potential pathogenicity of the other 5 novel polyomaviruses is unknown. As a first step toward exploring their disease potential, we sought to define their prevalence in immunocompromised transplant recipients. To this end, we established a longitudinal cohort of children undergoing transplantation at St. Louis Children’s Hospital, St. Louis, Missouri, USA.


The Study

We recruited 32 patients who were scheduled to receive transplants (2 lung, 11 liver, 5 heart, 2 kidney, 1 liver/lung, and 11 bone marrow transplants) during October 2008–April 2010. The Human Research Protection Office of Washington University in St. Louis approved this study. The mean age of enrolled patients was 5.8 years, and the median age was 3.1 years. Thirty patients received transplants and were studied for 1 year after transplantation. We collected 716 clinical specimens (160 nasopharyngeal swab, 169 urine, 122 fecal, 265 plasma) during 265 patient visits. We collected 298 specimens from patients during symptomatic episodes, which were defined as having >1 of the following: fever, respiratory symptoms, or gastrointestinal symptoms. We collected clinical data using a questionnaire and the medical records.

Fecal material was diluted 1:6 in phosphate-buffered saline and filtered through 0.45-μm membranes. For all specimens, we extracted total nucleic acids using an Ampliprep Cobas extractor (Roche, Branchburg, NJ, USA). We used published real-time PCRs for WUPyV (9), KIPyV (9), TSPyV (5), MCPyV (10), BKPyV (11), and JCPyV (12) (Table 1). We developed assays for HPyV6, HPyV7, and HPyV9 using Primer Express software (Applied Biosystems, Carlsbad, CA, USA) (Table 1). To assess the performance of each assay, we used serial dilutions (5 to 5 × 106 copies/reaction) of a plasmid containing the target sequence. All 3 assays demonstrated a sensitivity of ≈5 copies/reaction and yielded linear curves with R2 values >0.99.

Each of the 25-μl quantitative PCRs included 5 μL of extracted sample, 12.5 pmol of each primer, and 4 pmol of probe. The MCPyV primers and probe were used as described (10). We tested samples in a 96-well plate format, with 8 water negative controls and 1 positive control/plate. Reactions were cycled as recommended using either an ABI 7500 real-time thermocycler (Applied Biosystems) or a CFX96 real-time thermocycler (BioRad, Hercules, CA, USA). The threshold of all plates was set at a standard value, and samples were counted as positive if their cycle threshold was <37.00.

All 716 specimens were tested for each virus (Table 2). The most frequently detected virus was BKPyV, which was found primarily in urine as expected. JCPyV was detected in 1 plasma sample. HPyV6, HPyV7, MCPyV, and TSPyV were detected in specimen types not previously reported. HPyV6 and TSPyV were detected in fecal samples and nasopharyngeal swab samples, and HPyV7 was detected in a nasopharyngeal swab and urine. One fecal sample was positive for MCPyV. Because HPyV6, HPyV7, and MCPyV have been previously detected in skin, we cannot rule out the possibility that their presence in specimens could have been caused by shedding from skin.

We collected 2 serial nasopharyngeal samples that were positive for KIPyV from patient 3001 (Table 2), a 1-year-old child who had received a bone marrow transplant as treatment for Fanconi anemia. The first sample, a nasopharyngeal swab obtained 1 month after transplant, had low levels of KIPyV. To determine the viral load of the second nasopharyngeal swab specimen collected 2 months later, we reanalyzed the sample in triplicate; on the basis of extrapolation of the standard curve run in parallel, we estimated the viral load to be 1.3 × 109 genome copies/mL of nasopharyngeal swab transport media. This patient’s course was complicated by graft-versus-host disease of the gut and skin, renal failure requiring dialysis, and recurrent pulmonary hemorrhage. The patient was critically ill and had experienced multiorgan failure at the time of the second sampling. Other microbiological test results were negative at that time, including PCR for Epstein-Barr virus, cytomegalovirus, human herpesvirus-6, and adenovirus in the blood; aspergillus antigen detection in blood; and bacterial cultures of blood, tracheal aspirate, urine, and peritoneal fluid. The fecal specimen collected at this time was negative for KIPyV; plasma and urine were not available for this study. The patient died of acute respiratory failure and extensive pulmonary hemorrhage 24 days after collection of this specimen. Despite the frequent detection of KIPyV in respiratory specimens, no studies have definitively linked infection with respiratory disease. Titers of KIPyV were high in the nasopharyngeal swab sample from this patient 3 weeks before respiratory failure. Although this observation does not necessarily implicate KIPyV infection as a contributing factor in the death of the patient, it suggests a poorly controlled KIPyV infection in the respiratory tract.

Three specimens collected from patient 4001, a 13-year-old heart transplant recipient, were positive for TSPyV (Figure), but the patient did not have trichodysplasia spinulosa. At 1 week after transplant, the nasopharyngeal swab and fecal samples were positive for TSPyV. At 1 month after transplant, the nasopharyngeal swab sample was again positive for TSPyV, with a viral load of ≈2.3 × 104 genome copies/mL of transport media. There is currently only 1 TSPyV sequence in GenBank (accession no. GU989205). We used 4 primer pairs to amplify the complete genome of TSPyV from the nasopharyngeal swab taken 1 month after transplant. PCR products were cloned, and the complete genome was sequenced to 3× coverage (GenBank accession no. JQ723730) and compared with the other TSPyV sequence. There were 5 nt substitutions: 3 in noncoding regions and 2 synonymous mutations.

Although serologic studies have demonstrated that ≈70% of adults in Europe have been infected by TSPyV (13), its mode of transmission is unknown. The detection of TSPyV in nasopharyngeal swab and fecal samples raises the possibility that it may be transmitted by a respiratory or fecal–oral route. Furthermore, in the current study, 2 sequential nasopharyngeal swab samples taken 20 days apart were positive for TSPyV, suggesting it may persist for extended periods in the respiratory tract, at least in immunosuppressed persons.


Conclusions

Our goals were to establish a longitudinal repository of different specimens types from transplant recipients and to define the prevalence of polyomaviruses in these patients. We detected all 9 polyomaviruses in at least 1 specimen. Although the prevalence of each virus was generally low, TSPyV, HPyV6, HPyV7, and MCPyV were detected in specimen types not previously reported. These observations expand understanding of the recently identified polyomaviruses and the tissue and organ systems they may infect and suggest possible modes of transmission. Further studies to define their possible roles in human diseases are needed.


Notes

Suggested citation for this article: Siebrasse EA, Bauer I, Holtz LR, Le B, Lassa-Claxton S, Canter C, et al. Human polyomaviruses in children undergoing transplantation, United States, 2008–2010. Emerg Infect Dis [Internet]. 2012 Oct [date cited]. http://dx.doi.org/10.3201/eid1810.120359

Acknowledgments

We thank Angel Chen and Adira Vinograd for their help in compiling the clinical data for this study. We also thank M.C.W. Feltkamp for the TSPyV-positive control and Christopher Buck for the HPyV6-, HPyV7-, and MCPyV-positive controls (AddGene plasmids 24727–24729, respectively; addgene.org).

This study was supported by a grant from the Children’s Discovery Institute. E.A.S. was supported by the Department of Defense through the National Defense Science & Engineering Graduate Fellowship Program. L.R.H. is supported by ULIRR024992 subaward KL2RR024994 from the National Institutes of Health, National Center for Research Resources.

Ms Siebrasse is a graduate student at Washington University in St. Louis, Missouri. Her research focuses on the discovery and characterization of novel polyomaviruses.


References
1. . AllanderT, AndreassonK, GuptaS, BjerknerA, BogdanovicG, PerssonMA, et al. Identification of a third human polyomavirus.J Virol. Year: 2007;81:4130–610.1128/JVI.00028-0717287263
2. . GaynorAM, NissenMD, WhileyDM, MackayIM, LambertSB, WuG, et al. Identification of a novel polyomavirus from patients with acute respiratory tract infections.PLoS Pathog. Year: 2007;3:e6410.1371/journal.ppat.003006417480120
3. . FengH, ShudaM, ChangY, MoorePSClonal integration of a polyomavirus in human Merkel cell carcinoma.Science. Year: 2008;319:1096–10010.1126/science.115258618202256
4. . SchowalterRM, PastranaDV, PumphreyKA, MoyerAL, BuckCBMerkel cell polyomavirus and two previously unknown polyomaviruses are chronically shed from human skin.Cell Host Microbe. Year: 2010;7:509–1510.1016/j.chom.2010.05.00620542254
5. . van der MeijdenE, JanssensRW, LauberC, Bouwes BavinckJN, GorbalenyaAE, FeltkampMCDiscovery of a new human polyomavirus associated with trichodysplasia spinulosa in an immunocompromized patient.PLoS Pathog. Year: 2010;6:e100102410.1371/journal.ppat.100102420686659
6. . ScudaN, HofmannJ, Calvignac-SpencerS, RuprechtK, LimanP, KuhnJ, et al. A novel human polyomavirus closely related to the African green monkey–derived lymphotropic polyomavirus (LPV).J Virol. Year: 2011;85:4586–9010.1128/JVI.02602-1021307194
7. . Babakir-MinaM, CiccozziM, PernoCF, CiottiMThe novel KI, WU, MC polyomaviruses: possible human pathogens?New Microbiol. Year: 2011;34:1–821344140
8. . SauvageV, FoulongneV, ChevalJ, Ar GouilhM, ParienteK, DereureO, et al. Human polyomavirus related to African green monkey lymphotropic polyomavirus.Emerg Infect Dis. Year: 2011;17:1364–7021801611
9. . BialasiewiczS, WhileyDM, LambertSB, GouldA, NissenMD, SlootsTPDevelopment and evaluation of real-time PCR assays for the detection of the newly identified KI and WU polyomaviruses.J Clin Virol. Year: 2007;40:9–1410.1016/j.jcv.2007.07.01517714984
10. . GohS, LindauC, Tiveljung-LindellA, AllanderTMerkel cell polyomavirus in respiratory tract secretions.Emerg Infect Dis. Year: 2009;15:489–9110.3201/eid1503.08120619239773
11. . DumoulinA, HirschHHReevaluating and optimizing polyomavirus BK and JC real-time PCR assays to detect rare sequence polymorphisms.J Clin Microbiol. Year: 2011;49:1382–810.1128/JCM.02008-1021325560
12. . PalA, SirotaL, MaudruT, PedenK, LewisAMJrReal-time, quantitative PCR assays for the detection of virus-specific DNA in samples with mixed populations of polyomaviruses.J Virol Methods. Year: 2006;135:32–4210.1016/j.jviromet.2006.01.01816527364
13. . van der MeijdenE, KazemS, BurgersMM, JanssensR, Bouwes BavinckJN, de MelkerH, et al. Seroprevalence of trichodysplasia spinulosa–associated polyomavirus.Emerg Infect Dis. Year: 2011;17:1355–6321801610

Figures

[Figure ID: F1]
Figure 

Samples tested for TSV (trichodysplasia spinulosa polyomavirus) during May–June 2009 from patient 4001, a 13-year-old heart transplant recipient at St. Louis Children’s Hospital, St. Louis, Missouri, USA. Samples tested at each time point are indicated by white squares. Black squares represent positive samples. NP, nasopharyngeal.



Tables
[TableWrap ID: T1] Table 1  Real-time PCR assays to detect human polyomaviruses in children undergoing transplants, United States, 2008–2010*
Virus Target Primers, 5′ → 3′ Probe, 5′ → 3′
WUPyV NCCR WU-C-4824-F: GGCACGGCGCCAACT WU-C-4861-TM: FAM-TGCCATACCAACACAGCTGCTGAGC-TAMRA-3′
WU-C-4898-R: CCTGTTGTAGGCCTTACTTACCTGTA
KIPyV LTAg KI-B-4603-F: GAATGCATTGGCATTCGTGA KI-B-4632-TM: FAM-TGTAGCCATGAATGCATACATCCCACTGC-TAMRA
KI-B-4668-R: GCTGCAATAAGTTTAGATTAGTTGGTGC
TSPyV LTAg LTF: TGTGTTTGGAAACCAGAATCATTTG LTP: FAM-TTCTTCTTCCTCCTCATCCTCCACCTCAAT-TAMRA
LTR: TGCTACCTTGCTATTAAATGTGGAG
MCPyV LTAg LT.1F: CCACAGCCAGAGCTCTTCCT LT probe: FAM-TCCTTCTCAGCGTCCCAGGCTTCA-TAMRA
LT.1R: TGGTGGTCTCCTCTCTGCTACTG
HPyV6 VP1 ES011F: GCCTGGAAGGGCCTAGTAAAG ES024: FAM-ACCAACCATCTGTTGCAGGCATTAAAGCTA-TAMRA
ES012R: ATTGGCAGCTGTAACTTGTTTTCTG
HPyV7 VP1 ES017F: GGTCCAGGCAATACTGATGTAGCTA ES025: FAM-CCTGCAAGCCCTCAGAAAGCAAGTAAATG-TAMRA
ES018R: TCTGCAACCCAGAGCTCTACTG
HPyV9 LTAg ES026F: GAAGACCCTGATCCTGAGGAAGA ES031: FAM-TGGATCATCCCAGAGTTCATTTACCTGCA-TAMRA
ES027R: CTCTGGAGTATTAGGTTCAGGCTTCT
BKPyV LTAg BK-Deg-F: AGCAGGCAAGRGTTCTATTACTAAAT Bk-Deg-P: FAM-AAGACCCTAAAGACTTTCCYTCTGATCTACACCAGTTT-TAMRA
BK-Deg-R: GARGCAACAGCAGATTCYCAACA
JCPyV VP2/3 JL1 (F): AAGGGAGGGAACCTATATTTCTTTTG JL1 (P): FAM-CTCATACACCCAAAGTATAGATGATGCAGACAGCA-TAMRA
JL1 (R): TCTAGCCTTTGGGTAACTTCTTGAA

*WUPyV, WU polyomavirus; NCCR, non-coding control region; KIPyV, KI polyomavirus; LTAg, large T antigen; TSPyV, trichodysplasia spinulosa polyomavirus; MCPyV, Merkel cell polyomavirus; HPyV, human polyomavirus; VP, virion protein; BKPyV, BK polyomavirus; JCPyV, JC polyomavirus.


[TableWrap ID: T2] Table 2  Polyomaviruses detected among specimens from children undergoing transplants, United States, 2008–2010*
Virus Specimen type Transplant Ct Patient ID Date of collection, time elapsed from transplant
HPyV6 Feces BMT 32.19 3011 2012 Jun 06, 1 mo after transplant
HPyV6 NP Heart 36.13 4005 2010 Nov 25, 7 mo after transplant
HPyV6 Feces Lung 36.95 5001 2010 Aug 17, 1 mo after transplant
HPyV7 NP Liver 34.57 1002 2009 Jun 16, 7 mo after transplant
HPyV7 Urine Liver 36.54 1002 2009 Jul 15, 8 mo after transplant
HPyV9 Urine Liver 36.72 1009 2010 Feb 09, 1 wk after transplant
KIPyV NP BMT 16.28 3001 2009 Jul 07, 3 mo after transplant
KIPyV NP BMT 36.07 3001 2009 May 19, 1 mo after transplant
KIPyV NP BMT 33.37 3008 2009 Nov 12, before transplant
KIPyV NP BMT 31.04 3009 2010 Jul 30, 6 mo after transplant
MCPyV NP BMT 36.29 3011 2010 Apr 15, before transplant
MCPyV Feces BMT 34.56 3011 2010 Jul 02, 2 mo after transplant
TSPyV NP Heart 32.98 4001 2009 May 29, 1 wk after transplant
TSPyV NP Heart 30.74 4001 2009 Jun 18, 1 mo after transplant
TSPyV Feces Heart 33.89 4001 2009 May 29, 1 wk after transplant
WUPyV NP BMT 36.62 3005 2009 Jul 15, before transplant
WUPyV NP BMT 28.81 3007 2009 Nov 06, 2 mo after transplant
JCPyV Plasma BMT 36.12 3011 2010 Aug 24, 3 mo after transplant
BKPyV Urine BMT 15.83 3010 2010 Apr 15, 1 mo after transplant
BKPyV Urine Kidney 36.67 2022 2010 Jul 01, 10 mo after transplant
BKPyV Urine BMT 30.80 3011 2010 Aug 24, 3 mo after transplant
BKPyV Urine Heart 25.84 4001 2009 Aug 14, 2 mo after transplant
BKPyV Urine Heart 35.89 4003 2009 Dec 23, 2 mo after transplant
BKPyV Urine Heart 24.37 4001 2009 Sep 23, 4 mo after transplant
BKPyV Urine Liver 28.56 1010 2009 Nov 23, 1 wk after transplant
BKPyV Urine Lung 33.13 5002 2011 May 03, 1 year after transplant
BKPyV Urine Lung 25.25 5002 2011 Feb 08, 10 mo after transplant
BKPyV Urine Kidney 9.97 2002 2010 Mar 04, 6 mo after transplant
BKPyV Urine BMT 30.10 3009 2010 Mar 05, 2 mo after transplant
BKPyV Urine Liver 22.89 1001 2009 Jan 07, 3 mo after transplant
BKPyV Urine Kidney 34.41 2002 2010 May 13, 8 mo after transplant
BKPyV NP Kidney 35.93 2002 2010 Mar 04, 6 mo after transplant
BKPyV Feces Kidney 33.15 2002 2010 Mar 04, 6 mo after transplant
BKPyV Feces Liver 33.33 1001 2008 Dec18, 2 mo after transplant
BKPyV Feces Liver 34.84 1001 2009 Jan 07, 3 mo after transplant

*Ct, cycle threshold; ID, identification; HPyV, human polyomavirus; BMT, bone marrow transplant; NP, nasopharyngeal; KIPyV, KI polyomavirus; MCPyV, Merkel cell polyomavirus; TSPyV, trichodysplasia spinulosa polyomavirus; WUPyV, WU polyomavirus; JCPyV, JC polyomavirus; BKPyV, BK polyomavirus



Article Categories:
  • Dispatch
Article Categories:
  • Dispatch

Keywords: Keywords: transplant, polyomavirus, immunosuppression, Polyomaviridae, viruses, children, pediatric.

Previous Document:  Role of emergency thoracic ultrasonography in spontaneous pneumomediastinum. Two case report.
Next Document:  Simplified Detection of Food-Borne Pathogens: An In Situ High Affinity Capture and Staining Concept.