Document Detail


Characterization of four VNTR loci on human chromosome 6.
MedLine Citation:
PMID:  8422498     Owner:  NLM     Status:  MEDLINE    
Abstract/OtherAbstract:
We have determined DNA sequences of four VNTR loci; three in the peritelomeric region of Chromosome (Chr) 6q and one at 6p21. Heterozygosities of these loci among 80 CEPH parents are 78% (D6S139), 69% (D6S149), 76% (D6S161), and 94% (D6S193), respectively. The consensus sequences of repeating units at these VNTR loci are GAGCGGCAGGGGCAGCGGGGCCTGGCCAGAGAG-(34 bp) at D6S139, CCAGGCTGGTTCACAGGCTGTGGGGTGTGATGGGTGATG (39 bp) at D6S149, GGATGGGGTTGGAGGAACTACAGAGCGGTGGTGAAGAGGA (40 bp) at D6S161, and GAGGAGGTGGGGGCCT (16 bp) at D6S193. The GC content of the consensus sequences is 62% as high as reported previously. Furthermore, we have established a PCR assay for D6S193 locus and this will be useful for individual identification or for a study of loss of heterozygosity on the long arm of Chr 6 in malignant tumors.
Authors:
S Takiguchi; S Saito; Y Nakamura
Related Documents :
10527808 - Molecular interpretation of expanded red products in bipolar disorder by cag/ctg repeat...
16179988 - Nor activity and repeat sequences of the paternal sex ratio chromosome of the parasitoi...
1303248 - Linkage of rieger syndrome to the region of the epidermal growth factor gene on chromos...
17855568 - Multiple-locus variable-number tandem-repeat analysis for rapid typing of candida glabr...
3929078 - Effects of 3-aminobenzamide on chinese hamster cells treated with thymidine analogues a...
20606398 - Reciprocal translocation t(4;7)(q14;q28) in cattle: molecular characterization.
Publication Detail:
Type:  Journal Article; Research Support, Non-U.S. Gov't    
Journal Detail:
Title:  Mammalian genome : official journal of the International Mammalian Genome Society     Volume:  4     ISSN:  0938-8990     ISO Abbreviation:  Mamm. Genome     Publication Date:  1993  
Date Detail:
Created Date:  1993-02-19     Completed Date:  1993-02-19     Revised Date:  2006-11-15    
Medline Journal Info:
Nlm Unique ID:  9100916     Medline TA:  Mamm Genome     Country:  UNITED STATES    
Other Details:
Languages:  eng     Pagination:  21-4     Citation Subset:  IM    
Affiliation:
Department of Biochemistry, Cancer Institute, Tokyo, Japan.
Export Citation:
APA/MLA Format     Download EndNote     Download BibTex
MeSH Terms
Descriptor/Qualifier:
Base Sequence
Blotting, Southern
Chromosomes, Human, Pair 6*
Consensus Sequence
DNA / genetics*
Humans
Molecular Sequence Data
Oligodeoxyribonucleotides
Polymerase Chain Reaction
Repetitive Sequences, Nucleic Acid*
Chemical
Reg. No./Substance:
0/Oligodeoxyribonucleotides; 9007-49-2/DNA

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine


Previous Document:  Re-localization of Actsk-1 to mouse chromosome 8, a new region of homology with human chromosome 1.
Next Document:  The structure and evolution of the human salivary proline-rich protein gene family.