Document Detail


Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response.
MedLine Citation:
PMID:  25493381     Owner:  NLM     Status:  Publisher    
Abstract/OtherAbstract:
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Authors:
N N Dang; S G Pang; H Y Song; L G An; X L Ma
Publication Detail:
Type:  JOURNAL ARTICLE     Date:  2014-11-14
Journal Detail:
Title:  Brazilian journal of medical and biological research = Revista brasileira de pesquisas medicas e biologicas / Sociedade Brasileira de Biofisica ... [et al.]     Volume:  48     ISSN:  1414-431X     ISO Abbreviation:  Braz. J. Med. Biol. Res.     Publication Date:  2015 Jan 
Date Detail:
Created Date:  2014-12-10     Completed Date:  -     Revised Date:  2014-12-11    
Medline Journal Info:
Nlm Unique ID:  8112917     Medline TA:  Braz J Med Biol Res     Country:  -    
Other Details:
Languages:  ENG     Pagination:  39-45     Citation Subset:  -    
Export Citation:
APA/MLA Format     Download EndNote     Download BibTex
MeSH Terms
Descriptor/Qualifier:

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine


Previous Document:  More than 10 years survival with sequential therapy in a patient with advanced renal cell carcinoma:...
Next Document:  Analysis of heart rate control to assess thermal sensitivity responses in Brazilian toads.