Document Detail


The DNA-binding and transcription-activation abilities of p53 are necessary but not sufficient for its antiproliferation function.
MedLine Citation:
PMID:  7947385     Owner:  NLM     Status:  MEDLINE    
Abstract/OtherAbstract:
Normal p53 protein suppresses cell proliferation and ras oncogene-induced cell transformation. Missense mutations in the middle conserved conformational domain of p53 decrease its antiproliferation function. In this work, we studied the requirement of the NH2- and COOH-terminal regions of p53 in its antiproliferation function using two independent assays, growth of chronic myelogenous leukemia K562 cells on methylcellulose semisolid medium and ras oncogene-induced focus formation of rat fibroblast cells (Rat-1). We found that deletion of 80 or 159 amino acids from the NH2-terminus and deletion of 67 amino acids from the COOH-terminus of p53 drastically reduced the antiproliferation function of p53. However, the COOH-terminal deletion mutant is capable of binding to a p53 DNA-binding element, p53CON (GGACATGCCCGGGCATGTCC), and of activating p53CON-mediated transcription. These results suggest that p53' abilities to bind p53CON and activate transcription are not sufficient for its antiproliferation function and that p53CON-regulated genes may not be growth suppressive.
Authors:
W Zhang; G S Randhawa; X Y Guo; A B Deisseroth
Related Documents :
12869365 - Uteroplacental insufficiency increases apoptosis and alters p53 gene methylation in the...
17970695 - Regulation of the interferon-inducible p53 target gene trim22 (staf50) in human t lymph...
17395405 - P53 translational control: a new facet of p53 regulation and its implication for tumori...
15171255 - Dynamics of the p53 acetylation pathway.
23921685 - Post-transcriptional regulation by poly(adp-ribosyl)ation of the rna-binding proteins.
22899305 - Kiss1 expression in human female adipose tissue.
Publication Detail:
Type:  Journal Article; Research Support, Non-U.S. Gov't; Research Support, U.S. Gov't, P.H.S.    
Journal Detail:
Title:  Cell growth & differentiation : the molecular biology journal of the American Association for Cancer Research     Volume:  5     ISSN:  1044-9523     ISO Abbreviation:  Cell Growth Differ.     Publication Date:  1994 Jul 
Date Detail:
Created Date:  1994-12-07     Completed Date:  1994-12-07     Revised Date:  2007-11-14    
Medline Journal Info:
Nlm Unique ID:  9100024     Medline TA:  Cell Growth Differ     Country:  UNITED STATES    
Other Details:
Languages:  eng     Pagination:  705-10     Citation Subset:  IM    
Affiliation:
Department of Hematology, University of Texas M.D. Anderson Cancer Center, Houston 77030.
Export Citation:
APA/MLA Format     Download EndNote     Download BibTex
MeSH Terms
Descriptor/Qualifier:
Animals
Base Sequence
Binding Sites
Cell Division / physiology*
DNA / metabolism*
Fibroblasts
Humans
Leukemia, Erythroblastic, Acute
Molecular Sequence Data
Protein Binding
Rats
Recombinant Fusion Proteins / metabolism
Sequence Deletion
Transcription, Genetic*
Tumor Cells, Cultured
Tumor Suppressor Protein p53 / chemistry,  physiology*
Grant Support
ID/Acronym/Agency:
P01 CA55164/CA/NCI NIH HHS
Chemical
Reg. No./Substance:
0/Recombinant Fusion Proteins; 0/Tumor Suppressor Protein p53; 9007-49-2/DNA

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine


Previous Document:  c-erbA and v-erbA modulate growth and gene expression of a mouse glial precursor cell line.
Next Document:  Preferential overexpression of a 172Arg-->Leu mutant p53 in the mammary gland of transgenic mice res...