| Characterization of the Pseudomonas putida mobile genetic element ISPpu10: an occupant of repetitive extragenic palindromic sequences. | |
| | |
MedLine Citation:
|
PMID: 16352819 Owner: NLM Status: MEDLINE |
Abstract/OtherAbstract:
|
We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere. |
| | |
Authors:
|
María Isabel Ramos-González; María Jesús Campos; Juan Luis Ramos; Manuel Espinosa-Urgel |
Related Documents
:
|
17757239 - Chainpur-like chondrites: primitive precursors of ordinary chondrites? 9436909 - Functionality of mutations at conserved nucleotides in eukaryotic secis elements is det... 16387869 - Transposition of regulatory elements by p-element-mediated rearrangements in drosophila... 2172089 - Identification of an insertion-sequence-like genetic element in the newly recognized hu... 3005589 - The vi element. a transposon-like repeated dna sequence interspersed in the vitellogeni... 9274009 - Association of newly discovered is elements with the dichloromethane utilization genes ... 8206859 - Cloning and analysis of a gene cluster from streptomyces coelicolor that causes acceler... 15500449 - Characterization of phylogenetically distant members of the adenylate cyclase family fr... 17757239 - Chainpur-like chondrites: primitive precursors of ordinary chondrites? |
Publication Detail:
|
Type: Journal Article; Research Support, Non-U.S. Gov't |
Journal Detail:
|
Title: Journal of bacteriology Volume: 188 ISSN: 0021-9193 ISO Abbreviation: J. Bacteriol. Publication Date: 2006 Jan |
Date Detail:
|
Created Date: 2005-12-14 Completed Date: 2006-03-14 Revised Date: 2009-11-18 |
Medline Journal Info:
|
Nlm Unique ID: 2985120R Medline TA: J Bacteriol Country: United States |
Other Details:
|
Languages: eng Pagination: 37-44 Citation Subset: IM |
Affiliation:
|
Department of Plant Biochemistry and Molecular and Cellular Biology, Estación Experimental del Zaidín, CSIC, Profesor Albareda 1, Granada 18008, Spain. maribel.ramos@eez.csic.es |
Export Citation:
|
APA/MLA Format Download EndNote Download BibTex |
| MeSH Terms | |
Descriptor/Qualifier:
|
Amino Acid Sequence Base Sequence Chromosomes, Bacterial / genetics Interspersed Repetitive Sequences / genetics* Molecular Sequence Data Plasmids / genetics Pseudomonas putida / genetics* Repetitive Sequences, Nucleic Acid / genetics* Transposases / chemistry, genetics, metabolism |
| Chemical | |
Reg. No./Substance:
|
EC 2.7.7.-/Transposases |
| Comments/Corrections | |
From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine
Previous Document: Cooperativity between different nutrient receptors in germination of spores of Bacillus subtilis and...
Next Document: Role of the novel OprD family of porins in nutrient uptake in Pseudomonas aeruginosa.