| Computational prediction of MicroRNAs targeting GABA receptors and experimental verification of miR-181, miR-216 and miR-203 targets in GABA-A receptor. | |
| | |
| Jump to Full Text | |
MedLine Citation:
|
PMID: 22321448 Owner: NLM Status: PubMed-not-MEDLINE |
Abstract/OtherAbstract:
|
BACKGROUND: GABA receptors are well known as the inhibitory receptors in the central nervous system and are also found in peripheral tissues. We have previously shown that GABA receptors are involved in lung development and fluid homeostasis. However, the microRNAs that regulate GABA receptors have not yet been identified. RESULTS: In this study, we used the online software, TargetScan and miRanda, to query the microRNAs that directly target GABA receptors and then selected some of them to verify experimentally using 3'-UTR reporter assays. Computational approaches predict many microRNA binding sites on the 3'-UTR of GABAA receptors, but not on GABAC receptors. 3'-UTR reporter assays only verified miR-181, miR-216, and miR-203 as the microRNAs that target GABA receptor α1-subunit among 10 microRNAs tested. CONCLUSIONS: Our studies reinforce that microRNA target prediction needs to be verified experimentally. The identification of microRNAs that target GABA receptors provides a basis for further studies of post-transcriptional regulation of GABA receptors. |
| | |
Authors:
|
Chunling Zhao; Chaoqun Huang; Tingting Weng; Xiao Xiao; Hong Ma; Lin Liu |
Related Documents
:
|
8400228 - The extracytoplasmic domain of the erythropoietin receptor forms a monomeric complex wi... 16365288 - Expression of a homodimeric type i cytokine receptor is required for jak2v617f-mediated... 12380958 - What evidence supports use of erythropoietin as a novel neurotherapeutic? 22524438 - Dicarboxylate recognition by two macrobicyclic receptors: selectivity for fumarate over... 2412048 - Pharmacology of potent and selective s2-serotonergic antagonists. 15158458 - Cold exposure induces tyrosine phosphorylation of bit through nmda receptors in the rat... |
Publication Detail:
|
Type: Journal Article Date: 2012-02-09 |
Journal Detail:
|
Title: BMC research notes Volume: 5 ISSN: 1756-0500 ISO Abbreviation: BMC Res Notes Publication Date: 2012 |
Date Detail:
|
Created Date: 2012-03-08 Completed Date: 2012-10-02 Revised Date: 2012-11-09 |
Medline Journal Info:
|
Nlm Unique ID: 101462768 Medline TA: BMC Res Notes Country: England |
Other Details:
|
Languages: eng Pagination: 91 Citation Subset: - |
Affiliation:
|
The Lundberg-Kienlen Lung Biology and Toxicology Laboratory, Department of Physiological Sciences, Oklahoma State University, Stillwater, Oklahoma 74078, USA. lin.liu@okstate.edu. |
Export Citation:
|
APA/MLA Format Download EndNote Download BibTex |
| MeSH Terms | |
Descriptor/Qualifier:
|
|
| Full Text | |
|
Journal Information Journal ID (nlm-ta): BMC Res Notes ISSN: 1756-0500 Publisher: BioMed Central |
Article Information Download PDF ![]() Copyright ©2012 Zhao et al; licensee BioMed Central Ltd. open-access: Received Day: 13 Month: 7 Year: 2011 Accepted Day: 9 Month: 2 Year: 2012 collection publication date: Year: 2012 Electronic publication date: Day: 9 Month: 2 Year: 2012 Volume: 5First Page: 91 Last Page: 91 ID: 3296612 Publisher Id: 1756-0500-5-91 PubMed Id: 22321448 DOI: 10.1186/1756-0500-5-91 |
| Computational prediction of MicroRNAs targeting GABA receptors and experimental verification of miR-181, miR-216 and miR-203 targets in GABA-A receptor | |
| Chunling Zhao12 | Email: chunlingzhao@sina.cn |
| Chaoqun Huang1 | Email: Chaoqun.huang@okstate.edu |
| Tingting Weng1 | Email: Tingting.Weng@uth.tmc.edu |
| Xiao Xiao1 | Email: xiao.xiao@okstate.edu |
| Hong Ma1 | Email: mh1985623@126.com |
| Lin Liu13 | Email: lin.liu@okstate.edu |
|
1The Lundberg-Kienlen Lung Biology and Toxicology Laboratory, Department of Physiological Sciences, Oklahoma State University, Stillwater, Oklahoma 74078, USA |
|
|
2Department of Physiology, Lu Zhou Medical College, Lu Zhou, Sichuan Province 64600, People's Republic of China |
|
|
3Department of Physiological Sciences, Oklahoma State University, 264 McElroy Hall, Stillwater, Oklahoma 74078, USA |
|
GABA receptors are well known as the inhibitory receptors in the central nervous system [1,2]. However, GABA receptors are also found in several peripheral tissues [3-6]. The functions of GABA receptors in peripheral tissues are less studied. They may be involved in ion homeostasis [7], cell proliferation and differentiation [8], development [1], and hormone secretion [5,9].
We have initially identified GABA receptor π-subunit as a specific alveolar epithelial type II cell marker through DNA microarray analysis [10]. The expression pattern of the GABA receptor π-subunit is regulated by various culture conditions and is consistent with the type II cell phenotypes [11]. We have further identified 19 subunits of the ionotropic GABA receptors in alveolar epithelial cells [6]. Their expression is dynamically changed during lung development [12]. Functionally, GABA receptors play important roles in fluid homeostasis in the adult lung and fetal lung development [6,13].
GABA receptors can be classified into two major types: GABAA and GABAC as ligand-gated Cl-channels, and GABAB receptor as a metabotropic receptor coupled to a heterotrimeric G-protein. GABAA and GABAC receptors share a conserved structure that contains a long extracellular N-terminal region, 4 transmembrane domains (TM1-TM4), a large intracellular loop between TM3 and TM4, and a short extracellular C-terminus [1,2,14-16]. The N-terminal segment is responsible for ligand binding and subunit assembly. The TM2 domain forms the lining of the ion pore. The intracellular loop is the site for post-translational modifications and binding with other proteins. This loop harbors a number of consensus phosphorylation sites for protein kinase A and C (PKA and PKC) and tyrosine kinases [17].
MicroRNAs are small non-coding RNAs. They form a ribonucleoprotein complex, termed RISC that cleaves mRNA or represses protein translation. MicroRNAs regulate various biological processes [18,19]. Several microRNAs such as miR-17-92 cluster and miR-127 are involved in lung development [20-22]. MicoRNAs have also been implicated in many lung diseases including lung inflammation, Chronic Obstructive Pulmonary Disease, Asthma and Idiopathic Pulmonary Fibrosis [23-30]. Nevertheless, microRNAs that regulate GABA receptors have not yet been reported. In this study, we used online software, TargetScan (http://www.targetscan.org) [31] and mRanda (http://www.microrna.org) [32] to predict the microRNAs that possibly target to GABA receptors and then selected some of them to verify experimentally using 3'-UTR reporter assays. We found that miR-181, miR-23 and miR-216 target the GABA receptor α1-subunit.
Human microRNA expression vectors were constructed as previously described [22]. Mature microRNAs with the flanking sequences (~200 base pairs at each end) were PCR-amplified from human genomic DNA. The primers used for PCR amplification are listed in Table 1. The PCR products were inserted into a modified pLVX-Puro lenti-viral vector (Clontech) between CMV-driven enhanced green fluorescent protein (EGFP) and SV40 polyA terminal sequences.
The full length 3'-UTR or the microRNA binding sites in the 3'-UTR of rat GABA receptors were PCR-amplified and inserted into the pRL-TK vector containing a Renilla luciferase (Promega). The primers used for PCR amplification are listed in Table 2.
HEK 293T cells (2 × 104/well) were seeded in each well of a 96-well plate. After one day of culture, the cells were transfected with100 ng microRNA expression vector or control vector without miRNA insert, 2.5 ng 3'-UTR Renillia luciferase reporter vector and 15 ng pGL3 control vector (firefly luciferase reporter) using Lipofectamine. After a 2 day transfection, the cells were lyzed and dual luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega). The Renilla luciferase activities were normalized with firefly luciferase activity. Data was expressed as a ratio to the control vector without miRNA insert.
Both GABAA and GABAC receptors are ligand-gated Cl-channels. However GABAC receptors have very unique ligand binding characteristics in comparison with GABAA and GABAB receptors, including a high sensitivity to the physiological ligand, GABA, insensitivity to bicuculline, barbiturates, and bacofen, very weak de-sensitization, a smaller single-channel conductance, and a longer open time [14-16]. Eight different subunits of GABAA and GABAC receptors (α1-6, β1-3, γ1-3, δ, θ, ε, π, and ρ1-3) have been identified. The assembly of a heteropentamer, with at least one α-, one β-, and one γ-subunit, forms functional GABAA receptor channels. δ-, θ-, ε-, and π-subunits can substitute for the γ-subunit. However, GABAC receptors are exclusively composed of ρ subunits in the form of homo- or hetero-pentamers.
To identify the microRNA that may potentially regulate GABAA and GABAC receptors, we used the online computer software, TargetScan (v 5.2) to predict the binding sites of microRNAs on the 3'UTR of rat GABA receptors. We chose rat GABA receptors because we use rats as most of our animal or cell models. Since our microRNA expression vectors use human sequences, we only queried conserved microRNA target sites among mammals based on conserved 8 mer and 7 mer sites that match the seed sequence of a microRNA. The results are listed in Table 3. Among α-subunits, we found that α1 had most of the microRNA binding sites. There were 6 binding sites for 6 microRNAs on α1 3'-UTR. For other α-subunits, we found miR-128, miR-27ab, let-7/miR-98 for α6. We did not find any microRNAs for α2, α4, and α5. There was no information available for α3.
For β-subunits, we found two binding sites for miR-30a/30a-5p/30b/30b-5p/30/384-5p and one binding site for miR-103/107. There were 15 binding sites for 15 microRNAs on β2 and 5 binding sites for 7 microRNAs on β3. For γ-subunits, we found two binding sites on γ2 and no binding sites on γ1 and γ3, There was only one binding site for ε and no binding sites on π-, δ-, θ-, ρ1- and ρ2-subunits. In general, the "common" subunits (α, β, and γ) had more miRNA target sites than the "rare" subunits (δ, θ, ε, π, and ρ). This is probably because these subunits had shorter 3'-UTRs, in particular for ρ-subunits.
We also used another software, miRanda to predict the microRNA that target to GABA receptors (Table 3). In general, miRanda predicted more microRNAs than TargetScan. There were some common microRNAs that were predicted by both software. For example, miR-137, miR-181, miR-203, and miR-216a for α1; miR-103, miR-107, miR-30, and miR-384-5p for β1; and miR-204, miR-211, miR-23, and miR-26 for β3.
We further utilized a recently developed software, miRWalk [33], to predict the miRNAs targeting 3'-UTR and open reading frame (ORF) of GABA receptors. The results are presented in Table 4. Obviously, this method is less stringent compared to TargetScan and miRanda, since the miRWalk query yielded 79 miRNAs for GABA receptor α1 subunit in comparison with only 6 by TargetScan and 29 by miRanda.
We selected two subunits, α1 and γ2 for experimental verification of the predictions. For α1-subunit, we constructed a 3'-UTR reporter vector, in which the 3'-UTR of α1-subunit was placed after a Renilla luciferase reporter gene (Table 2). For γ2-subunit, we cloned the predicted binding site of miR-103/107 into the downstream of a Renilla luciferase reporter gene. We then co-transfected a microRNA expression vector with the reporter into HEK293T cells to see whether the microRNA depressed the reporter activity. The firefly luciferase pGL3 vector was used for normalization. As shown in Figure 1, among the predicted microRNAs tested, miR-181, miR-216, and miR-203 inhibited the reporter activity. Four miR-181 isoforms, a-2, b-1, c and d-1 generated the same mature miR-181 and all of them depressed the reporter activity. All other microRNAs tested had no effects. The results suggest that miR-181, miR-216, and miR-203 are the micoRNAs that regulates GABA receptor α1-subunit. It is noted that miR-15, miR-16, miR-146, miR-221, miR-424 and miR-497 were predicated to target the GABA receptor α1-subunit by an earlier version (v.4.2) of TargetScan. Some of the miRNAs such as miR-181 are expressed in astrocytes naturally expressing GABA receptors [34]. For γ2-subunit, we did not find major effects of miR-103-1, miR-103-2, and miR-107 on the reporter activity (Figure 2).
It should be noted that we did not measure miRNA levels in the miRNA-overexpressed cells. Thus, there are possibilities that some of miRNAs may not be over-expressed in the experimental set-up; particularly for these miRNAs that had no effect on 3'-UTR reporter activity. However, the transfection efficiency is 90-100% under our experimental conditions based on the GFP reporter expression encoded in the same miRNA expression vector. Additionally, the effect of a miRNA on the luciferase activity does not necessarily mean that it was a direct effect on the binding of a miRNA to the 3'-UTR reporter construct. A miRNA could have indirect effects. The mutations of seed sequences in the miRNA binding sites are needed to exclude indirect effects. Further studies are also needed to see whether the overexpression of miR-181, miR-203, and miR-216 in a physiologically relevant cell type modifies GABA receptor expression, and whether these miRNAs are differentially regulated in diseased states.
It is also interesting to note that miR-15b and miR-146a/b actually increased the 3'-UTR reporter activity. It has been reported that miRNA increases translation [35]. However, it is also possible that this is a result of indirect effects.
We have previously shown that the activation of GABA receptors promotes fetal lung development [13]. The inhibition of miRNAs that target GABA receptors may increase receptor density and thus sensitivity of GABA receptors, which may benefit the development of therapy in treating diseases related to developmental anomalies.
In summary, computational approaches predict many microRNA binding sites on the 3'-UTR of GABAA receptors, but not on these of GABAC receptors. 3'-UTR reporter assays only verified miR-181, miR-216, and miR-203 as the microRNAs that target GABA receptor α1-subunit among 10 microRNAs tested. These studies reinforce that micoRNA target prediction needs to be verified experimentally. The identification of microRNAs that target to GABA receptors provides a basis for further studies of post-transcriptional regulation of GABA receptors.
The authors declare that they have no competing interests.
CZ, TW and HM carried out experiments. CZ, CH and XX analyzed data and performed target predictions. LL conceived of the study, and participated in its design and coordination. LL and CZ drafted the manuscript. All authors read and approved the final manuscript.
We thank Ms. Tazia Cook for editorial assistance. This work was supported by the National Institutes of Health, HL-087884 and HL-095383 and OCAST, AR101-037.
References
| Ben Ari Y,Excitatory actions of GABA during development: the nature of the nurtureNat Rev NeurosciYear: 2002372873912209121 | |
| Owens DF,Kriegstein AR,Is there more to GABA than synaptic inhibition?Nat Rev NeurosciYear: 2002371572710.1038/nrn91912209120 | |
| Akinci MK,Schofield PR,Widespread expression of GABA(A) receptor subunits in peripheral tissuesNeurosci ResYear: 19993514515310.1016/S0168-0102(99)00078-410616918 | |
| Glassmeier G,Hopfner M,Buhr H,Lemmer K,Riecken EO,Stein H,Quabbe HJ,Rancso C,Wiedenmann B,Scherubl H,Expression of functional GABAA receptors in isolated human insulinoma cellsAnn N Y Acad SciYear: 199885924124810.1111/j.1749-6632.1998.tb11138.x9928397 | |
| Park HS,Park HJ,Effects of gamma-aminobutyric acid on secretagogue-induced exocrine secretion of isolated, perfused rat pancreasAm J Physiol Gastrointest Liver PhysiolYear: 2000279G677G68211005753 | |
| Jin N,Kolliputi N,Gou D,Weng T,Liu L,A novel function of ionotropic gamma-aminobutyric acid receptors involving alveolar fluid homeostasisJ Biol ChemYear: 2006281360123602010.1074/jbc.M60689520017003036 | |
| Limmroth V,Lee WS,Moskowitz MA,GABAA-receptor-mediated effects of progesterone, its ring-A-reduced metabolites and synthetic neuroactive steroids on neurogenic oedema in the rat meningesBr J PharmacolYear: 1996117991048825349 | |
| Mong JA,Nunez JL,McCarthy MM,GABA mediates steroid-induced astrocyte differentiation in the neonatal rat hypothalamusJ NeuroendocrinolYear: 200214455510.1046/j.1365-2826.2002.00737.x11903812 | |
| Mayerhofer A,Hohne-Zell B,Gamel-Didelon K,Jung H,Redecker P,Grube D,Urbanski HF,Gasnier B,Fritschy JM,Gratzl M,Gamma-aminobutyric acid (GABA): a para- and/or autocrine hormone in the pituitaryFASEB JYear: 2001151089109111292677 | |
| Chen Z,Jin N,Narasaraju T,Chen J,McFarland LR,Scott M,Liu L,Identification of two novel markers for alveolar epithelial type I and II cellsBiochem Biophys Res CommunYear: 200431977478010.1016/j.bbrc.2004.05.04815184050 | |
| Jin N,Narasaraju T,Kolliputi N,Chen J,Liu L,Differential expression of GABA(A) receptor pi subunit in cultured rat alveolar epithelial cellsCell Tissue ResYear: 200532117318310.1007/s00441-005-1130-815912403 | |
| Jin N,Guo Y,Sun P,Bell A,Chintagari NR,Bhaskaran M,Rains K,Baviskar P,Chen Z,Weng T,Liu L,Ionotropic GABA receptor expression in the lung during developmentGene Expr PatternsYear: 2008839740310.1016/j.gep.2008.04.00818539546 | |
| Chintagari NR,Jin N,Gao L,Wang Y,Xi D,Liu L,Role of GABA receptors in fetal lung development in ratsPLoS OneYear: 20105e1417110.1371/journal.pone.001417121152393 | |
| Bormann J,The 'ABC' of GABA receptorsTrends Pharmacol SciYear: 200021161910.1016/S0165-6147(99)01413-310637650 | |
| Enz R,Cutting GR,Molecular composition of GABAC receptorsVision ResYear: 1998381431144110.1016/S0042-6989(97)00277-09667009 | |
| Zhang D,Pan ZH,Awobuluyi M,Lipton SA,Structure and function of GABA(C) receptors: a comparison of native versus recombinant receptorsTrends Pharmacol SciYear: 20012212113210.1016/S0165-6147(00)01625-411239575 | |
| Moss SJ,Smart TG,Modulation of amino acid-gated ion channels by protein phosphorylationInt Rev NeurobiolYear: 1996391528894843 | |
| Bushati N,Cohen SM,microRNA functionsAnnu Rev Cell Dev BiolYear: 20072317520510.1146/annurev.cellbio.23.090506.12340617506695 | |
| Croce CM,Causes and consequences of microRNA dysregulation in cancerNat Rev GenetYear: 20091070471410.1038/nrg263419763153 | |
| Lu Y,Thomson JM,Wong HY,Hammond SM,Hogan BL,Transgenic over-expression of the microRNA miR-17-92 cluster promotes proliferation and inhibits differentiation of lung epithelial progenitor cellsDev BiolYear: 200731044245310.1016/j.ydbio.2007.08.00717765889 | |
| Carraro G,El-Hashash A,Guidolin D,Tiozzo C,Turcatel G,Young BM,De Langhe SP,Bellusci S,Shi W,Parnigotto PP,Warburton D,miR-17 family of microRNAs controls FGF10-mediated embryonic lung epithelial branching morphogenesis through MAPK14 and STAT3 regulation of E-Cadherin distributionDev BiolYear: 200933323825010.1016/j.ydbio.2009.06.02019559694 | |
| Bhaskaran M,Wang Y,Zhang H,Weng T,Baviskar P,Guo Y,Gou D,Liu L,MicroRNA-127 modulates fetal lung developmentPhysiol GenomicsYear: 20093726827810.1152/physiolgenomics.90268.200819439715 | |
| Kumar MS,Erkeland SJ,Pester RE,Chen CY,Ebert MS,Sharp PA,Jacks T,Suppression of non-small cell lung tumor development by the let-7 microRNA familyProc Natl Acad Sci USAYear: 20081053903390810.1073/pnas.071232110518308936 | |
| Izzotti A,Calin GA,Arrigo P,Steele VE,Croce CM,De FS,Downregulation of microRNA expression in the lungs of rats exposed to cigarette smokeFASEB JYear: 20092380681210.1096/fj.08-12138418952709 | |
| Liu G,Friggeri A,Yang Y,Park YJ,Tsuruta Y,Abraham E,miR-147, a microRNA that is induced upon Toll-like receptor stimulation, regulates murine macrophage inflammatory responsesProc Natl Acad Sci USAYear: 2009106158191582410.1073/pnas.090121610619721002 | |
| Sato T,Liu X,Nelson A,Nakanishi M,Kanaji N,Wang X,Kim M,Li Y,Sun J,Michalski J,Patil A,Basma H,Holz O,Magnussen H,Rennard SI,Reduced miR-146a increases prostaglandin Ein chronic obstructive pulmonary disease fibroblastsAm J Respir Crit Care MedYear: 20101821020102910.1164/rccm.201001-0055OC20522791 | |
| Polikepahad S,Knight JM,Naghavi AO,Oplt T,Creighton CJ,Shaw C,Benham AL,Kim J,Soibam B,Harris RA,Coarfa C,Zariff A,Milosavljevic A,Batts LM,Kheradmand F,Gunaratne PH,Corry DB,Proinflammatory role for let-7 microRNAS in experimental asthmaJ Biol ChemYear: 2010285301393014910.1074/jbc.M110.14569820630862 | |
| Pandit KV,Corcoran D,Yousef H,Yarlagadda M,Tzouvelekis A,Gibson KF,Konishi K,Yousem SA,Singh M,Handley D,Richards T,Selman M,Watkins SC,Pardo A,Ben-Yehudah A,Bouros D,Eickelberg O,Ray P,Benos PV,Kaminski N,Inhibition and role of let-7d in idiopathic pulmonary fibrosisAm J Respir Crit Care MedYear: 201018222022910.1164/rccm.200911-1698OC20395557 | |
| Cushing L,Kuang PP,Qian J,Shao F,Wu J,Little F,Thannickal VJ,Cardoso WV,Lu J,MIR-29 is a major regulator of genes associated with pulmonary fibrosisAm J Respir Cell Mol BiolYear: 20104528729420971881 | |
| Liu G,Friggeri A,Yang Y,Milosevic J,Ding Q,Thannickal VJ,Kaminski N,Abraham E,miR-21 mediates fibrogenic activation of pulmonary fibroblasts and lung fibrosisJ Exp MedYear: 20102071589159710.1084/jem.2010003520643828 | |
| Zhang B,Pan X,Anderson TA,MicroRNA: a new player in stem cellsJ Cell PhysiolYear: 200620926626910.1002/jcp.2071316791837 | |
| Betel D,Wilson M,Gabow A,Marks DS,Sander C,The microRNA.org resource: targets and expressionNucleic Acids ResYear: 200836D149D15318158296 | |
| Dweep H,Sticht C,Pandey P,Gretz N,miRWalk-Database: prediction of possible miRNA binding sites by "walking" the genes of three genomesJ Biomed InformYear: 20114483984710.1016/j.jbi.2011.05.00221605702 | |
| Ouyang YB,Lu Y,Yue S,Giffard RG,miR-181 targets multiple Bcl-2 family members and influences apoptosis and mitochondrial function in astrocytesMitochondrionYear: 2011http://dx.doi.org/10.1016/j.mito.2011.09.001 | |
| Vasudevan S,Tong Y,Steitz JA,Switching from repression to activation: microRNAs can up-regulate translationScienceYear: 20073181931193410.1126/science.114946018048652 |
Figures
Tables
Primers for miRNA expression vectors
| Forward | Reverse | |
|---|---|---|
| miR-15a | CCGCTCGAGTATTCTTTGTGTTTCCTAACCTAT | GCGGAATTCTCAATAATACTGAAAAGACTATC |
|
|
||
| miR-15b | CACCTCGAGCGGCCTGCAGAGATAATACTTC | GAGAATTCGTTGCTGTATCCCTGTCACACT |
|
|
||
| miR-16-1 | GGGCTCGAGAAACATAGATTTTTTTACATGC | CCCGAATTCAATTCCTCTAATGCTGCATAAG |
|
|
||
| miR-16-2 | CACCTCGAGCCTTAAAGTACTGTAGCAGCACAT | GAGAATTCGGTAAATCAAACACCAAGTGTACAG |
|
|
||
| miR-103-1 | CCGCTCGAGTACTTCCCAATCCATTTAAAGTAT | GCGGAATTCAAGTAGCAGATAATTCAAATTG |
|
|
||
| miR-103-2 | CGCCTCGAGTTCCAACAAATGTTTAATTACTTG | GGCGAATTCAAGTAGAGGAAGAGTGGAAGGT |
|
|
||
| miR-107 | CACCTCGAGGATACAATTACAACCCATGTC | GAGAATTCCTGTCTTTCTAATATACCTCAGTG |
|
|
||
| miR-137 | CACCTCGAGTTATGGATTTATGGTCCCGGTCAAG | GAGAATTCTCCAGTCCTGGTCACCAGAGGC^ |
|
|
||
| miR-146a | CACCTCGAGATCCACCCACATCAGCCTTC | GGTTGAAGACTGAATTCGAGTAGCAGCAGCAGCAAGAGAG |
|
|
||
| miR-146b | CACCTCGAGTCAGCTCCAAGCTCAGACCCTC | GGTTGGTCTCGAATTCAGCACTGAGGAAGGACCAGCAT |
|
|
||
| miR-181a-2 | CACCTCGAGTTCTCAGACATTCATTTGAGTC | CACGAATTCTCATCATGGACTGCTCCTTAC |
|
|
||
| miR-181b-1 | GTTCTCGAGTATGACTAAAGGTACTGTTGTTTC | GCTGGTCTCTAATTTGATACTGTACGTTTGATGGAC |
|
|
||
| miR-181c | CACCTCGAGCTGCACTGCTACATCTCCATCC | GAGAATTCACACCAGCTCTCCTCTCCAAAG |
|
|
||
| miR-181d | ATTCTCGAGCTCTCCTCCTCTCCCTCTTCATGCTC | ATAGAATTCAGATTGGGCCACTGCACTCCAGC |
|
|
||
| miR-203 | ATTCTCGAGGCGGGGCTGGGCTTGGCGGCTG | TTTGAATTCGCGCGCCCCCACCCAGCGGTTC |
|
|
||
| miR-216b | CCGCTCGAGTTTTCCTTCATTCTCTATGGAGAT | GGCGAATTCGATGCTAGTCTGGGAATCAAAC |
|
|
||
| miR-221 | CACCTCGAGCGACCTTCCTTCCATCCAGCTT | GAGAATTCTTTGACAGTTGAGGCAGGGAGAAG |
|
|
||
| miR-424 | CACCTCGAGCAGCTCCTGGAAATCAAATGGTG | GAGAATTCACTTACCCTGGCAGCGGAAACAATAC |
|
|
||
| miR-497 | CACCTCGAGATGGTCCGTCGCCTTCCAGTTG | GAGAATTCTGGGTGTGGGCAACAAAGACTC |
Primers used for constructing 3'-UTR reporter vectors
| Names | 3'-UTR or binding Sites | Sequences |
|---|---|---|
| GABRA1-F-Spe I | 9-1962 | ggtactaGTCGTATTCTGTTGTTCAGTC |
|
|
|
|
| GABRA1-R-PspOMI | gttgggcccTCTATACATGAAATGTCCTTGG | |
|
|
||
| GABRG2-F | 2095-2102 (miR-103/107) | CTAGTATGGACTTTTACAATAAAAATGCTGCATTCTA |
|
|
|
|
| GABRG2-R | GGCCTAGAATGCAGCATTTTTATTGTAAAAGTCCATA | |
F: forward primers; R: reverse primers; microRNA binding sites are underlined
Predicted microRNAs targeting rat GABA receptor subunits by TargetScan and miRanda
| GABA receptor subunits | Entrez Gene symbol | Lengths of 3'-UTR in TargetScan (v5.2) | Conserved microRNAs targeting to GABA receptors predicted by TargetScan (v5.2) | Lengths of 3'-UTR in miRanda | Conserved microRNAs targeting to GABA receptors predicted by miRanda |
|---|---|---|---|---|---|
| α1 | GABRA1 | 2017 | miR-208/208ab, | 2018 | miR-129 (2), miR-130b, miR-136, miR-137, miR-148b-3p, |
| miR-499/499-5p, miR-181, | miR-150, miR-152, miR-181a (2) bc (3) d, miR-182, | ||||
| miR-216/216a, miR-137, | miR-186, miR-203 (2), miR-210, miR-216a, miR-26ab, | ||||
| miR-203 | miR-30acde, miR-30b-5p, miR-320, miR-340-5p, miR-361, | ||||
| miR-374, miR-375, miR-376c, miR-377, miR-384-5p, | |||||
| miR-410, miR-433, miR-488 (2), miR-539, miR-874 | |||||
|
|
|||||
| α2 | GABRA2 | 747 | 0 | NA | NA |
|
|
|||||
| α3 | GABRA3 | 0 | 0 | NA | NA |
|
|
|||||
| α4 | GABRA4 | 7478 | 0 | 88 | miR-186, miR-200bc, miR-203, miR-429, miR-495 |
|
|
|||||
| α5 | GABRA5 | 586 | 0 | 880 | miR-124, miR-132, miR-133ab, miR-195, miR-212, miR-223, |
| miR-30acde, miR-30b-5p, miR-322, miR-346, miR-376c, | |||||
| miR-378, miR-384-5p, miR-494 (2), miR-495, miR-539 | |||||
|
|
|||||
| α6 | GABRA6 | 809 | miR-128, miR-27ab, | NA | N/A |
| let7/miR-98 | |||||
|
|
|||||
| β1 | GABRB1 | 407 | miR-30a/30a-5p/30b/30b-5p/ | 428 | miR-103, miR-107, miR-128, miR-143, miR-148b-3p, |
| 30/384-5p (2), miR-103/107 | miR-152, miR-30a (2) c (2) d (2) e (2), miR-30b-5p (2), | ||||
| miR-384-5p (2), miR-411 | |||||
|
|
|||||
| β2 | GABRB2 | 5618 | miR-203,miR-135, miR-218, | 499 | miR-128, miR-199a-5p, miR-203, miR-33, miR-411, miR-485 |
| miR-21/590-5p, miR-10, | |||||
| miR-101, miR-19, miR-144, | |||||
| miR-9 (2), miR-455/455-5p, | |||||
| miR-33/33ab | |||||
|
|
|||||
| β3 | GABRB3 | 4060 | miR-26ab/1297, miR-204/211, | 508 | miR-122, miR-186, miR-199a-5p, miR-204, miR-210, miR-211, |
| miR-23ab, miR-27ab, miR-218 | miR-23ab, miR-26ab, miR-320, miR-324-5p, miR-329, | ||||
| miR-381, miR-539 | |||||
|
|
|||||
| γ1 | GABRG1 | 3428 | 0 | 240 | miR-203, miR-218, miR-379, miR-410, miR-455, miR-488 |
|
|
|||||
| γ2 | GABRG2 | 2106 | miR-150, miR-103/107 | NA | N/A |
|
|
|||||
| γ3 | GABRG3 | 96 | 0 | 114 | miR-15b, miR-16, miR-195, miR-26ab, miR-322, miR-497 |
|
|
|||||
| π | GABRP | 1178 | 0 | NA | N/A |
|
|
|||||
| δ | GABRD | 433 | 0 | 393 | miR-145, miR-19ab, miR-24, miR-328, miR-365 |
|
|
|||||
| ε | GABRE | 1485 | miR-22 | NA | N/A |
|
|
|||||
| θ | GABRQ | 80 | 0 | NA | N/A |
|
|
|||||
| ρ1 | GABRR1 | 464 | 0 | NA | N/A |
|
|
|||||
| ρ2 | GABRR2 | 113 | 0 | 191 | 0 |
|
|
|||||
| ρ3 | GABRR3 | N/A | N/A | 271 | miR-191 |
The conserved microRNAs targeting GABA receptors are predicted by Targetscan 5.2 http://www.targetscan.org/ and miRanda software (http://www.microrna.org). The number in parenthesis is the number of the binding sites and none means one binding site. N/A means no information is available in TargetScan or miRanda
Predicted microRNAs targeting 5'-UTR, ORF and 3'-UTR region using miRWalk software
| GABA receptor subunits | Entrez Gene symbol | MicroRNAs targeting 5'-UTR | MicroRNAs targeting ORF | Numbers of microRNA targeting 3'-UTR with p-value < 0.05 |
|---|---|---|---|---|
| α1 | GABRA1 | miR-326, miR-28*, miR-29b-1*, | miR-341, miR-503, miR-150, miR-378 | 79 |
| miR-539, miR-542-5p, miR-147, | ||||
| miR-423, miR-598-5p | ||||
|
|
||||
| α2 | GABRA2 | N/A | N/A | N/A |
|
|
||||
| α3 | GABRA3 | miR-27b, miR-27a, miR-185, | miR-350, miR-431, miR-542-3p, miR-322, miR-323*, | 0 |
| miR-343, miR-346, miR-17-5p, | miR-140, miR-148b-3p, miR-29a*, miR-152, miR-497 | |||
| miR-93, miR-128, miR-143, | ||||
| miR-291a-5p, miR-20b-5p | ||||
|
|
||||
| α4 | GABRA4 | N/A | N/A | N/A |
|
|
||||
| α5 | GABRA5 | miR-345, miR-22, miR-451, | miR-24-1*, miR-24-2*, let-7d, miR-346, miR-153, | 37 |
| miR-541, miR-369 | miR-296, miR-376c, miR-466c | |||
|
|
||||
| α6 | GABRA6 | 0 | miR-126*, miR-743b, miR-323*, miR-330*, miR-21*, | 0 |
| miR-153, miR-880 | ||||
|
|
||||
| β1 | GABRB1 | miR-323, miR-219-2 | miR-140, miR-351, miR-324-5p, miR-325-3p, miR-7a*, | 26 |
| miR-10a-5p, miR-125a-5p, miR-125b-5p, miR-376b-5p, | ||||
| miR-384-3p | ||||
|
|
||||
| β2 | GABRB2 | 0 | miR-20a*, miR-150, miR-297, miR-541 | 0 |
|
|
||||
| β3 | GABRB3 | miR-188 | miR-300-5p, miR-350, miR-433, miR-881, miR-672, | 17 |
|
|
||||
| γ1 | GABRG1 | miR-497, miR-322, miR-103-2, | miR-182, miR-216a, miR-483, miR-327, miR-338, | miR-126*, miR- |
| miR-103-1, miR-107 | miR-205, miR-296, miR-320, miR-880 | 379, miR-742, | ||
| miR-871 | ||||
|
|
||||
| γ2 | GABRG2 | 0 | miR-182, miR-483, miR-382, miR-505 | 0 |
|
|
||||
| γ3 | GABRG3 | miR-151*, miR-125a-3p | miR-142-3p, miR-298, miR-15b, miR-16, miR-28, | 14 |
| miR-34a, miR-195, miR-214, miR-290, miR-449a, | ||||
| miR-880, miR-708 | ||||
|
|
||||
| π | GABRP | miR-28, miR-708 | miR-345-5p, miR-199a-3p, miR-873 | 0 |
|
|
||||
| δ | GABRD | miR-210 | miR-322, miR-338, miR-193, miR-370, miR-497, miR-873 | 29 |
|
|
||||
| ε | GABRE | 0 | miR-485, miR-484, miR-342-3p, miR-344-5p, miR-223, | 0 |
| miR-671, miR-322, miR-24, miR-139-3p, miR-199a-5p, | ||||
| miR-298, miR-483, miR-497, miR-743b, miR-672 | ||||
|
|
||||
| θ | GABRQ | 0 | miR-350, miR-34c, miR-92a, miR-92a, miR-300-5p, | 0 |
| miR-92b, miR-7a*, miR-32 | ||||
|
|
||||
| ρ1 | GABRR1 | miR-29b-1*, miR-26c | miR-338, let-7d, miR-204*, miR-421, miR-672, | 92 |
| miR-674-3p | ||||
|
|
||||
| ρ2 | GABRR2 | miR-873, miR-134, miR-210, | miR-218*, let-7d, miR-34a, miR-204*, miR-421, | miR-191, |
| miR-207, miR-380, | miR-449a, miR-431, miR-381, miR-674-3p | miR-872* | ||
|
|
||||
| ρ3 | GABRR3 | miR-350, miR-30c-1*, miR-30c- | miR-338, miR-341, miR-23a*, miR-143, miR-384-5p, | miR-191, miR- |
| 2*, miR-148b-3p, miR-152, | miR-324-3p, miR-30c, miR-30e, miR-30b-5p, miR-30d, | 344-1, miR-217, | ||
| miR-872*, miR-874, miR-672 | miR-30a, miR-204*, miR-539, miR-742, miR-873 | miR-883, miR-484 | ||
MicroRNAs which target 5'-UTR, open reading frame (ORF) and 3'-UTR of GABA receptors were predicted by miRWalk software http://www.ma.uni-heidelberg.de. N/A means that no information is available in miRWalk
Article Categories:
|
|
Previous Document: Coronary CT angiography using a prospective protocol. Comparison of image quality and radiation dose...
Next Document: Molecular Demonstration of Trypanosoma evansi and Trypanosoma lewisi DNA in Wild Rodents from Cambod...


