Phosphate buffered saline (PBS, with or without Ca²⁺ and Mg²⁺) was from Invitrogen. Fatty acid free BSA (BSAfaf), gluthatione agarose beads, fibronectin, 2′,7′-Dichlorofluorescein diacetate (2′,7′-DCF-DA), poly-D-Lysine (PDL), Pertussis toxin and L-α-lysophosphatidylinositol mixture (LPI; 58% C16, 42% C18) were from Sigma. AM251 (N-(Piperidin-1-yl)-5-(4-iodophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3 carboxamide), AM630 (6-Iodo-2-methyl-1-[2-(4-morpholinyl)ethyl]-1H-indol-3-yl](4-methoxyphenyl)methanone), 2-arachidonoylglycerol ((5Z,8Z,11Z,14Z)-5,8,11,14-Eicosatetraenoic acid, 2-hydroxy-1-(hydroxymethyl)ethyl ester) and (−)-cannabidiol (CBD) (2-[(1R,6R)-3-Methyl-6-(1-methylethenyl)-2-cyclohexen-1-yl]-5-pentyl-1,3-benzenediol) were purchased from Tocris Bioscience. The rabbit polyclonal anti-Rac2 antibody was obtained from Santa Cruz and the mouse monoclonal anti-Rac1 antibody was purchased from BD Bioscience. Rabbit monoclonal anti-Cdc42 antibody was from Cell Signaling (Austria). The rabbit anti-human CB₂R antibody (Affinity BioReagents) was a gift from Cristina Sanchez (Complutense University, Madrid, Spain). Mouse anti-human β-actin antibody was obtained from Sigma. Alexa Fluor®-594 goat anti-rat and Alexa Fluor®-488 goat anti-rabbit antibodies were obtained from Molecular Probes. HRP-conjugated goat anti-rabbit, HRP-conjugated goat anti-mouse and HRP-conjugated goat anti-rat antibodies were from Jackson Immuno-Research. Anti-human CD11b-FITC, CD16-FITC and CD16-PE antibodies were obtained from BD Bioscience. Phenylmethylsulfonyl fluoride (PMSF), Aprotinin, Leupeptin and Nonidet P40 were purchased from Roche Applied Science. Cell-permeable C3 toxin was obtained from Cytoskeleton and the ROCK inhibitor Y27632 was purchased from Calbiochem.

The FLAG-CB₂R plasmid was generated by fusing the signaling peptide sequence/FLAG epitope (MKTIIALSYIFCLVFA/DYKDDDDA) N-terminally to the human CB₂R in the pcDNA3.1 (+, Zeo) vector. pGEX-T-PAK N plasmid was kindly provided by Silvio Gutkind from the National Institute of Health (Bethesda, USA). The dominant negative mutants of RhoA (pcDNA3-3xHA-RhoA-T19N) and of Gα₁₃ (pcDNA3-Gα₁₃-Q226L/D294N) were kindly provided by Andrew Irving, University of Dundee (Scotland).

Total RNA was extracted from cells using an RNeasy Mini Kit (QIAGEN). For RT-PCR, total RNA was reverse-transcribed by using the Omniscript RT kit (QIAGEN) with OligodT primers according to manufacturer protocols. PCR was performed using Taq polymerase (Fermentas) and primers for the human GPR55, CB₁R, CB₂R and GAPDH (GPR55 (forward: 5′-CCTCCCATTCAAGATGGTCC-3′; reverse: 5′- GACGCTTCCGTACATGCTGA 3′), CB₁R (forward: 5′-CCTTCCTACCACTTCATCGGC-3′; reverse: 5′- CGTTGCGGCTATCTTTGCG-3′), CB₂R (forward: 5′- GACCGCCATTGACCGATACC-3′; reverse: 5′-GGACCCACATGATGCCCAG-3′) and GAPDH (forward: 5′- ATGGGGAAGGTGAAGGTCG-3′; reverse: 5′-GGGGTCATTGATG-GCAACAATA-3′)). For real time PCR, 1 μg of total RNA was reverse transcribed by using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). PCR was performed in a Mastercycler (Eppendorf) by using a Fast SYBR® Green PCR Master Mix (Applied Biosystems). Standard curves for GPR55, CB₁R and CB₂R were calculated by using the pcDNA3.1 plasmids encoding the respective genes; Ct values were plotted versus gene copy number and absolute mRNA copy number was calculated accordingly. Data analysis of the relative real time PCR was based on the 2^−ΔΔCt method ⁴¹.

Rat polyclonal antibodies were raised as a custom genetic immunization (Genovac, Freiburg, Germany). In order to evoke an immune response, a GENOVAC immunization vector encoding the C-terminal portion (aa 301-327) of mouse GPR55 was applied intradermally to the skin of Wistar rats using a Biorad GeneGun. Sera were tested at 11 weeks by flow cytometry using HEK293-derived BOSC23 cells transiently transfected with a GENOVAC test vector encoding the same protein fragment, and goat anti-rat IgG-RPE (Southern Biotech) as secondary. Final bleeds were taken 91 days after immunization.

Neutrophil migration was evaluated using a 48-well microBoyden chamber (NeuroProbe) with a 5-μm pore-size polycarbonate filter. Ligands (30 μl) were added to the wells of the bottom chamber and neutrophils resuspended in the assay buffer (50 μl; 2×10⁶ cells/ml) were added to the upper chamber and incubation was performed for 1 hour at 37°C. The migrated cells in the bottom wells were counted by flow cytometry. The chemotactic index was defined as the number of cells migrated towards the ligand divided by the number of cells migrated towards 0.01% DMSO as vehicle. In some experiments neutrophils were pre-incubated with DMSO (0.05%), CBD (5 μM) or AM630 (5 μM) for 10 min at 37°C. In assays requiring the inhibition of the Gα-subunits Gα_12/13 or Gα_i, neutrophils were pre-incubated with either C3 toxin (3 μg/ml) or pertussis toxin (PTX, 3 μg/ml), respectively, for 2 hours at 37°C in PBG – buffer.

The respiratory burst of neutrophils was evaluated as previously described ⁴². In brief, neutrophils (2 × 10⁷ cell/ml) suspended in PBG - buffer were stained with an anti-human CD16-PE antibody for 10 min at RT. Cells were then resuspended in the assay buffer and loaded with 1 μM of the non-fluorescent compound, 2′,7′-DCF-DA for 5 min at 37°C. Ligands prepared in the assay buffer were mixed with equal volume of cells and kept at 37°C for 20 min and then fixed with 100 μl of ice-cold fixative (Cell Fix, buffered formaldehyde from Becton-Dickinson). Respiratory burst was immediately analyzed by flow cytometry and measured as an increase in fluorescence in the FL-1 channel. The reactive oxygen species (ROS) production in dHL-60 cells was assessed in a FlexStation™ II device (Molecular Devices, USA). dHL60 cells were seeded on 1% PDL-coated black bottom-clear plates at a density of 2 × 10⁵ cells/well. Cells were loaded with 5 μM of 2′,7′-DCF-DA in the assay buffer for 10 min at 37°C. ROS production was measured as an increase in fluorescence immediately after ligand application and recorded for 20 min, using excitation and emission filters of 485 and 535 nm, respectively.

Release of myeloperoxidase (MPO) was evaluated as previously described ⁴³ with minor modifications. Briefly, cells were incubated with agonists for 1 hour at 37°C at a density of 4 × 10⁶ cell/ml in the assay buffer. Then cells were exposed to 5 μg/ml cytochalasin B followed by incubation with C5a at concentrations indicated for 30 min at 37°C in 96-well microplates. Tetramethylbenzidine (70 μl at 2.8 mM) was added to the plate followed by 60 μl of H₂O₂ (1 mM). The peroxidase enzymatic reaction was stopped after 1 min by addition of 50 μl of acetic acid (4 M) including 10 mM sodium azide. MPO levels were determined in a microplate reader (Bio-Rad) at 630 nm.

The GST-fusion protein pGEX-T-PAK N containing the p21-activated-kinase domain (PAK) for Rac1, Rac2 and Cdc42 was expressed in XL BLUE Top 10 E. coli and bound onto gluthatione agarose beads ⁴⁴. Neutrophils and HL60 cells were prewarmed to 37°C for 10 min in the assay buffer. Cells were stimulated with 1 μM of ligand for the time points indicated and immediately lysed on ice for 10 min in lysis buffer (50 mM Tris-HCl, 200 mM NaCl, 10 mM MgCl₂, 1 mM DTT, 1 mM PMSF, 10 μg/ml aprotinin, 10 μg/ml leupeptin, 5% glycerol and 1% Nonidet P-40). Cleared lysates were incubated with 30 μg of pre-chilled PAK-gluthatione agarose beads for 30 min at 4°C, washed extensively and eluted in SDS sample buffer at 90°C for 5 min. Samples were resolved on 16% Tris-glycine precast gels and electroblotted onto polyvinylidene fluoride (PVDF) membranes (Millipore). Blots were blocked in TBST buffer (1 mM CaCl_2, 136 mM NaCl, 2.5 mM KCl, 25 mM Tris-HCl, 0.1% (v/v) Tween 20), containing 5% non-fat dry milk for 1 hour and then incubated with anti-Rac1 (1:4000), anti-Rac2 (1:1000) or anti-Cdc42 (1:1000) antibodies at 4°C overnight. After washing, blots were incubated for 2 hours with either HRP-conjugated goat anti-rabbit (1:4000) or HRP-conjugated goat anti-mouse (1:4000) antibodies and proteins were visualized using ECL Western Blotting Substrate (Pierce Thermo Fisher Scientific).

Confluent 10-cm dishes of HEK293 cells, 1×10⁷ HL-60 cells or neutrophils were washed twice in ice-cold PBS and lysed on ice in 800 μl of IPB lysis buffer containing 10 mM Tris-HCl pH 7.4, 150 mM NaCl, 25 mM KCl, 1 mM CaCl₂, 0.1% Triton X-100 and protease inhibitors (Roche Applied Science). After centrifugation, supernatants were collected and resolved by SDS/PAGE using 4-20% Tris-Glycine precast gels (Invitrogen). After transfer to polyvinylidene difluoride membrane (Millipore, USA), blots were blocked in TBST buffer (1 mM CaCl_2, 136 mM NaCl, 2.5 mM KCl, 25 mM Tris-HCl, 0.1% (v/v) Tween 20) containing 1% BSA (for GPR55) or 5% BSA (for CB₂R) and incubated with the rat anti-GPR55 (1:1000) or rabbit anti-CB₂R (1:1000) antibodies overnight at 4°C. Blots were then incubated with HRP-conjugated goat anti-rat (1:4000; Jackson ImmunoResearch) or HRP-conjugated goat anti-rabbit (1:5000; Jackson ImmunoResearch) antibodies for 2 hours at RT. Blots were re-probed for β-actin with a mouse anti-human β-actin antibody (1:4000) followed by HRP-conjugated goat anti-mouse antibody (1:4000; Jackson ImmunoResearch). Receptors and β-actin were visualized by Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific).

Transcription factor luciferase assays were performed essentially as described previously ¹⁸, ²¹. In brief, HEK-CB₂R/GPR55 cells (20,000 cells/well) were seeded on 1% PDL coated 96-well plates and transiently transfected with the cis-reporter plasmid (PathDetect; Stratagene) for NFAT (200 ng/well) using Lipofectamine 2000. 24 hours post-transfection, cells were incubated for 3 h in serum-free OptiMEM medium at 37°C with ligands at the indicated concentrations. Luciferase activity was visualized as previously described ¹⁸, ⁴⁵.

DMR assays were performed as previously described ²¹, ⁴⁶, ⁴⁷. In brief, 48 hours before the assay, HEK-CB₂R/GPR55 cells were seeded at a density of 7500 cells per well in 384-well Epic® sensor microplates with 30 μl growth medium (DMEM, 10% FCS) and cultured for 24 hours (37°C, 5% CO₂). Cells were serum starved in 30 μl of starvation medium [Hank’s buffered salt solution (HBSS) with 20 mM HEPES, pH 7.15] for 24 hours. Prior to the assay, cells were washed once with assay buffer [HBSS with 20 mM HEPES and 0.1% bovine serum albumin, fatty acid free (BSAfaf), pH 7.15] and incubated in 30 μl per well of assay-buffer in the Epic® reader at 28°C. Hereafter, the sensor plate was scanned and a baseline optical signature was recorded. Ten μl of ligands at indicated concentrations, dissolved in the assay buffer, were added to the cells and DMR responses were monitored for at least 3600 s. The analysis of DMR data was performed as previously described ²¹, ⁴⁶, ⁴⁷. Data were normalized and expressed as percent of maximum activation induced by concomitant addition of LPI and 2-AG.

Images were analyzed using an OLYMPUS fluorescence microscope equipped with a Hamamatsu ORCA CCD camera or a Zeiss LSM510 META Axioplan confocal microscope with Plan-Apochromat 1.4 Oil DIC objectives. Flow Cytometry analyses were performed in a FACSCalibur flow cytometer (Becton Dickinson).

For quantification of active GTP-bound GTPases to total GTPase levels, data generated in at least three independent blots were analyzed using Image J software (NIH). Statistical analysis were performed using one-way ANOVA with Tukey post-test and P values less than 0.05 were considered significant. GraphPad Prism Software, version 4.03 (GraphPad Software, Inc.) was used for these analyses.

It has previously been suggested that there is a site distinct from CB₁R and CB₂R, which interferes with CB₂R-mediated migration in human blood neutrophils and that this site could be GPR55 ³¹. In addition, another recent study showed that the highly metastatic MDA-MB231 breast cancer cell line expresses GPR55 and migrates efficiently towards LPI ⁴⁸. Therefore, we set out to determine the effects of LPI on the migration of neutrophils. As Fig. 1Ai shows, neutrophils readily migrated towards a gradient of LPI (Fig. 1Ai,■). Likewise, the more stable synthetic cannabinoid GPR55 agonist and CB₁R antagonist AM251 ²¹ induced a concentration-dependent migration of neutrophils (Fig. 1Ai,●). The chemotactic properties of these ligands were comparable to that of the CB₂R agonist 2-AG (Fig. 1Ai,◆). Next, we tested whether the migration of neutrophils towards either LPI or 2-AG could be blocked by pretreating the cells with selective receptor antagonists. Pre-incubation of neutrophils with 5 μM of either the GPR55 antagonist cannabidiol ⁴⁹ (Fig. 1Aii, CBD) or the selective CB₂R antagonist AM630 (Fig. 1Aii, 5 μM) for 10 minutes significantly diminished the migratory properties of neutrophils towards LPI (3 μM) or 2-AG (1 μM), respectively. In contrast, neutrophil migration was not impaired when cells were pretreated with the ‘wrong’ antagonists, i.e. 5 μM of CBD followed by 1 μM 2-AG stimulation or 5 μM AM630 followed by 3 μM LPI stimulation, respectively (data not shown).

In most of the previous studies, 2-AG has been used alone ¹², ³⁵ or in combination with chemokines to induce neutrophil migration ¹⁴, ⁵⁰. Since both 2-AG and LPI are endogenous lipid mediators released by stimulated macrophages ⁷, ²⁹, ³⁰, ⁵¹, we investigated the concomitant effect of 2-AG and LPI on the migration of neutrophils. LPI (3 μM) and 2-AG (1 μM) showed a significant impact on neutrophil migration, when compared to LPI or 2-AG alone (Fig. 1Aiii). More prominently, the migration of neutrophils towards AM251 (3 μM), when combined with 2-AG (1 μM), was synergistically enhanced compared to neutrophils migrating towards AM251 or 2-AG alone (Fig. 1Aiv). These effects could be significantly diminished by pretreating the cells with the GPR55 antagonist CBD (5 μM), the CB₂R antagonist AM630 (5 μM) or a combination of both for 10 min (Fig. 1Av).

In response to chemokines, neutrophils undergo cytoskeletal rearrangement and shape change, which culminates in cellular polarization and thereby enables the cells to migrate efficiently ⁵². We hence next assessed the cytoskeletal rearrangement of neutrophils in response to a five-minute exposure to LPI or 2-AG alone, or a combination thereof. Cytoskeletal rearrangement was assessed by F-actin phalloidin staining. In neutrophils treated with vehicle, actin was found at the periphery of the cells, which had a round spherical shape (Fig. 1Bi). LPI (3 μM) induced random non-directional protrusions in the neutrophils (Fig. 1Bii, arrows). Consistent with previous reports ¹⁴, treatment of neutrophils with 2-AG (1 μM) resulted in an elongation of cells, however, without showing the characteristic polarity of migrating leukocytes (Fig. 1Biii, arrows). Only when neutrophils were concomitantly incubated with a gradient of LPI (3 μM) and 2-AG (1 μM), the typical polarity of migrating neutrophils – i.e. extending head (arrow) and retracting tail (dashed arrow) - could be detected (Fig. 1Biv). This effect was not due to the higher concentration of the combined ligands per se, since up to 5 μM, neither LPI nor 2-AG alone could evoke the same cytoskeletal rearrangement (data not shown) but it was dependent on the gradient of compounds (see Fig. 1C).

When LPI (3 μM) and 2-AG (1 μM) were simultaneously applied to the media using the top of a narrow tip (Fig. 1Ci, white dot), a directional movement towards the source of ligands was observed. The uniform addition of ligands into the culture medium, however, did not evoke any shape change in the neutrophils (Fig. 1Cii). Likewise, when tested in a boyden-migration assay, no migration of neutrophils could be observed in the absence of a ligand gradient (Fig. S1).

Taken together, these data show that LPI, AM251 or 2-AG alone could each evoke neutrophil migration - albeit to a lesser extent than when used in combination - and without inducing the typical morphology of migrating neutrophils. In fact, only the combination of LPI and 2-AG evoked a strong migratory response in human blood neutrophils via the establishment of a rear-front asymmetric morphology.

Next, we investigated the expression of the cannabinoid receptors CB₁ and CB₂ as well as that of GPR55 in human blood neutrophils at both mRNA and protein levels. It has previously been reported that the pattern of expression levels of CB₁ and CB₂ receptors in neutrophils depends on the isolation procedure ⁵³, ⁵⁴, ⁵⁵. Here we used an untouched, non-column based system at room temperature in the absence of Ca²⁺ and Mg²⁺ ions to prevent a stimulation of the cells. GPR55 mRNA copy numbers (Fig. 2Ai, black bar) were significantly higher than those of the CB₂R (Fig. 2Ai, white bar). Indeed, both CB₂R and GPR55 mRNA could also be detected by RT-PCR (Fig. 2Aii). The CB₁R was not detectable in either RT-PCR or real time PCR (data not shown). In addition, we tested the expression of GPR55 on differentiated neutrophil-like HL60 cells (dHL60), which expressed the differentiation marker CD11b at levels comparable to those of neutrophils (Fig. S2). Real time PCR showed a 5.5-fold increase in GPR55 mRNA levels in dHL60 cells (Fig. 2Aiii, black bar) compared to undifferentiated HL60 cells (uHL60) (Fig. 2Aiii, white bar).

We next assessed the protein levels and cellular expression of both GPR55 and CB₂ receptors in neutrophils, as well as in uHL60 and dHL60 cells. Human embryonic kidney (HEK293) cell lines stably expressing the CB₂ receptor (HEK-CB₂R), the GPR55 receptor (HEK-GPR55) ¹⁸alone or in combination with the CB₂ receptor (HEK-CB₂R/GPR55) served as controls. Using antibodies specifically targeting the respective receptors, we found that GPR55 and CB₂R proteins were expressed in neutrophils, uHL60 and dHL60 cells at the appropriate protein sizes (Fig. 2Bi, ~ 37 kDa for GPR55 and ~ 45 kDa for CB₂R). The specificity of the antibodies was confirmed by western blot using the lysates from HEK293, HEK-GPR55, HEK-CB₂R and HEK-CB₂R/GPR55 cells. As Fig. 2Bii shows, the antibodies reacted with their respective targets only. Moreover, we confirmed the expression of GPR55 in freshly isolated neutrophils and HL60 cells by immunofluorescence using the rat anti-GPR55 antibody (Fig. 2C). As observed in other primary cells ⁵⁶, GPR55 was predominantly found intracellulary in both neutrophils and HL60 cells. This staining was specific, since only HEK-GPR55 cells, but not untransfected HEK293 cells showed a positive immunoreactivity with the rat anti-GPR55 antibody (Fig. S3).

It has been demonstrated that GPR55 mediates its downstream signaling events via Gα₁₃ and the RhoA small GTPase in HEK293 cells ¹⁵, ¹⁸, ¹⁹. In addition, we recently showed that - among all Gα subunits - GPR55 couples solely to Gα₁₃ in HEK293 cells ⁴⁶. In order to test which Gα protein subunits are involved in the GPR55 and CB₂R mediated signaling effects in neutrophils we used the toxins C3 and Pertussis toxin to inhibit the activity of Gα₁₃/RhoA and Gα_i, respectively. Pre-incubation of neutrophils with C3 toxin (3 μg/ml, 2 hours) significantly inhibited the LPI-induced migration of neutrophils, but showed no effect on the 2-AG-stimulated migration (Fig. 3Ai & 3Aii). On the other hand, Pertussis toxin (3 μg/ml, 2 hours) prevented the migration of neutrophils towards 2-AG, but had no significant effect on LPI-induced migration (Fig. 3Ai & 3Aii). Furthermore, migration of neutrophils towards a combination of LPI and 2-AG was significantly inhibited when the cells were pre-incubated with either C3 or Pertussis toxin (Fig. 3Aiii).

Next, we tested whether the impact of these inhibitors on neutrophil migration was due to an impairment of cytoskeletal remodeling. C3 toxin (3 μg/ml, 2 hours) inhibited the formation of protrusions induced by LPI (compare Figs. 3Bvi & 3Bii), but had no effect on the elongated morphology of 2-AG-treated neutrophils (compare Figs. 3Bvii & 3Biii). Moreover, inhibition of RhoA prevented the polarization of neutrophils in response to a combination of LPI and 2-AG (compare Figs. 3Bviii & 3Biv). Pertussis toxin (3 μg/ml, 2 hours) inhibited the elongation of 2-AG-stimulated cells (compare Figs. 3Bxi & 3Biii), but did not affect the non-directional protrusions stimulated by LPI (compare Figs. 3Bx & 3Bii). Inhibition of Gα_i signaling abrogated the polarized head/tail morphology of neutrophils upon treatment with a combination of LPI and 2-AG (compare Figs. 3Bxii and 3Biv).

Summarized, the exclusive inhibitory effects either i) of C3 toxin on GPR55-mediated responses or ii) of Pertussis toxin on CB₂R-mediated responses, provide evidence for the involvement of Gα₁₃/RhoA in GPR55 mediated and Gα_i in CB2R mediated signaling in neutrophils.

The migration of leukocytes towards chemotactic agents occurs through a coordinated series of events, typically including a cytoskeletal rearrangement that relies on the function of the Rho family of small GTPases ⁵⁷. For instance, neutrophil-like dHL60 cells have been reported to elongate in response to CB₂R agonists (i.e. JWH015 and 2-AG), thereby activating Rac1 and Cdc42, whilst repressing RhoA ¹⁴. However, under these conditions, dHL60 cells did not show the typical rear/front polarity of chemotaxing neutrophils.

We tested whether Rac1 and Cdc42 were differentially activated by either LPI, 2-AG or the combined application of both ligands in neutrophils. Consistent with previous reports of GPR55-mediated Rac1 activation in HEK293 cells ¹⁵, LPI (1 μM) induced a rapid – albeit modest - activation of Rac1 in neutrophils (Figs. 4Ai, lane 2). 2-AG (1 μM) induced a rapid and significant increase in activated Rac1 (Fig. 4Aii, lane 3), whereby a maximum of Rac1 activity was reached within 60 seconds (Fig. S4). This time-frame of activation is consistent with CB₂R-mediated Rac1 activation in dHL60 cells ¹⁴. However, the incubation of neutrophils with both LPI and 2-AG did not result in a synergistic activation of Rac1 (Fig. 4Ai, lane 4).

Activated Cdc42 was reported to be involved in the polarization and directional migration of neutrophils ⁵⁸. Again, 1 μM LPI induced a modest activation of Cdc42 (Fig. 4Aii, lane 2), whereas 1 μM 2-AG was able to promote GTP-binding to Cdc42 in neutrophils within one minute (Fig. 4Aii, lane 3). Interestingly, incubation of neutrophils with both agonists led to a further increase in Cdc42 activity compared to 2-AG alone (Fig. 4Aii, lane 4).

In summary, only the combined application of both the GPR55 agonist LPI and the CB₂R agonist 2-AG potentiated Cdc42 activity. This process may thus underlie the polarized morphology (see Figs. 1Biv and 4A, top of lane 4) and the trafficking of neutrophils towards a gradient of both ligands (see Fig. 1Aiii).

Next, we wanted to test the extent to which each of the respective receptors - i.e. GPR55 or CB₂R - are involved in the formation of RhoA dependent F-actin. Since the short life-time of purified neutrophils does not allow for manipulations such as siRNA knockdown, we took advantage of HEK293 cells stably expressing these receptors alone, or a combination thereof. We and others have previously shown that in HEK293 cells, GPR55 stimulation leads to the activation of RhoA, Rac1 and Cdc42 ¹⁵, ¹⁸.

The GPR55 agonist LPI (1 μM, 10 min) induced prominent F-actin fibers in HEK-GPR55 (Fig. 4Biv) but not in HEK-CB₂R cells (Fig. 4Bv). This effect was dependent on the activity of the Gα₁₃/RhoA axis, since the transient transfection of HEK-GPR55 cells with dominant negative mutants of Gα₁₃ (Fig. S5i) and RhoA (Fig. S5ii) or a 10-minute pretreatment with 10 μM of the ROCK inhibitor Y27632 (Fig. S5iii) prevented actin polymerization in response to 1 μM of LPI. Surprisingly, GPR55-mediated F-actin formation was modestly attenuated in the presence of non-activated CB₂R in HEK-CB₂R/GPR55 cells (Fig. 4Bvi).

The CB₂R agonist 2-AG (1 μM) could not induce actin rearrangement in the HEK-GPR55 cells (Fig. 4Bvii), but led to some accumulation of polymerized actin in the periphery of HEK-CB₂R cells (Fig. 4Bviii, arrows). This effect could also be observed in HEK-CB₂R/GPR55 cells (Fig. 4Bix, arrow). Treatment of HEK-CB₂R/GPR55 cells with both LPI (1 μM) and 2-AG (1 μM) drastically increased the formation of filamentous actins (Fig. 4Bxii) when compared with LPI (Fig. 4Bvi) or 2-AG (Fig. 4Bix) alone. Co-administration of LPI and 2-AG did not show a change in actin formation in HEK-GPR55 (Fig. 4Bx) or HEK-CB₂R (Fig. 4Bxi) cells compared to treatment of these cells with any of the agonists alone (compare Figs. 4Bx & 4Biv and 4Bxi & 4Bviii, respectively).

We have recently shown that in HEK293 cells, the stimulation of GPR55 triggers multiple signaling pathways, eventually leading to the activation of transcription factors such as the nuclear factor of activated T cells (NFAT), the nuclear factor-κB (NF-κB) and the cAMP responsive element binding (CREB) protein ²¹. Moreover, we have reported that GPR55-mediated NFAT activation is crucially dependent on the function of RhoA ¹⁸. Hence, we next tested whether NFAT-transcription factor activity was differentially regulated in the presence of activated GPR55 and/or CB₂ receptors in our HEK-CB₂R/GPR55 cell model. Concomitant activation of GPR55 and CB₂R with LPI (1 μM) and 2-AG (1 μM) led to a significant enhancement of NFAT-activation when compared to cells stimulated with 1 μM of LPI only (Fig. 4Ci, compare light grey and black bars). 2-AG (1 μM) did not induce NFAT activity in HEK-CB₂R/GPR55 cells (Fig. 4Ci, dark grey bar). This was expected, since CB₂ receptors typically mediate their signaling events predominantly through Gα_i-pathways, which have not been reported to induce NFAT-activity. In order to test the signaling events in the HEK-CB₂R/GPR55 on a more ‘global’ scale, we subjected our cells to a Dynamic Mass Redistribution Assay (DMR, Epic®). We have previously reported the suitability of this system for label free measurement of signaling events in both GPR55 ²¹ and Gα_i-coupled 7TM/GPCRs ⁴⁶. In fact, similar to our findings in the NFAT-assay, concomitant activation of GPR55 and CB₂R with LPI (1 μM) and 2-AG (1 μM) led to a significantly higher DMR response in these cells when compared to cells stimulated with 1 μM of LPI only (Fig. 4Cii, compare light grey and black bars). Again, 2-AG (1 μM) alone did not induce any DMR in HEK-CB2R/GPR55 cells (Fig. 4Cii, dark grey bar).

In summary, these data suggest that the LPI-induced activation of GPR55 is critical for the RhoA dependent rearrangement of the actin cytoskeleton and downstream signaling events such as activation of the transcription factor NFAT. However, these effects are enhanced in the presence of a 2-AG activated CB₂ receptor.

A dramatic increase in reactive oxygen species (ROS) levels - known as the “ respiratory burst” - is a mechanism used by neutrophils to resolve infection. This process is catalyzed by the NADPH oxidase complex ⁵⁹ and is regulated by the small GTPase Rac2 ³⁸. In neutrophils and HL60 cells, 2-AG and the complement component 5a (C5a) have been reported to activate Rac2 via their cognate Gα_i-coupled receptors, i.e. the CB₂R and the C5aR ¹⁴, ⁶⁰, ⁶¹. Here, we tested whether the activation of GPR55 and CB₂ receptors had an effect on ROS production in neutrophils.

GPR55 agonists LPI (300 nM) or AM251 (300 nM) did not induce ROS production in neutrophils per se (Figs. 5Ai and 5Aii, light grey bars). In contrast, 2-AG (10 μM) induced ROS production in neutrophils (Figs. 5Ai and 5Aii, dark grey bars), an effect that could be inhibited with 10 μM of the selective CB₂R antagonist AM630 (Fig. S6). Interestingly, 2-AG-induced ROS production was significantly diminished when neutrophils were concomitantly stimulated with LPI (300 nM) or AM251 (300 nM) (Figs. 5Ai and 5Aii, black bars). This effect was dose dependent (Fig. 5Aiii, 100 nM – 300 nM LPI) and could also be observed in neutrophils activated with C5a (Fig. 5Aiii). Similar to neutrophils, we observed that ROS formation by 2-AG (10 μM) was significantly inhibited by co-administration of LPI (Fig. 5Aiv) in dHL60 cells, although higher concentrations of LPI (1 μM – 10 μM) were needed to see an effect. However, like in neutrophils, LPI alone could not induce ROS production in dHL60 cells (Fig. 5Aiv).

Summarized, these data show that - once activated - GPR55 prevented the formation of CB₂R-mediated reactive superoxide in both neutrophils and dHL60 cells.

In order to be able to destroy infectious agents, neutrophils store a large number of enzymes in azurophilic granules ³. Upon activation by C5a and/or other inflammatory mediators, these granules release their enzymes – e.g. myeloperoxidase (MPO) - to the milieu ³. Since activated GPR55 could block C5a-mediated ROS production in neutrophils (Fig. 5Aiii), we next tested whether LPI could likewise modify C5a-induced MPO release. In fact, pretretment of neutrophils with 300 nM of LPI for 1 hour (Fig. 5Bi, black bars) significantly inhibited the MPO release triggered by different concentrations of C5a (Fig. 5Bi, white bars). Increasing doses of LPI reduced MPO release mediated by 300 nM of C5a up to a maximum of 75% (Fig. 5Bii). No MPO release was observed when neutrophils were incubated with LPI alone (Fig. 5Bi, black bar at 0 concentration of C5a). Thus, activated GPR55 can prevent C5a-mediated degranulation of neutrophils.

It has frequently been reported that the small GTPase Rac2 regulates the degranulation and NADPH oxidase activity in neutrophils via its translocation to the plasma membrane and incorporation in the NADPH oxidase complex ⁶⁰, ⁶². In addition, JWH015, a synthetic CB₂R-specific agonist was shown to activate Rac2 in dHL60 cells and primary neutrophils ¹⁴. To see whether the GPR55-mediated inhibition of ROS production and degranulation is dependent on Rac2, we investigated the activation and translocation of Rac2 in response to both GPR55 and CB₂R agonists in neutrophils and dHL60 cells.

Treatment of neutrophils with LPI (1 μM) for 1 min reduced the activity of Rac2 when compared to vehicle (Fig. 6A, lanes 1 and 2). In contrast, 2-AG (1 μM) resulted in a significant activation of Rac2 (Fig. 6A, lane 3), which reached the highest activity at 1 min and returned to its basal activity after 2 minutes (Fig. S7). However, concomitant stimulation of neutrophils with 2-AG (1 μM) and LPI (1 μM) resulted in a significant inhibition of Rac2 activity when compared to cells treated with 2-AG alone (Fig. 6A, compare lanes 3 and 4). Likewise, in dHL60 cells Rac2 activity was reduced in the presence of 1 μM LPI (Fig. 6B, lane 2) and enhanced in the presence of 1 μM 2-AG (Fig. 6B, lane 3). Again, in the presence of both ligands, the Rac2 GTPase activity was reduced when compared to dHL60 cells treated with 2-AG alone (Fig. 6B, compare lanes 3 and 4).

The function of Rac2 in ROS production and degranulation is dependent on its translocation from the nuclear and/or perinuclear zones to the plasma membrane. In neutrophils, Rac2 was mainly located in or closely around the nucleus (Fig. 6Ci, arrow, Rac2 in green, DAPI/nuclear staining in blue). Treatment of neutrophils with 3 μM of LPI did not alter the perinuclear distribution of Rac2 (Fig. 6Cii, arrow). In contrast, stimulation of neutrophils with 2-AG (1 μM) induced a redistribution of Rac2 to the cytosol (Fig. 6Ciii, green, arrow) and partly resulted in a colocolization with the peripheral actin (Fig. 6Ciii, yellow, arrowhead). This effect, however, could be prevented by concomitant application of 3 μM LPI with 1 μM 2-AG, showing a perinuclear distribution of Rac2 in these cells (Fig. 6Civ, arrow).

In summary, these data suggest that GPR55 regulates both ROS and MPO production in neutrophils via suppressing the activity of the small GTPase Rac2.