Document Detail

Fetal haemoglobin response to hydroxycarbamide treatment and sar1a promoter polymorphisms in sickle cell anaemia.
Jump to Full Text
MedLine Citation:
PMID:  18318767     Owner:  NLM     Status:  MEDLINE    
The hydroxycarbamide (HC)-inducible small guanosine triphosphate (GTP)-binding protein, secretion-associated and RAS-related (SAR) protein has recently been shown to play a pivotal role in HBG induction and erythroid maturation by causing cell apoptosis and G1/S-phase arrest. Our preliminary analysis indicated that HC inducibility is transcriptionally regulated by elements within the SAR1A promoter. This study aimed to assess whether polymorphisms in the SAR1A promoter are associated with differences Hb F levels or HC therapeutic responses among sickle cell disease (SCD) patients. We studied 386 individuals with SCD comprised of 269 adults treated with or without HC and 117 newborns with SCD identified from a newborn screening program. Three previously unknown single nucleotide polymorphisms (SNPs) in the upstream 5'UTR (-809 C>T, -502 G>T and -385 C>A) were significantly associated with the fetal haemoglobin (HbF) response in Hb SS patients treated with HC (P < 0.05). In addition, four SNPs (rs2310991, -809 C>T, -385 C>A and rs4282891) were significantly associated with the change in absolute HbF after 2 years of treatment with HC. These data suggest that variation within SAR1A regulatory elements might contribute to inter-individual differences in regulation of HbF expression and patient responses to HC in SCD.
Chutima Kumkhaek; James G Taylor; Jianqiong Zhu; Carolyn Hoppe; Gregory J Kato; Griffin P Rodgers
Related Documents :
21941277 - Discovering pluripotency: 30 years of mouse embryonic stem cells.
17652787 - Optimal conditions for cryopreservation of primary chicken embryo kidney cells with dim...
21258487 - Optical injection of mammalian cells using a microfluidic platform.
2370297 - The effect of hyperthyroidism on in vivo aging of erythrocyte ouabain-binding sites and...
17046737 - A critical role for the epha3 receptor tyrosine kinase in heart development.
8205537 - Functional insulin and insulin-like growth factor-1 receptors are preferentially expres...
Publication Detail:
Type:  Journal Article; Research Support, N.I.H., Intramural     Date:  2008-03-03
Journal Detail:
Title:  British journal of haematology     Volume:  141     ISSN:  1365-2141     ISO Abbreviation:  Br. J. Haematol.     Publication Date:  2008 Apr 
Date Detail:
Created Date:  2008-03-20     Completed Date:  2008-06-11     Revised Date:  2013-06-05    
Medline Journal Info:
Nlm Unique ID:  0372544     Medline TA:  Br J Haematol     Country:  England    
Other Details:
Languages:  eng     Pagination:  254-9     Citation Subset:  IM    
Molecular and Clinical Hematology Branch, NIDDK, NIH, Bethesda, MD, USA.
Export Citation:
APA/MLA Format     Download EndNote     Download BibTex
MeSH Terms
Anemia, Sickle Cell / blood,  drug therapy*,  genetics
Antisickling Agents / therapeutic use*
Fetal Hemoglobin / metabolism*
Hydroxyurea / therapeutic use*
Infant, Newborn
Monomeric GTP-Binding Proteins / genetics*
Polymorphism, Single Nucleotide
Promoter Regions, Genetic / genetics
Grant Support
Reg. No./Substance:
0/Antisickling Agents; 127-07-1/Hydroxyurea; 9034-63-3/Fetal Hemoglobin; EC 3.6.1.-/SAR1A protein, human; EC GTP-Binding Proteins

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine

Full Text
Journal Information
Journal ID (nlm-ta): Br J Haematol
Journal ID (publisher-id): bjh
ISSN: 0007-1048
ISSN: 1365-2141
Publisher: Blackwell Publishing Ltd
Article Information
Download PDF
Journal compilation ? 2008 Blackwell Publishing Ltd No claim to original US government works
Received Day: 21 Month: 11 Year: 2007
Accepted Day: 05 Month: 12 Year: 2007
Print publication date: Day: 01 Month: 4 Year: 2008
Volume: 141 Issue: 2
First Page: 254 Last Page: 259
ID: 2344124
PubMed Id: 18318767
DOI: 10.1111/j.1365-2141.2008.07045.x

Fetal haemoglobin response to hydroxycarbamide treatment and sar1a promoter polymorphisms in sickle cell anaemia
Chutima Kumkhaek1
James G Taylor, VI2
Jianqiong Zhu1
Carolyn Hoppe3
Gregory J Kato24
Griffin P Rodgers1
1Molecular and Clinical Hematology BranchNIDDK, NIH, Bethesda, MD
2Pulmonary and Vascular Medicine BranchNHLBI, NIH, Bethesda, MD
3Department of Hematology/Oncology, Children's Hospital and Research Center at OaklandOakland, CA
4Critical Care Medicine, Clinical CenterNIH, Bethesda, MD, USA
Correspondence: Correspondence: Griffin P. Rodgers, Molecular and Clinical Hematology Branch, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, 10 Center Dr. Rm 9N115, Bethesda, MD 20892, USA. E-mail:

Reactivation of fetal haemoglobin (HbF) expression in adult life could provide an effective therapeutic approach for patients with haemoglobinopathies and thalassaemias. Among HbF induction agents, hydroxycarbamide (HC) has been successfully used to treat sickle cell disease (SCD) and selected thalassaemia syndromes (Rodgers et al, 1990; Zeng et al, 1995; Fucharoen et al, 1996). Hydroxycarbamide is believed to exert its beneficial effects in SCD via a variety of mechanisms, including augmented HbF synthesis by erythroid regeneration or NO-related increases in soluble guanylate cyclase activity and cyclic guanidine monophosphate (cGMP) that stimulate HBG expression (Cokic et al, 2003). Additional mechanisms may also include myelosuppression with a reduction in circulating neutrophils, increased erythrocyte water content, modified erythrocyte endothelial cell interactions and altered vascular tone by increasing NO bioavailability (Okpala, 2005). Many patients treated with HC increase HbF levels from baseline, with wide variability in the magnitude of this response. The underlying reasons for this spectrum of HC responsiveness are poorly understood (Steinberg et al, 1997; Bakanay et al, 2005).

Presently, a major research priority is the identification of genetic variants underlying both human diseases and differences in pharmacological responsiveness to drugs (Collins et al, 2003). In SCD, this paradigm is being applied to elucidate the pathogenesis of vaso-occlusive and vascular complications and to develop individualized SCD therapies (Steinberg, 2005). Genetic variants in drug-metabolizing enzymes, transporters or targets could potentially influence the efficacy or toxicity of drugs used in SCD. The HC-induced small guanosine triphosphate (GTP)-binding protein, secretion-associated and RAS-related (SAR) protein has recently been shown to play a pivotal role in HBG induction by causing cell apoptosis and G1/S-phase arrest by reduction of phosphatidylinositol 3 (PI3) kinase and extracellular protein-related kinase (ERK) phosphorylation with increased p21 and GATA-2 expression (Tang et al, 2005).

SAR1A belongs to the small GTPase superfamily and encodes a GTP-binding protein SAR1a. This protein plays a key role in initializing transport from the endoplasmic reticulum (ER) to the Golgi apparatus. The localization of SAR1A in the endoplasmic reticulum and its association with HBG expression demonstrated in our recent study suggest that SAR1A also plays a special role in haemoglobin regulation (Tang et al, 2005). However, the precise pathway(s) through which SAR1A regulates HBG remain unknown. SAR1A may increase the transport of membrane-bound transcription factor precursors from the ER to the Golgi. The proteolytic cleavage of the precursor proteins in the Golgi activate cytosolic fragments that enter the nucleus and regulate erythroid-specific transcription factors, such as GATA, eventually modulating HBG expression. Moreover, previous studies have illuminated a pivotal role of the p38 mitogen-activated protein kinase (MAPK) pathway during GTP-mediated erythroid differentiation of K562 cells with the accumulation of HBG mRNA (Osti et al, 1997; Moosavi et al, 2007). Activators of the soluble guanylate cyclase (sGC) and protein kinase G (PKG) pathways have been implicated in the regulation of HBG expression in both erythroleukemic cells and in primary erythroblasts (Ikuta et al, 2001). Expression of HBG and the sGC alpha subunit are correlated, indicating that GTP-binding proteins may participate in HBG induction.

Preliminary data from our study indicated that HC inducibility is transcriptionally regulated and localized to elements in the SAR1A promoter. Accordingly, we hypothesized that DNA sequence variation within the SAR1A promoter might explain differences in individual responses to HC therapy. To test this hypothesis, we identified the single nucleotide polymorphism (SNPs) in the SAR1A promoter by DNA sequencing and examined these variants in an association study of sickle cell anaemia patients treated with HC.

Materials and methods

DNA samples and laboratory data were from unrelated individuals with SCD who enrolled in a Sickle Cell Pulmonary Hypertension Screening Study at the National Institutes of Health (NIH) and Howard University ( Identifier: NCT00011648). The study had enrolled 282 subjects as of December, 2005, of which 269 had sufficient clinical data for inclusion in the present study (Taylor et al, 2008). All subjects were at least 18 years of age and provided written informed consent for participation in this Institutional Review Board (IRB) approved protocol. Cases and controls were defined as adults with SCD who were treated with or without HC respectively. Additionally, 32 of these 269 subjects had quantitative high performance liquid chromatography (HPLC) HbF measurements and other laboratory values determined prior to and during HC therapy. The mean length of follow-up evaluation for patients with HbF measured at the end of the study was 21 months (maximum, 33 months; minimum, 8 months). DNA was also available from 117 newborns identified with SCD by a state newborn screening program during a single calendar year, where DNA was collected anonymously with prospective exemption from IRB review.

Polymerase chain reaction (PCR) and DNA sequencing

A 2265 base pair fragment which included the SAR1A upstream promoter region, exon 1, and a portion of intron 1 was amplified using gene-specific primers: forward primer, 5? ATGTGCACAACAATGCCTGT 3?; reverse primer, 5? GAAACTGTTATCCGGCCCAG 3?. The PCR conditions were an initial denaturation at 95?C for 3 min, followed by 35 cycles at 95?C for 45 s, 56?C for 1 min and 2 min at 72?C. Finally an additional elongation step was carried out at 72?C for 7 min. The PCR products were purified using QIAquick PCR purification kit (Qiagen, Valencia, CA, USA). Purified PCR products were directly sequenced in both directions by using Big Dye chemistry (Applied Biosystems, Foster City, CA, USA). The BioEdit and Clustal W programs were used to multiple align individual sequences with the reference sequence (GenBank accession number: NT008583 or March, 2006 assembly hg18: chr10:71599909-71602173).

Statistical analysis

Comparisons of genotype and allele frequencies between cases and controls were carried out using chi-squared tests of association. Three genetic models (dominant, codominant and recessive) for modulation of response to HC treatment were tested. Genotype specific risks were estimated as odds ratio (OR) with 95% confidence intervals (95% CI). Multiple logistic regression (JMP 6.0.3) was used to investigate the association between individual SNPs and the change in HbF level after HC treatment. Haplotypes were determined using Phase 2.1 (Stephens & Donnelly, 2003). Probability differences of P < 0?05 were considered as statistically significant without additional correction for multiple comparisons.

Of 282 enrolled adults at NIH, 13 patients were excluded because of incomplete data. The majority was Hb SS (202 cases, 71?6%), 44 haemoglobin SC (15?6%), 16 sickle ?+-thalassaemia (5?7%), 4 sickle ?0-thalassaemia (1?4%), two haemoglobin SD (0?7%), one haemoglobin SOArab (0?4%) and two with incompletely characterized sickle ?-thalassaemia (0?7%). The presence of coincident ?-thalassaemia (?3?7 deletion) was also determined for 260 SCD subjects (92?2%, n = 282): 179 (68?8%) with ??/??, 73 (28?1%) with ??/??, seven (2?7%) with ??/?? and one (0?4%) with ???/??. No ?4?2 deletions were detected (89?4%, n = 252 out of total 282) (Taylor et al, 2008).

In order to determine the pattern of mutation and polymorphism across putative HC responsive regulatory elements in SCD patients, we designed sequence-specific primers corresponding to a 2?3 kb fragment of SAR1A on chromosome 10 which was completely sequenced in all subjects. Twenty DNA sequence variants, including two insertion/deletion polymorphisms and nine that have been previously reported in dbSNP (, were identified among a total of 386 patients, consisting of 269 adults at NIH and 117 newborns with SCD. Fourteen variants were within the upstream promoter region, four SNPs were in the 5?UTR encoded within exon 1 (+14 T>A, rs3812693, +31 T>C and rs3812692), and 2 SNPs were within the first intron (rs4282891 and intron 1 + 140 C>G). Using Phastcons genomic sequence alignments from 17 vertebrate species including Homo sapiens (; May, 2004 hg17 assembly), we identified phylogenetically conserved blocks of sequence across this 2?3 kb region of SAR1A. Four SNPs (?30 C>G, +14 T>A, rs4282891 and intron 1 + 140 C>G) corresponded to highly conserved non-coding nucleotide sites (Phastcons scores >0?4), which is strongly suggestive of an increased likelihood that these SNPs represent functional variants.

When SAR1A sequence data were compared between NIH subjects and the newborn SCD cohort, differences in genotype frequency were observed for rs2310991 in the upstream promoter region [Odds ration (OR) = 1?9, 95% CI = 1?1?3?2, P = 0?009] and +31 T>C in the 5?UTR [OR 9?8 (1?3-73?9); 95% CI; P < 0?001] (data not shown).

Individual SAR1A variants were then analysed for association with HbF levels, expressed as percentage of total haemoglobin (%) or as absolute HbF (g/l), among 176 adults with homozygous SCD (SS) treated with or without HC (69 cases vs. 107 cases). Three SNPs in the upstream promoter region (?809 C>T, ?502 G>T and ?385 C>A) were significantly associated with higher percentage HbF under a co-dominant genetic model even after statistical correction (Table I). The major allele frequency of ?809 C>T, ?502 G>T and ?385 C>A were 0?93, 0?98 and 0?96 respectively. When the analysis was repeated using absolute HbF concentration as a clinical endpoint between HC cases and SS controls, only one of these three markers showed evidence for an association (SNP ?502 G>T; data not shown). None of the 20 variants were associated with total haemoglobin levels as the outcome measure between cases and controls (data not shown).

In addition, 32 of the Hb SS subjects had prospective, regular clinical evaluations including quantitative HbF measurements before and during 2 years of HC therapy. When this patient subset was analysed, only rs2310991 was significantly associated with the change in the percentage of HbF. However, four markers (rs2310991, ?809 C>T, ?385 C>A and rs4282891) were significantly associated with the change of absolute HbF concentration. The most statistically significant P-value for an association was at rs4282891 (P = 0?0012), which is phylogenetically conserved in vertebrates (Phastcons score = 0?5984) and present intron 1 of SAR1A (Table II).

Considering all 20 markers, there were 64 total haplotypes including seven common haplotypes (>5% frequency) spanning 1617 nucleotides. Significant individual associations observed for markers ?809 C>T, ?502 G>T, and ?385 C>A in the overall population and the 32 prospective follow-up subjects reflected a co-dominant haplotypic effect for the TGA variant (n = 23, 4?6%) and CGC wild type (n = 447, 89?8%) SAR1A promoter haplotypes.

HC therapy in sickle cell anaemia increases the circulating HbF concentration in most individuals, although a large proportion of compliant patients experience either a complete failure to respond or have a small, clinically insignificant increase in HbF (Ma et al, 2007). Even among patients who are identified as HC responders, the magnitude of HbF increase is variable (Charache et al, 1995; ; Steinberg et al, 1997; Zimmerman et al, 2004; Bakanay et al, 2005; Ma et al, 2007). Presently, the underlying reason for this variability is not known (Steinberg et al, 1997; Bakanay et al, 2005).

Our previous work identified a novel role of SAR1A in HBG induction that is distinct from its previously established protein-trafficking function. SAR1A participates in HBG expression and erythroid cell maturation after HC treatment by regulating PI3 kinase/ERK and GATA-2/p21-dependent signal transduction pathways (Tang et al, 2005). These results led us to hypothesize that functional polymorphisms in regulatory elements of HC inducible genes, like SAR1A, modulate HbF levels or HC therapeutic responses. The present study identified all of the common nucleotide variants across a 2?3 kb region, which includes the promoter and first exon of SAR1A, including a subset of markers that are associated with either differences in HbF levels or change in HbF levels in sickle cell anaemia patients treated with HC. Individual associations with higher HbF concentration in HC-treated patients were detectable under three different genetic models (Table I), in addition to a more rigorous logistic regression association analysis of a subset of prospectively treated patients (Table II). Similar to our present findings in SAR1A, all of the presently known SNP markers in HC inducible genes associated with higher HbF are located within either promoter regions or the first intron 1 of candidate genes (Ma et al, 2007). In the slightly larger population studied by Ma et al (2007), variants in genes like FLT1, ARG2, HAO2 and NOS1 influenced HbF treatment response. Collectively, these association studies suggest that a specific transcriptionally regulated gene expression profile may be initiated by HC therapy and that genetic variants within regulatory elements of these genes could modulate this response.

Comparative sequence analysis and cross-species conservation have previously been used to identify putative genes and regulatory elements in small genomic regions, suggesting that this is a viable approach for hypothesis generation and fine mapping functional variants underlying genetic association studies (Pennacchio et al, 2001; Woolfe et al, 2005). Conserved sites within a 2?3 kb region of SAR1A were identified using the University of California Santa Cruz phastCons algorithm, which is based on a two state phylogenetic hidden Markov model that determines a likelihood ratio for conservation at a single nucleotide site across vertebrates (Siepel et al, 2005). We identified four variants, including three previously unknown markers (?30 C>G, +14 T>A, rs4282891 and intron 1 + 140 C>G), occurring at highly conserved SAR1A nucleotides. Thus, these variants are priority candidates for additional study to evaluate their role in regulating SAR1A transcription, potentially such using novel methods as high throughput transcriptional profiling for cloned promoter haplotypes in response to therapeutic agents like HC (Idelman et al, 2007).

SAR1A joins an expanding list of candidate loci including the genes listed above and regions of chromosomes 6q, 8q and Xp that might modulate HbF expression or HC responses. In humans, there are two SAR genes; SAR1A on chromosome 10 and SAR1B on chromosome 5. Although, these paralogs share high degree of amino acid sequence homology (89?4%), their expression patterns are distinct. SAR1A is expressed ubiquitously, most abundantly in prostate, thyroid and adrenal gland while SAR1B has a tissue-specific pattern with moderate expression in heart, liver, skeletal muscle and testis (He et al, 2002; Tang et al, 2005). These differences in expression patterns suggest different biological roles in various tissues and involvement in different human disease processes. Indeed, SAR1B mutations cause lipid absorption disorders, such as chylomicron retention disease (CMRD; MIM 246700) and Anderson disease (MIM 607689). In contrast, SAR1A mutations were not identified in either of these syndromes (Jones et al, 2003). To date, there are no known human SAR1A human mutations although this association study suggests that some SNPs could subtly alter SAR1A expression or function.

Finally, others have also examined SAR1A polymorphisms and haemolysis-driven phenotypes of SCD, such as leg ulcers, but these studies have not demonstrated significant associations (Nolan et al, 2006). Similarly in this study, there was no association between SAR1A SNPs and pulmonary hypertension (e.g. tricuspid regurgitant jet velocity >2?5 m/s, data not shown), which is also believed to be a haemolysis-associated complication of SCD. However, it is worthwhile to note that the Nolan leg ulcer study evaluated SNPs (rs870801 in intron 1 and rs2271690 in intron 3) that are located approximately 10 kb pairs apart from one another within a 20?3 kb gene (SAR1A). While these negative results suggest an unlikely role for involvement of SAR1A in response to haemolysis in SCD, neither study utilized high density, haplotype tagged markers to interrogate this gene. Additional study of the role of this gene in response to HC therapy and haemolysis are warranted before firm conclusions can be made.

In conclusion, SAR1A polymorphisms might contribute to the regulation of HbF expression and modulate patient responses to HC in sickle cell anaemia. However, replication in independent populations and targeted functional studies are needed to confirm the validity of these associations.

This work was supported by the Intramural Research Program of the National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health. The authors thank the investigators of Sickle Cell Pulmonary Hypertension Screening Study who obtained blood samples for DNA-based studies. We also acknowledge Dr Suthat Fucharoen, Thalassemia Research Center, Institute of Science and Technology for Research and Development, Mahidol University for his helpful discussions and on-going support of the project.

Bakanay SM,Dainer E,Clair B,Adekile A,Daitch L,Wells L,Holley L,Smith D,Kutlar A. Mortality in sickle cell patients on hydroxyurea therapyBlood 2005;105:545–547. [pmid: 15454485]
Charache S,Terrin ML,Moore RD,Dover GJ,Barton FB,Eckert SV,McMahon RP,Bonds DR. Effect of hydroxyurea on the frequency of painful crises in sickle cell anemia. Investigators of the Multicenter Study of Hydroxyurea in Sickle Cell AnemiaNew England Journal of Medicine 1995;332:1317–1322. [pmid: 7715639]
Cokic VP,Smith RD,Beleslin-Cokic BB,Njoroge JM,Miller JL,Gladwin MT,Schechter AN. Hydroxyurea induces fetal hemoglobin by the nitric oxide-dependent activation of soluble guanylyl cyclaseThe Journal of Clinical Investigation 2003;111:231–239. [pmid: 12531879]
Collins FS,Green ED,Guttmacher AE,Guyer MS. A vision for the future of genomics researchNature 2003;422:835–847. [pmid: 12695777]
Fucharoen S,Siritanaratkul N,Winichagoon P,Chowthaworn J,Siriboon W,Muangsup W,Chaicharoen S,Poolsup N,Chindavijak B,Pootrakl P,Piankijagum A,Schechter AN,Rodgers GP. Hydroxyurea increases hemoglobin F levels and improves the effectiveness of erythropoiesis in beta-thalassemia/hemoglobin E diseaseBlood 1996;87:887–892. [pmid: 8562958]
He H,Dai F,Yu L,She X,Zhao Y,Jiang J,Chen X,Zhao S. Identification and characterization of nine novel human small GTPases showing variable expressions in liver cancer tissuesGene expression 2002;10:231–242. [pmid: 12450215]
Idelman G,Taylor JG,Tongbai R,Chen RA,Haggerty CM,Bilke S,Chanock SJ,Gardner K. Functional profiling of uncommon VCAM1 promoter polymorphisms prevalent in African American populationsHuman Mutation 2007;28:824–829. [pmid: 17431880]
Ikuta T,Ausenda S,Cappellini MD. Mechanism for fetal globin gene expression: role of the soluble guanylate cyclise-cGMP-dependent protein kinase pathwayProceedings of the National Academy of Sciences of the United States of America 2001;98:1847–1852. [pmid: 11172039]
Jones B,Jones EL,Bonney SA,Patel HN,Mensenkamp AR,Eichenbaum-Voline S,Rudling M,Myrdal U,Annesi G,Naik S,Meadows N,Quattrone A,Islam SA,Naoumova RP,Angelin B,Infante R,Levy E,Roy CC,Freemont PS,Scott J,Shoulders CC. Mutations in a Sar1 GTPase of COPII vesicles are associated with lipid absorption disordersNature Genetics 2003;34:29–31. [pmid: 12692552]
Ma Q,Wyszynski DF,Farrell JJ,Kutlar A,Farrer LA,Baldwin CT,Steinberg MH. Fetal hemoglobin in sickle cell anemia: genetic determinants of response to hydroxyureaThe Pharmacogenomics Journal 2007;7:386–394. [pmid: 17299377]
Moosavi MA,Yazdanparast R,Lotfi A. ERK1/2 inactivation and p38 MAPK-dependent caspase activation during guanosine 5?-triphosphate-mediated terminal erythroid differentiation of K562 cellsThe International Journal of Biochemistry & Cell Biology 2007;39:1685–1697.
Nolan VG,Adewoye A,Baldwin C,Wang L,Ma Q,Wyszynski DF,Farrell JJ,Sebastiani P,Farrer LA,Steinberg MH. Sickle cell leg ulcers: associations with haemolysis and SNPs in Klotho, TEK and genes of the TGF-beta/BMP pathwayBritish Journal of Haematology 2006;133:570–578. [pmid: 16681647]
Okpala IE. New therapies for sickle cell diseaseHematology/Oncology Clinics of North America 2005;19:975–987. [pmid: 16214656]
Osti F,Corradini FG,Hanua S,Matteuzzi M,Gambari R. Human leukemia K562 cells: induction to erythroid differentiation by guanine, guanosine and guanine nucleotidesHaematologica 1997;82:395–401. [pmid: 9299849]
Pennacchio LA,Olivier M,Hubacek JA,Cohen JC,Cox DR,Fruchart JC,Krauss RM,Rubin EM. An apolipoprotein influencing triglycerides in humans and mice revealed by comparative sequencingScience 2001;294:169–173. [pmid: 11588264]
Rodgers GP,Dover GJ,Noguchi CT,Schechter AN,Nienhuis AW. Hematologic responses of patients with sickle cell disease to treatment with hydroxyureaNew England Journal of Medicine 1990;322:1037–1045. [pmid: 1690857]
Siepel A,Bejerano G,Pedersen JS,Hinrichs AS,Hou M,Rosenbloom K,Clawson H,Spieth J,Hillier LW,Richards S,Weistock GM,Wilson RK,Gibbs RA,Kent WJ,Miller W,Haussler D. Evolutionarily conserved elements in vertebrate, insect, worm, and yeast genomesGenome Research 2005;15:1034–1050. [pmid: 16024819]
Steinberg MH. Predicting clinical severity in sickle cell anaemiaBritish Journal of Haematology 2005;129:465–481. [pmid: 15877729]
Steinberg MH,Lu ZH,Barton FB,Terrin ML,Charache S,Dover GJ. Fetal hemoglobin in sickle cell anemia: determinants of response to hydroxyurea. Multicenter Study of HydroxyureaBlood 1997;89:1078–1088. [pmid: 9028341]
Stephens M,Donnelly PA. A comparison of Bayesian methods for Haplotype reconstruction from population genotype dataThe American Journal of Human Genetics 2003;73:1162–1169.
Tang DC,Zhu J,Liu W,Chin K,Sun J,Chen L,Hanover JA,Rodgers GP. The hydroxyurea-induced small GTP-binding protein SAR modulates gamma-globin gene expression in human erythroid cellsBlood 2005;106:3256–3263. [pmid: 15985540]
Taylor JG,Ackah D,Cobb C,Orr N,Percy MJ,Sachdev V,Machado R,Castro O,Kato GJ,Chanock SJ,Gladwin MT. Mutations and polymorphisms in hemoglobin genes and the risk of pulmonary hypertension and death in sickle cell diseaseAmerican Journal of Hematology 2008;83:6–14. [pmid: 17724704]
Woolfe A,Goodson M,Goode DK,Snell P,McEwen GK,Vavouri T,Smith SF,North P,Callaway H,Kelly K,Walter K,Abnizova I,Gilks W,Edwards YJ,Cooke JE,Elgar G. Highly conserved non-coding sequences are associated with vertebrate developmentPLoS Biology 2005;3:e7. [pmid: 15630479]
Zeng YT,Huang SZ,Ren ZR,Lu ZH,Zeng FY,Schechter AN,Rodgers GP. Hydroxyurea therapy in beta-thalassaemia intermedia: improvement in haematological parameters due to enhanced beta-globin synthesisBritish Journal of Haematology 1995;90:557–563. [pmid: 7646994]
Zimmerman SA,Schultz WH,Davis JS,Pickens CV,Mortier NA,Howard TA,Ware RE. Sustained long-term hematologic efficacy of hydroxyurea at maximum tolerated dose in children with sickle cell diseaseBlood 2004;103:2039–2045. [pmid: 14630791]

[TableWrap ID: tbl1] Table I 

SNPs associated with a higher percent HbF (%HbF) with hydroxycarbamide treatment.

SNP rs Number Ch 10 map position Dominant Codominant Recessive Major allele frequency
?1377 (G>T)* rs2310991 71601652 0?0027? 0?0218 0?1369 0?45
?809 (C>T) rs76901216 71601084 0?0413 0?0008? ND 0?93
?743 (G>A)* rs10999169 71601018 0?0418 0?0108 0?0079 0?77
?605/?606 (?>T)* rs11438971 71600880/71600879 ND ND 0?0231 0?01
?502 (G>T) rs76901217 71600777 0?0300 2?1266E-07? ND 0?98
?460 (C>G) rs76901218 71600735 0?0084 0?0129 ND 0?98
?432 (T>?)* rs11284333 71600707 0?0199 ND 0?0319 0?61
?420 (TTTT>?)* rs10577419 71600699 0?0310 ND 0?0117 0?60
?417 (T>?)* rs5785963 71600692 0?0258 ND 0?0140 0?61
?396 (T>C) rs76901219 71600671 0?0264 ND ND 0?98
?385 (C>A) rs76901220 71600660 0?0344 1?0610E-07? ND 0?96
?372 (G>A) rs76901221 71600647 0?0161 0?0833 0?0027? 0?89
?45 (G>A) rs76901222 71600320 0?0348 0?5382 ND 0?98
?30 (C>G) rs76901223 71600305 0?0264 ND ND 1?00
+14 (T>A)? rs76901224 71600262 0?0288 ND ND 1?00
+27 (C>A)*, ? rs3812693 71600249 0?0146 0?0284 ND 0?98
+31 (T>C)? rs76901225 71600245 0?0159 0?6734 ND ?95
+68 (C>T)*, ? rs3812692 71600208 0?0228 ND ND 0?99
Intron 1 + 100 (G>A)* rs4282891 71600075 0?0193 0?8913 ND 0?98
Intron 1 + 140 (C>G) rs76901226 71600035 0?0267 ND ND 0?99

*Previously reported in dbSNP.

?Present within the 5? UTR.

?Significant P-value after Bonforoni correction.

Bold: SNP with P-value ? 0?05.

ND, not determined.

Major allele frequency was calculated from genotype frequency of Hb SS patients.

[TableWrap ID: tbl2] Table II 

SNPs associated with a significant change in HbF levels after 2 years of hydroxycarbamide treatment in 32 adults with sickle cell anaemia.

SNP rs Number Ch10 map position % HbF Absolute HbF
?1377 (G>T)* rs2310991 71601652 0?0229 0?0338
?809 (C>T) rs76901216 71601084 0?0584 0?0270
?743 (G>A)* rs10999169 71601018 0?0806 0?2591
?605/?606 (?>T)* rs11438971 71600880/71600879 0?0720 0?1514
?502 (G>T) rs76901217 71600777 0?3569 0?9125
?460 (C>G) rs76901218 71600735 0?8546 0?8040
?432 (T>?)* rs11284333 71600707 0?8719 0?4418
?420 (TTTT>?)* rs10577419 71600699 0?5861 0?7434
?417 (T>?)* rs5785963 71600692 0?6116 0?4440
?396 (T>C) rs76901219 71600671 0?5035 0?4804
?385 (C>A) rs76901220 71600660 0?0584 0?0270
?372 (G>A) rs76901221 71600647 0?6441 0?3167
?45 (G>A) rs76901222 71600320 0?1490 0?1560
?30 (C>G) rs76901223 71600305 ND ND
+14 (T>A)? rs76901224 71600262 0?3151 0?9402
+27 (C>A)*, ? rs3812693 71600249 ND ND
+31 (T>C)? rs76901225 71600245 0?3483 0?9676
+68 (C>T)*, ? rs3812692 71600208 ND ND
Intron 1 + 100 (G>A)* rs4282891 71600075 0?2078 0?0012
Intron 1 + 140 (C>G) rs76901226 71600035 0?4313 0?8147

*Previously reported in dbSNP.

?Present within the 5? UTR.

Bold: SNP with P-value ? 0?05.

ND, not determined.

Article Categories:
  • Red Cells and Iron

Keywords: hydroxycarbamide, SAR1A, sickle cell disease, fetal haemoglobin, single nucleotide polymorphism.

Previous Document:  Rituximab in the treatment of autoimmune haematological disorders.
Next Document:  Murine bone marrow derived stromal progenitor cells fail to prevent or treat acute graft-versus-host...