Document Detail

Abundance and distribution of archaeal acetyl-CoA/propionyl-CoA carboxylase genes indicative for putatively chemoautotrophic Archaea in the tropical Atlantic's interior.
Jump to Full Text
MedLine Citation:
PMID:  23330917     Owner:  NLM     Status:  MEDLINE    
Abstract/OtherAbstract:
Recently, evidence suggests that dark CO2 fixation in the pelagic realm of the ocean does not only occur in the suboxic and anoxic water bodies but also in the oxygenated meso- and bathypelagic waters of the North Atlantic. To elucidate the significance and phylogeny of the key organisms mediating dark CO2 fixation in the tropical Atlantic, we quantified functional genes indicative for CO2 fixation. We used a Q-PCR-based assay targeting the bifunctional acetyl-CoA/propionyl-CoA carboxylase (accA subunit), a key enzyme powering inter alia the 3-hydroxypropionate/4-hydroxybutyrate cycle (HP/HB) and the archaeal ammonia monooxygenase (amoA). Quantification of accA-like genes revealed a consistent depth profile in the upper mesopelagial with increasing gene abundances from subsurface layers towards the oxygen minimum zone (OMZ), coinciding with an increase in archaeal amoA gene abundance. Gene abundance profiles of metabolic marker genes (accA, amoA) were correlated with thaumarchaeal 16S rRNA gene abundances as well as CO2 fixation rates to link the genetic potential to actual rate measurements. AccA gene abundances correlated with archaeal amoA gene abundance throughout the water column (r(2)  = 0.309, P < 0.0001). Overall, a substantial genetic predisposition of CO2 fixation was present in the dark realm of the tropical Atlantic in both Archaea and Bacteria. Hence, dark ocean CO2 fixation might be more widespread among prokaryotes inhabiting the oxygenated water column of the ocean's interior than hitherto assumed.
Authors:
Kristin Bergauer; Eva Sintes; Judith van Bleijswijk; Harry Witte; Gerhard J Herndl
Related Documents :
23665147 - A comparative proteomic analysis of vibrio cholerae o1 wild-type cells versus a phob mu...
23034157 - Molecular profiling of postnatal development of the hypothalamus in female and male rats.
24902847 - Targeted germ line disruptions reveal general and species-specific roles for paralog gr...
23065977 - Transcriptional regulation of the cmeabc multidrug efflux pump and the kata catalase by...
10506937 - Regulation mechanisms for the heterodimeric transcription factor, pebp2/cbf.
17699607 - Wnt signaling mediates regional specification in the vertebrate face.
Publication Detail:
Type:  Journal Article; Research Support, Non-U.S. Gov't     Date:  2013-02-13
Journal Detail:
Title:  FEMS microbiology ecology     Volume:  84     ISSN:  1574-6941     ISO Abbreviation:  FEMS Microbiol. Ecol.     Publication Date:  2013 Jun 
Date Detail:
Created Date:  2013-05-13     Completed Date:  2013-07-25     Revised Date:  2013-08-09    
Medline Journal Info:
Nlm Unique ID:  8901229     Medline TA:  FEMS Microbiol Ecol     Country:  England    
Other Details:
Languages:  eng     Pagination:  461-73     Citation Subset:  IM    
Copyright Information:
© 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Affiliation:
Department of Marine Biology, Faculty Center of Ecology, University of Vienna, Vienna, Austria.
Export Citation:
APA/MLA Format     Download EndNote     Download BibTex
MeSH Terms
Descriptor/Qualifier:
Acetyl-CoA Carboxylase / genetics
Archaea / enzymology,  genetics*,  metabolism*
Atlantic Ocean
Carbon Cycle*
Carbon Dioxide / metabolism
Carbon-Nitrogen Ligases / genetics*
Chemoautotrophic Growth*
Darkness
Genes, Archaeal*
Genes, rRNA
Methylmalonyl-CoA Decarboxylase / genetics,  metabolism
Oxidoreductases / genetics*
Phylogeny
RNA, Ribosomal, 16S / genetics,  metabolism
Seawater / microbiology*
Chemical
Reg. No./Substance:
0/RNA, Ribosomal, 16S; 124-38-9/Carbon Dioxide; EC 1.-/Oxidoreductases; EC 1.7.3.-/ammonia monooxygenase; EC 4.1.1.41/Methylmalonyl-CoA Decarboxylase; EC 6.3.-/Carbon-Nitrogen Ligases; EC 6.3.4.14/biotin carboxylase; EC 6.4.1.2/Acetyl-CoA Carboxylase
Comments/Corrections

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine

Full Text
Journal Information
Journal ID (nlm-ta): FEMS Microbiol Ecol
Journal ID (iso-abbrev): FEMS Microbiol. Ecol
Journal ID (publisher-id): fem
ISSN: 0168-6496
ISSN: 1574-6941
Publisher: Blackwell Publishing Ltd
Article Information
Download PDF
Copyright © 2013 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved
open-access:
Received Day: 31 Month: 10 Year: 2012
Revision Received Day: 07 Month: 1 Year: 2013
Accepted Day: 11 Month: 1 Year: 2013
Print publication date: Month: 6 Year: 2013
Electronic publication date: Day: 13 Month: 2 Year: 2013
Volume: 84 Issue: 3
First Page: 461 Last Page: 473
PubMed Id: 23330917
ID: 3732383
DOI: 10.1111/1574-6941.12073

Abundance and distribution of archaeal acetyl-CoA/propionyl-CoA carboxylase genes indicative for putatively chemoautotrophic Archaea in the tropical Atlantic's interior
Kristin Bergauer1
Eva Sintes1
Judith van Bleijswijk2
Harry Witte2
Gerhard J Herndl12
Tillmann Lueders Role: Editor
1Department of Marine Biology, Faculty Center of Ecology, University of ViennaVienna, Austria
2Department of Biological Oceanography, Royal Netherlands Institute for Sea ResearchDen Burg, Texel, The Netherlands
Correspondence: Gerhard J. Herndl, Department of Marine Biology, Faculty Center of Ecology, University of Vienna, A-1090 Vienna, Austria., Tel.: +43-1-4277-57100;, fax: +43-1-4277-9571;, e-mail: gerhard.herndl@univie.ac.at

Introduction

About two decades ago, molecular analyses have revealed that mesophilic Archaea [Thaumarchaeota (Brochier-Armanet et al., 2008), previously coined marine Crenarchaeota Group I, and Group II Euryarchaeota] are ubiquitously present in the global ocean.

The ability of some marine archaeal groups to incorporate dissolved amino acids (Ouverney & Fuhrman, 2000; Teira et al., 2006b) hints at a heterotrophic life mode. Compound-specific isotope analyses of thaumarchaeal lipids, however, revealed a chemoautotrophic lifestyle (Pearson et al., 2001; Wuchter et al., 2003). Pronounced differences in the Δ14C signature of thaumarchaeal DNA were found at a Pacific site at 670 and 900 m depth, indicating a preferential auto- and heterotrophic thaumarchaeal life mode, respectively (Hansman et al., 2009). Experimental work and genomic analysis using Nitrosopumilus maritimus, Cenarchaeum symbiosum and an enrichment culture obtained from the coastal North Sea (Könneke et al., 2005; Hallam et al., 2006a; Ingalls et al., 2006; Wuchter et al., 2006; Martens-Habbena et al., 2009) indicate that these members of the Thaumarchaeota are ammonia oxidizer (AOA) and hence chemolithoautotrophs.

The first step in ammonia oxidation is enzymatically catalysed by ammonia monooxygenase, and the encoding amoA gene is currently the most commonly used marker to determine the abundance of putatively ammonia-oxidizing prokaryotes in environmental studies. Numerous quantitative analyses have revealed that archaeal amoA genes dominate over bacterial amoA genes in soil as well as in marine and freshwater systems, tentatively suggesting that Crenarchaeota might be the main ammonia oxidizers in most environments (Treusch et al., 2005; Wuchter et al., 2006; Francis et al., 2007; Beman et al., 2008; Merbt et al., 2011). Hence, the oxidation of ammonia by AOA has been generally assumed to be the main energy source for dark carbon metabolism.

Apart from the prevalent pathway of carbon fixation, the Calvin–Bassham–Benson cycle (CBB), carried out by plants, algae and mostly photosynthetic bacteria, novel CO2 fixation pathways, such as the 3-hydroxypropionate/4-hydroxybutyrate (HP/HB) and dicarboxylate/4-hydroxybutyrate cycle (DC/4-HB), were found to exclusively operate in Archaea (Berg et al., 2007, 2010; Huber et al., 2008; Ramos-Vera et al., 2009). These metabolic pathways require unique and conserved enzymes that might serve as biomarkers for dark CO2 fixation. A key multifunctional enzyme of the HP/HB cycle, which is typically responsible for the synthesis of fatty acids in Bacteria, is the biotin-dependent acetyl-CoA/propionyl-CoA carboxylase complex (ACCase) (Moss & Lane, 1971; Chuakrut et al., 2003). Due to the lack of fatty acids in archaeal lipids, the enzyme is thought to mediate autotrophic carbon assimilation via the HP/HB cycle (Chuakrut et al., 2003; Hügler et al., 2003).

Additionally to dissolved inorganic carbon (DIC) fixation through autotrophic pathways, many carboxylases substantially contribute to the acquisition of carbon via assimilatory reactions as well as so-called anaplerotic reaction sequences (Werkman & Wood, 1942; Erb, 2011). While assimilatory carboxylases allow for a DIC ‘by-uptake’, anaplerotic reactions are ‘refilling’ the pools of tricarboxylic acid (TCA) cycle intermediates, intimately involved in the energy metabolism of cells. While anaplerotic CO2 fixation of heterotrophic Bacteria has been shown to occur in laboratory cultures, particularly associated with the uptake of labile substrate (Dijkhuizen & Harder, 1995), its contribution to the measured dark CO2 fixation in oceanic water remains enigmatic (Romanenko, 1964; Sorokin, 1993; Dijkhuizen & Harder, 1995; Alonso-Saez et al., 2010; Reinthaler et al., 2010).

The objective of this study was to determine the relative abundance and distribution of putatively chemoautotrophic prokaryotes in the dark realm of the Atlantic. We aimed at linking the genes indicative of chemoautotrophy and their abundance to dark DIC fixation. The abundances of Archaea-specific accA genes were determined by Q-PCR and related to archaeal 16S rRNA and amoA gene abundances, as well as to DIC fixation rates. Based on our data, we conclude that meso- and bathypelagic prokaryotes might have a larger potential for autotrophy than assumed hitherto.


Material and methods
Sample collection

Water samples were collected from the major water masses throughout the water column (from the lower euphotic to the abyssopelagic zone) at 17 stations (Sts. 8–26) along a transect through the Romanche Fracture Zone (RFZ) in the tropical Atlantic during the Archimedes-3 cruise with RV Pelagia from December 2007 to January 2008 (Fig. 1). The physical and chemical characteristics of the sampled water masses are given in Table 1. Specifically, water was collected from the lower euphotic layer at 100 m depth, the South Atlantic Central Water (SACW) exhibiting an oxygen minimum, the Antarctic Intermediate Water (AAIW), the upper (uNADW), middle (mNADW) and lower North Atlantic Deep Water (lNADW) and the Antarctic Bottom Water (AABW) (Table 1). From these water masses, samples for prokaryotic variables (described below) as well as a suite of other microbial parameters (De Corte et al., 2011) were taken. Also, samples were collected to determine inorganic nutrient concentrations (Table 1) using standard spectrophotometric methods and a TRAACS autoanalyzer (Gordon et al., 1993).

Picoplankton abundance determined by flow cytometry

Picoplankton collected from the different water masses were enumerated by flow cytometry. Water samples (2 mL) were fixed with 0.5% glutaraldehyde (final concentration), shock-frozen in liquid nitrogen for 5 min and stored at −80 °C. Immediately before analysis, the samples were thawed and the picoplankton cells stained with SYBR Green I at room temperature in the dark for 15 min and enumerated on a FACScalibur flow cytometer (Becton Dickinson) equipped with a 488-nm laser. Fluorescent microspheres (1 μm diameter, Molecular Probes) were added to all samples as an internal standard. Picoplankton cells were identified based on their characteristic right angle scatter vs. green fluorescence signature.

Dark dissolved inorganic carbon fixation

14C-bicarbonate fixation in the dark was used to determine the bulk autotrophic activity of the prokaryotic community as described previously (Herndl et al., 2005). Briefly, 40 mL of seawater [samples and formaldehyde-fixed blanks (2% final conc.) each in triplicate] were spiked with 14C-bicarbonate (100 μCi; SA 54.0 mCi mmol−1; Amersham) and incubated in the dark at in situ temperature for 48–72 h. Subsequently, the samples were fixed with formaldehyde (2% final conc.), filtered onto 0.2-μm-pore-size filters (Millipore, polycarbonate, 25 mm filter diameter) supported by HAWP filters (Millipore, cellulose acetate, 0.45 μm pore-size) and rinsed three times with 10 mL of ultra-filtered seawater (30-kDa molecular weight cut-off). Thereafter, the filters were exposed to a fume of concentrated HCl for 12 h and placed in scintillation vials. Scintillation cocktail (8 mL Canberra-Packard Filter Count) was added, and after 18 h, the sample counted in a liquid scintillation counter (Tri-Carb 3100TR, PerkinElmer) on board RV Pelagia. The mean disintegrations per minute (DPM) of the formaldehyde-fixed blanks were subtracted from the mean DPM of the respective samples and the resulting DPM converted into DIC fixation rates taking into account the ambient DIC concentration measured by continuous-flow analysis (Stoll et al., 2001).

DNA extraction

Ten litres of seawater were filtered through 0.2-μm Sterivex filter units (Millipore), and thereafter, 1.8 mL of lysis buffer (40 mM EDTA, 50 mM Tris-HCL, 0.75 M sucrose) was added to the filter cartridges, sealed at both ends with Parafilm and stored in the dark at −80 °C. Back in the laboratory, the Sterivex filter cartridges were cracked open and the lysis solution with the Sterivex filters transferred to sterile 50-mL centrifuge tubes. DNA extraction was carried out with the Mega Soil DNA extraction kit (MoBio laboratories, Carlsbad, CA) according to the manufacturer's protocol. Subsequently, isolated DNA was further concentrated (approximately 10 times) with a Centricon device (Millipore).

Evaluating the primer set for detecting accA genes

The annealing temperatures for the primer set Crena_529F/Crena_981R (Yakimov et al., 2009), specifically targeting archaeal acetyl-CoA carboxylase alpha subunit (accA), were tested by a temperature gradient as follows: denaturation at 94 °C for 4 min; 35 cycles of denaturation at 94 °C for 40 s, annealing at 45–55 °C for 40 s and extension at 72 °C for 90 s, followed by an extension at 72 °C for 10 min and cooling at 4 °C. PCR products were checked on a 2% agarose gel. The optimal annealing temperature was at 51 °C for accA primer set. PCR products of the expected size were obtained from enrichment cultures (Nitrosopumilus maritimus, Sulfolobus solfataricus, Nitrosococcus oceani, Nitrosomonas europaea), known to encode a bifunctional acetyl-CoA/propionyl-CoA carboxylase.

Quantitative PCR (Q-PCR) accA, archaeal amoA, archaeal 16S rRNA genes

All Q-PCRs were performed using an iCycler iQ 5 thermocycler (Bio-Rad) and i-Cycler iQ software (version 3.1, Bio-Rad). The reaction mixture was composed of 1 U of PicoMaxx high fidelity DNA polymerase (Stratagene), 2 μL of 10× PicoMaxx PCR buffer, 0.25 mM of each dNTP, 8 μg of BSA, 0.2 μM of each primer, 50 000 times diluted SYBR Green® (Invitrogen), and a final concentration of 10 nM of fluorescein, 3 mM of MgCl2, 1 μL of template DNA (average concentration 11.3 ng μL−1) and ultrapure sterile water (Sigma) was added to a final volume of 20 μL. All reactions were performed in iQ 96-well PCR plates (Bio-Rad) with optical sealing foils (Bio-Rad). The specificity of Q-PCRs was tested by electrophoresis on a 2% agarose gel and melting curve analysis. Standard curves were generated using serial dilutions of PCR products of known gene abundance (from 107 to 101 gene copies) obtained with the described primers (Table 2). The amount of DNA from the PCR products was determined spectrophotometrically (Nanodrop Technologies, Rockland, DE), and the gene abundance was calculated based on the fragment length and the DNA concentration. Ten-fold serial dilutions of the standard for the specific genes and no-DNA controls were run in triplicate with each plate. The following thermal cycling protocol was used: initial denaturation at 95 °C for 4 min; 41 cycles at 95 °C for 30 s, followed by the respective primer annealing temperature for 40 s, extension at 72 °C for 30 s and 80 °C for 25 s with readings taken between each cycle. To check for potential PCR artefacts, a melting curve analysis was performed at this point by monitoring SYBR Green fluorescence in the temperature ramp 60 to 94 °C with an increase of 0.5 °C and a hold for 1 s between each read.

The ‘total’ archaeal amoA gene abundance was calculated as the sum of archaeal amoA gene abundances yielded with the two primer sets Arch-amoA-for and Arch-amoA-rev as well as Arch-amoA-rev NEW (Table 2), assuming specific priming of distinct amoA gene types.

The efficiencies of Q-PCRs were 98% (r2 = 0.998) and 101% (r2 = 0.999) obtained with the archaeal amoA primers of Wuchter et al. (2006) and Konstantinidis et al. (2009), respectively. Amplification efficiency for the ACCase-related primer pair was 73% (r2 = 0.994). The specificity of PCR products was confirmed by melting curve analysis and analyses of agarose gels. For Thaumarchaeota, primed with MCGI-391-for and MCGI-554-rev, Q-PCR efficiencies ranged between 84% and 96% (r2 = 0.983–0.997, Table 2).

Statistical analyses

Statistics of Q-PCR data were performed with SigmaPlot, and linear regressions were calculated between archaeal amoA and accA gene abundances.


Results
Hydrography

Specific water masses were sampled as shown by their distinct physical and chemical characteristics (Table 1). The highest apparent oxygen utilization (AOU) was detected in the SACW followed by AAIW and AABW (Table 1). The two lower NADW layers (mNADW and lNADW) were characterized by a higher concentration of silicate than the upper NADW reflecting a certain extent of mixing of the underlying AABW with its characteristically high silicate concentration with NADW (Table 1).

Picoplankton and archaeal abundance

Picoplankton abundance, determined by flow cytometry, decreased by one order of magnitude from the 100-m layer to the abyssopelagic waters with little lateral variability throughout the RFZ (Fig. 2a). Picoplankton abundance varied between 1.8 × 105 and 3.5 × 105 cells mL−1 at 100 m depth, 4.6 × 104 and 2.4 × 105 cells mL−1 in the mesopelagic waters, 1.6 × 104 and 3.3 × 104 cells mL−1 in the bathypelagic, and between 1.5 × 104 and 3.8 × 104 cells mL−1 in the abyssopelagic realm (Fig. 2a).

The 16S rRNA gene abundance of Thaumarchaea obtained by Q-PCR varied by 3 orders of magnitude over the entire depth range: between 1.5 × 104 and 1.7 × 105 mL−1 in the 100-m layer, 9.7 × 103 and 3.9 × 105 mL−1 in the mesopelagic, 5.9 × 102 and 2.9 × 104 mL−1 in the bathypelagic, and between 1.2 × 102 and 1.6 × 104 mL−1 in the abyssopelagic waters (Fig. 2b, Fig. S2). In the oxygen minimum zone (between 250 and 750 m depth), thaumarchaeal 16S rRNA gene abundance was significantly higher (Kruskal–Wallis, one-way ANOVA; P ≤ 0.001, for 1750, 2750, 3500, 4500 and 6000 m) than in the waters below the O2 minimum layer. Overall, thaumarchaeal 16S rRNA gene abundances were significantly lower in the western than in the eastern part of the RFZ (ANOVA on ranks, Kruskal–Wallis, P ≤ 0.001). However, no significant difference (ANOVA on ranks, Dunn's method P ≥ 0.05) was detectable in the thaumarchaeal 16S rRNA gene abundance between the western and eastern part of the RFZ in the meso- and upper bathypelagic waters (200–2500 m, Fig. 2b).

Distribution of carboxylase genes determined by Q-PCR

The abundance of acetyl-CoA/propionyl-CoA carboxylase alpha subunit (accA) genes ranged between 1.1 × 104 and 5.3 × 104 mL−1 at 100 m depth, 1.1 × 104 and 5.2 × 105 mL−1 in the mesopelagic, 2.6 × 103 and 4.9 × 104 mL−1 in the bathypelagic, and between 7.6 × 102 mL−1 and 4.8 × 104 genes mL−1 in the abyssopelagic realm (Fig. 2c, Fig. S2). In the AAIW and SACW, the abundance of accA genes was similar (ANOVA on ranks, Kruskal–Wallis, Dunn's method, P ≥ 0.05) to thaumarchaeal 16S rRNA gene abundance (Fig. 2b and c).

Generally, accA gene abundance was higher in the AAIW, SACW, NADW and the AABW in the eastern (Sts. 19–26) than in the western section of the RFZ (Figs 2c and 3). Total picoplankton, however, did not increase in abundance from west to east through the RFZ (Fig. 2a).

Relation between archaeal amoA and accA gene abundances

The amoA gene encoding the archaeal ammonia monooxygenase-α subunit was quantified as a proxy for putatively ammonia-oxidizing Archaea (Fig. 2d). The abundance of archaeal amoA genes obtained with both primer sets (Table 2) was summed and related to accA gene abundance (Fig. 4). Archaeal amoA and accA gene abundance were weakly related to each other over the entire depth range (r2 = 0.309, P < 0.0001, n = 91). Excluding the data of the 100 m-depth horizon, however, resulted in a tighter correlation (r2 = 0.407, P < 0.0001, n = 80) of archaeal amoA and accA gene abundance than with the gene abundances of the 100 m layer included (Fig. 4).

Relation between thaumarchaeal 16S rRNA and accA gene abundance

The biotin carboxylase alpha subunit was significantly correlated with 16S rRNA gene abundances of Thaumarchaeota, excluding the samples from 100 m depth (accA: r2 = 0.552, P < 0.0001, not shown). Including the gene abundance obtained in the 100 m layer resulted in a slightly weaker correlation with accA genes (r2 = 0.493, P < 0.0001, not shown). The ratio of accA/thaumarchaeal 16S rRNA gene abundance ranged between 0.6 and 5.9 from the subsurface to the bathypelagic layers, respectively (Fig. 3). In the O2 minimum zone (250–750 m), this ratio approached roughly unity and remained above 1 towards deeper layers (Fig. 3). No significant differences were found in the accA/thaumarchaeal 16S rRNA gene ratio between the western and eastern part of the RFZ (Fig. 3; ANOVA, Kruskal–Wallis, P > 0.05, respectively).

Dark DIC fixation

Generally, prokaryotic dark DIC fixation rates increased from 4.3 ± 0.7 μmol C m−3 days−1 in the 100 m layer to 6.2 ± 4.2 μmol C m−3 days−1 at 250 m depth (Table 3, Supporting Information, Fig. S1). Below 250 m depth, DIC fixation rates were well below 1 μmol C m−3 days−1 (Table 3). In the central part of the RFZ (Sts. 16–19), higher dark DIC fixation rates were observed in the mesopelagic realm than in the marginal regions of the RFZ ranging from 6.7 to 14.1 μmol C m−3 days−1. Relating gene abundances to activity rates, only 30% of the variation in the CO2 fixation was explained by the summed abundance of archaeal amoA genes (not shown). A lower or similar explanatory power was found between DIC fixation rates and accA (10%) and thaumarchaeal 16S rRNA (30%) gene abundances (data not shown).


Discussion

In this study, we related the abundance of genes encoding the archaeal biotin carboxylase and archaeal ammonia monooxygenase to dark DIC fixation rates, exploring the genetic potential for chemoautotrophy. The occurrence of archaeal accA genes and their ubiquitous distribution throughout the pelagic realm of the open ocean are highly indicative of a chemoautotrophic lifestyle via the HP/HB cycle (Wuchter et al., 2006; Berg et al., 2007, 2010; Ward et al., 2007; Auguet et al., 2008; Pratscher et al., 2011) as archaeal lipids are devoid of fatty acids.

DIC fixation in the dark ocean

Dark carbon metabolism and fixation rates in the oxygenated realm of the global ocean have been of interest for some time (Prakash et al., 1991), yet the organisms responsible for it remained ambiguous. Gradually, evidence is accumulating that DIC fixation in the dark ocean might be more prevalent than hitherto assumed (Auguet et al., 2008; Alonso-Saez et al., 2010; Hu et al., 2011; Varela et al., 2011). Measurements by Reinthaler et al. (2010) indicate dark DIC fixation rates in the meso- and bathypelagic waters of the North Atlantic amounts to about 15–53% of the export primary production. Comparative studies of prokaryotic heterotrophic biomass synthesis and DIC fixation in the dark realm of the North Atlantic revealed that DIC fixation is within the same order of magnitude as heterotrophic biomass production (Baltar et al., 2009; Reinthaler et al., 2010). Whether this DIC fixation is mainly due to autotrophic or heterotrophic microorganisms remains uncertain. Some recent studies emphasize the significance of anaplerotic CO2 conversion (Alonso-Saez et al., 2010; Lliros et al., 2011) in the context of microbial carbon cycling. Laboratory studies, however, provide contradictory evidence, showing that anaplerosis amounts to < 10% of organic carbon uptake by heterotrophic bacteria (Goldman et al., 1987; Dijkhuizen & Harder, 1995; Roslev et al., 2004). Anaplerosis, as reported by Doronina & Trotsenko (1985), appears to be stimulated by the presence of easily metabolizable organic carbon and consequently might play a minor role in the DIC fixation in deep waters (Reinthaler et al., 2010) where the organic carbon pool is largely refractory (Hansell et al., 2009; Jiao et al., 2010). A recent study indicates that members of the SAR324 cluster are ubiquitous present in the mesopelagic waters of the Atlantic and Pacific using RuBisCO as DIC acquisition enzyme (Swan et al., 2011). Hence, neither the extent of chemoautotrophy nor the potential metabolic pathways are probably completely known.

In this study, we determined the abundance of the archaeal accA gene and used it as a marker for DIC fixation via the HP/HB cycle. This cycle functions in (micro) aerobic members of the crenarchaeal order Sulfolobales containing the acetyl-CoA/propionyl-CoA carboxylase for CO2 assimilation (Ishii et al., 1996; Menendez et al., 1999; Berg et al., 2007, 2010; Fuchs, 2011). The presence of genes encoding the key enzymes in the HP/HB cycle of Thaumarchaeota suggests that these and related abundant marine Archaea (Karner et al., 2001) may use a similar cycle. Key enzymes of the HP/HB cycle, including the acetyl-CoA/propionyl-CoA carboxylase, were unambiguously identified, whereas enzymes encoding genes of other autotrophic pathways were absent in the ammonia-oxidizing sponge symbiont C. symbiosum and the free-living N. maritimus (Könneke et al., 2005; Hallam et al., 2006a; Berg et al., 2007).

Q-PCR profiles of accA genes assessed in the western and eastern part of the longitudinal transect of the RFZ revealed highly similar tendencies in their distribution along the depth strata (Fig. 3). The accuracy of determining the gene abundance of the accA subunit by Q-PCR depends on the efficiency of the Q-PCR and a reliable standardization of the method. The observed Q-PCR efficiencies varied depending on the primer pair used and were lower amplifying the accA gene (Yakimov et al., 2009) than other genes quantified in this study (Table 2). Determination of gene numbers and differences in efficiencies can be caused by a number of factors, such as initial extraction of nucleic acids, preparation and amplification of the standard curve template (Love et al., 2006), the presence of reverse transcriptase, reaction reagents, fragment size of the target gene and PCR inhibitors. AccA primers, applied in DGGE analyses (Yakimov et al., 2009) as well as Q-PCR assays (Hu et al., 2011), yield rather long amplicons (Table 2), possibly impairing PCR efficiencies. However, amplification efficiencies were constant throughout our measurements and hence reproducible. We are confident that reliable estimates of the different gene abundances were achieved in this study. DNA extraction efficiencies were consistent, yielding DNA concentrations proportional to total cell counts (Fig. 2) within discrete depth layers (Table S2). Dilution series were performed a priori to check on PCR inhibitors empirically (see Supporting Information, Data S1). Variance in Ct values of triplicate reactions was higher when gene abundance was high and ranged between 102 and 104 gene copy numbers (Supporting Information, Table S1). Fierer et al. (2005), however, showed that varying DNA concentrations do not result in significant changes in gene abundances, supporting our conclusion of accurate gene numbers using the Q-PCR assay.

Spatial variations in gene abundances

Prokaryotic abundance (Fig. 2) and dark DIC fixation (Table 3, Fig. S1) declined exponentially from surface to abyssopelagic layers as shown in previous studies from the North Atlantic (Reinthaler et al., 2006; Teira et al., 2006a; Varela et al., 2008). Also, a pronounced stratification in the composition of prokaryotic communities in the meso- and bathypelagic realm in the Atlantic and the Pacific has been reported (DeLong et al., 2006; Aristegui et al., 2009; Agogue et al., 2011). In this study, thaumarchaeal 16S rRNA gene abundance in the deep waters of the tropical Atlantic was within the range of abundances previously found (Varela et al., 2008; De Corte et al., 2009). However, thaumarchaeal 16S rRNA gene abundance profiles revealed a patchy spatial distribution in the upper mesopelagic layer and a more homogenous distribution below 1750 m depth (Fig. 2b). The percentage of thaumarchaeal 16S rRNA genes to total picoplankton counts (determined by flow cytometry) ranged between ∼7% and < 23% in the AABW, the oxygen minimum layer and in the lNADW. Similar abundances were also reported using CARD-FISH (catalyzed reporter deposition-fluorescence in situ hybridization) (Varela et al., 2008). Hence, independent of the quantification method used, a coherent pattern in the distribution of Thaumarchaeota in the different depth layers of the Atlantic is evident.

In the central-eastern part of the RFZ, the high abundance of thaumarchaeal 16S rRNA genes down to 1750 m depth (Fig. 2b, Sts. 15–23) coincided with high DIC fixation rates (10.5–14 μmol C m−3 days−1) and a high AOU (∼172 μmol O2 kg−1). While the high AOU may indicate an increased heterotrophic activity, the high DIC fixation rates are likely due to the activity of chemoautotrophs rather than anaplerotic reactions of heterotrophs because the autotrophic activity is similar to the measured heterotrophic prokaryotic biomass production (De Corte et al., 2010).

Correlating the abundance of biotin carboxylase α-subunit genes to the 16S rRNA gene abundance of Thaumarchaeota, ratios close to one were obtained in the central parts of the RFZ. The high abundance of accA genes below 2000 m depth at Sts. 23 and 25 (Fig. 2c), however, is not reflected in enhanced DIC fixation rates (measured down to 4550 m depth, Fig. S1) or elevated concentrations of ammonia and/or nitrite (data not shown). This might indicate that the ecological function of Crenarchaeota is changing across the depth strata or alternative pathways of DIC fixation are followed. Similar dynamics have been shown by Grzymski et al. (2012), reporting seasonal shifts of chemolithoautotrophic organisms in surface waters of the Antarctic Peninsula.

A positive relation of thaumarchaeal 16S rRNA gene abundance and the concentration of ammonia (Wuchter et al., 2006; Kirchman et al., 2007; Varela et al., 2008) as well as nitrite (Teira et al., 2006a; Lam et al., 2007) has been reported for surface and mesopelagic waters, tentatively indicating chemolithoautotrophy of ammonia-oxidizing Thaumarchaeota. Dark DIC fixation rates normalized to accA gene abundance varied over three to five orders of magnitude over all depths sampled (data not shown) reflecting either large variations in the expression of ACCase and/or a large variability in the enzymes responsible for CO2 fixation in the deep ocean.

Relating the gene abundance of archaeal amoA and thaumarchaeal 16S rRNA genes in the upper 250 m revealed a ratio of accA/thaumarchaeal 16S rRNA gene of ∼ 1.2 averaged over the whole transect of the RFZ (Table 3). Similar values were reported by Alonso-Saez et al. (2012) in polar oceans and Mincer et al. (2007) for the HOTS station in the Pacific, whereas Beman et al. (2008) and Wuchter et al. (2006) obtained accA/thaumarchaeal 16S rRNA gene ratios of about 2.5 and 2.8 in the Gulf of California and the North Atlantic, respectively. Significantly lower accA/thaumarchaeal 16S rRNA gene ratios (Table 3) were obtained from the lower meso- and bathypelagic waters of the RFZ, tentatively indicating that other energy sources than ammonia might be utilized in the lower meso- and bathypelagic waters.

Archaeal amoA and accA gene abundances were only weakly correlated over the whole depth range (Fig. 4). A metagenomic survey by Hallam et al. (2006b) reported a gene ratio of accA/amoA close to one in surface waters. In our study, the exclusion of the 100-m samples, however, resulted in a tighter relationship of archaeal amoA to accA gene abundances. These differences might be caused by the specificity of the primers designed based on a few sequences (Yakimov et al., 2009), possibly failing to target accA homologues of epipelagic Archaea. Data indicative of a vertical stratification of Crenarchaeota in a ‘shallow-’ and ‘deep-water clade’ have recently been suggested based on accA gene diversity (Hu et al., 2011; Yakimov et al., 2011). A genomic and transcriptomic survey in the deep waters of the Gulf of California also revealed multiple populations of Crenarchaeota (Baker et al., 2012). Based on our data, the rather weak correlation between genes encoding the archaeal ammonia monooxygenase and acetyl-CoA carboxylase suggests that the HP/HB cycle might be fuelled at least to a certain extent by energy sources other than ammonia.

The overall ratio of the acetyl-CoA/propionyl-CoA carboxylase gene to thaumarchaeal 16S rRNA gene abundance supports the assumption that a major fraction of Thaumarchaeota is capable of fixing DIC via the HP/HB cycle. Assuming the accA gene is present as a single copy in the crenarchaeal genome (Könneke et al., 2005; Hallam et al., 2006a), its abundances matches roughly those of thaumarchaeal cells in the SACW and AAIW (Fig. 3). In the water layers of the NADW and AABW, the ratio of accA/thaumarchaeal 16S genes increased to 3.8 and 5.5, respectively. Highest accA gene abundance (1.14 × 105 genes mL−1) was obtained in the oxygen minimum zone (200–750 m depth) corresponding to the highest abundance of thaumarchaeal 16S rRNA genes. In a previous study, high accA gene abundance (2.08 × 103 ± 312 mL−1) was found at 3000 m depth in the Tyrrhenian Sea (western Mediterranean Sea) and a ratio of accA/thaumarchaeal cells of about unity (Yakimov et al., 2009).

Overall, the gene abundances obtained by Q-PCR of archaeal accA, archaeal amoA and thaumarchaeal 16S rRNA genes reveal similar trends of gene abundances with depth. The high abundance of thaumarchaeal 16S rRNA genes in the oxygen minimum layer might reflect the importance of Thaumarchaeota in the biogeochemical processes, particularly nitrification, occurring in this layer. However, also some groups of mesopelagic Bacteria such as members of the SAR324 or the SUP05 cluster contribute to autotrophy in the dark ocean (Swan et al., 2011).

Taken together, this study, along with some other recent work, demonstrates that there is a substantial genetic predisposition of DIC fixation present in the dark ocean. In this context, it adds to the emerging notion that dark ocean DIC fixation might be more important than hitherto assumed. The extent to which this DIC assimilation is due to anaplerotic reactions of heterotrophic prokaryotes or true autotrophy remains to be shown. Additional studies, including the quantification of other related genes and proteomic approaches, are needed to shed light on the modes of archaeal carbon metabolism. The sheer magnitude of DIC fixation, roughly equalling heterotrophic production in the North Atlantic deep waters, however, might indicate that the anaplerotic metabolism of heterotrophic prokaryotes is of minor importance and that autotrophic processes prevail in the DIC fixation pathway in the Atlantic's interior.


We thank the captain and crew of R/V Pelagia for their support and splendid atmosphere on board. K.B. and E.S. were supported by the ESF EuroCores project MOCA financed via the Austria Science Fund (FWF, project number I 486-B09) and the FWF project MICRO-ACT (project number 23234-B11). We also acknowledge three anonymous reviewers for valuable feedback and constructive comments. Laboratory work was also supported by funds from the Univ. of Vienna to G.J.H. Ship-time was provided by a grant of the Earth and Life Science Division of the Dutch Science Foundation (ARCHIMEDES project, 835.20.023) to G.J.H. This work is in partial fulfilment of the requirements for a Ph.D. degree from the University of Vienna by K.B.


References
Agogue H,Lamy D,Neal PR,Sogin ML,Herndl GJ. Water mass-specificity of bacterial communities in the North Atlantic revealed by massively parallel sequencingMol EcolYear: 20112025827421143328
Alonso-Saez L,Galand PE,Casamayor EO,Pedros-Alio C,Bertilsson S. High bicarbonate assimilation in the dark by Arctic bacteriaISME JYear: 201041581159020555365
Alonso-Saez L,Waller AS,Mende DR,et al. Role for urea in nitrification by polar marine ArchaeaProc Natl Acad Sci USAYear: 2012109179891799423027926
Aristegui J,Gasol JM,Duarte CM,Herndl GJ. Microbial oceanography of the dark ocean's pelagic realmLimnol OceanogrYear: 20095415011529
Auguet JC,Borrego CM,Baneras L,Casamayor EO. Fingerprinting the genetic diversity of the biotin carboxylase gene (accC) in aquatic ecosystems as a potential marker for studies of carbon dioxide assimilation in the darkEnviron MicrobiolYear: 2008102527253618557770
Baker BJ,Lesniewski RA,Dick GJ. Genome-enabled transcriptomics reveals archaeal populations that drive nitrification in a deep-sea hydrothermal plumeISME JYear: 201262269227922695863
Baltar F,Aristegui J,Sintes E,Aken HMv,Gasol JM,Herndl GJ. Prokaryotic extracellular enzymatic activity in relation to biomass production and respiration in the meso- and bathypelagic waters of the (sub)tropical AtlanticEnviron MicrobiolYear: 2009111998201419508555
Beman JM,Popp BN,Francis CA. Molecular and biogeochemical evidence for ammonia oxidation by marine Crenarchaeota in the Gulf of CaliforniaISME JYear: 2008242944118200070
Berg IA,Kockelkorn D,Buckel W,Fuchs G. A 3-hydroxypropionate/4-hydroxybutyrate autotrophic carbon dioxide assimilation pathway in archaeaScienceYear: 20073181782178618079405
Berg IA,Kockelkorn D,Ramos-Vera WH,Say RF,Zarzycki J,Hugler M,Alber BE,Fuchs G. Autotrophic carbon fixation in archaeaNat Rev MicrobiolYear: 2010844746020453874
Brochier-Armanet C,Boussau B,Gribaldo S,Forterre P. Mesophilic Crenarchaeota: proposal for a third archaeal phylum, the ThaumarchaeotaNat Rev MicrobiolYear: 2008624525218274537
Chuakrut S,Arai H,Ishii M,Igarashi Y. Characterization of a bifunctional archaeal acetyl coenzyme-A carboxylaseJ BacteriolYear: 200318593894712533469
De Corte D,Yokokawa T,Varela MM,Agogue H,Herndl GJ. Spatial distribution of Bacteria and Archaea and amoA gene copy numbers throughout the water column of the Eastern Mediterranean SeaISME JYear: 2009314715818818711
De Corte D,Sintes E,Winter C,Yokokawa T,Reinthaler T,Herndl GJ. Links between viral and prokaryotic communities throughout the water column in the (sub)tropical Atlantic OceanISME JYear: 201041431144220485386
De Corte D,Sintes E,Yokokawa T,Herndl GJ. Changes in viral and bacterial communities during the ice-melting season in the coastal Arctic (Kongsfjorden, Ny-Alesund)Environ MicrobiolYear: 2011131827184121554518
DeLong EF,Preston CM,Mincer T,et al. Community genomics among stratified microbial assemblages in the ocean's interiorScienceYear: 200631149650316439655
Dijkhuizen L,Harder W. Dalton HMicrobial metabolism of carbon dioxideComprehensive BiotechnologyYear: 1995OxfordPergamon Press409423
Doronina NV,Trotsenko YA. Levels of carbon dioxide assimilation in bacteria with different pathways of C1 metabolismMikrobiologiyaYear: 198553885889
Erb TJ. Carboxylases in natural and synthetic microbial pathwaysAppl Environ MicrobYear: 20117784668477
Fierer N,Jackson JA,Vilgalys R,Jackson RB. Assessment of soil microbial community structure by use of taxon-specific quantitative PCR assaysAppl Environ MicrobiolYear: 2005714117412016000830
Francis CA,Beman JM,Kuypers MMM. New processes and players in the nitrogen cycle: the microbial ecology of anaerobic and archaeal ammonia oxidationISME JYear: 20071192718043610
Fuchs G. Alternative pathways of carbon dioxide fixation: insights into the early evolution of life?Annu Rev MicrobiolYear: 20116563165821740227
Goldman JC,Caron DA,Dennett MR. Regulation of gross growth efficiency and ammonium regeneration in bacteria by substrate C-N ratioLimnol OceanogrYear: 19873212391252
Gordon LI,Jennings JC,Ross AA,Krest JM. Year: 1993 A suggested protocol for continuous flow automated analysis of seawater nutrients in the WOCE hydrographic program and the Joint Global Ocean Fluxes Study. WOCE Operations Manual, WHP Office Report 91-91-revision.
Grzymski JJ,Riesenfeld CS,Williams TJ,et al. A metagenomic assessment of winter and summer bacterioplankton from Antarctica Peninsula coastal surface watersISME JYear: 201261901191522534611
Hallam SJ,Konstantinidis KT,Putnam N,et al. Genomic analysis of the uncultivated marine crenarchaeote Cenarchaeum symbiosumP Natl Acad Sci USAYear: 2006a1031829618301
Hallam SJ,Mincer TJ,Schleper C,Preston CM,Roberts K,Richardson PM,DeLong EF. Pathways of carbon assimilation and ammonia oxidation suggested by environmental genomic analyses of marine CrenarchaeotaPLoS BiolYear: 2006b495
Hansell DA,Carlson CA,Repeta DJ,Schlitzer R. Dissolved organic matter in the ocean a controversy stimulates new insightsOceanographyYear: 200922202211
Hansman RL,Griffin S,Watson JT,Druffel ERM,Ingalls AE,Pearson A,Aluwihare LI. The radiocarbon signature of microorganisms in the mesopelagic oceanP Natl Acad Sci USAYear: 200910665136518
Herndl GJ,Reinthaler T,Teira E,van Aken H,Veth C,Pernthaler A,Pernthaler J. Contribution of Archaea to total prokaryotic production in the deep Atlantic OceanAppl Environ MicrobYear: 20057123032309
Hu A,Jiao N,Zhang CL. Community structure and function of planktonic Crenarchaeota: changes with depth in the South China SeaMicrob EcolYear: 20116254956321597940
Huber H,Gallenberger M,Jahn U,Eylert E,Berg IA,Kockelkorn D,Eisenreich W,Fuchs G. A dicarboxylate/4-hydroxybutyrate autotrophic carbon assimilation cycle in the hyperthermophilic Archaeum Ignicoccus hospitalisProc Natl Acad Sci USAYear: 20081057851785618511565
Hügler M,Krieger RS,Jahn M,Fuchs G. Characterization of acetyl-CoA/propionyl-CoA carboxylase in Metallosphaera sedula - Carboxylating enzyme in the 3-hydroxypropionate cycle for autotrophic carbon fixationJ BiochemYear: 2003270736744
Ingalls AE,Shah SR,Hansman RL,Aluwihare LI,Santos GM,Druffel ER,Pearson A. Quantifying archaeal community autotrophy in the mesopelagic ocean using natural radiocarbonP Natl Acad Sci USAYear: 200610364426447
Ishii M,Miyake T,Satoh T,Sugiyama H,Oshima Y,Kodama T,Igarashi Y. Autotrophic carbon dioxide fixation in Acidianus brierleyiArch MicrobiolYear: 19961663683719082912
Jiao JJ,Wang Y,Cherry JA,Wang XS,Zhi BF,Du HY,Wen DG. Abnormally high ammonium of natural origin in a coastal aquifer-aquitard system in the Pearl River Delta, ChinaEnviron Sci TechnolYear: 2010447470747520806932
Karner MB,DeLong EF,Karl DM. Archaeal dominance in the mesopelagic zone of the Pacific OceanNatureYear: 200140950751011206545
Kirchman DL,Elifantz H,Dittel AI,Malmstrom RR,Cottrell MT. Standing stocks and activity of Archaea and Bacteria in the western Arctic OceanLimnol OceanogrYear: 200752495507
Konstantinidis KT,Braff J,Karl DM,DeLong EF. Comparative metagenomic analysis of a microbial community residing at a depth of 4000 meters at station ALOHA in the North Pacific subtropical gyreAppl Environ MicrobiolYear: 2009755345535519542347
Könneke M,Bernhard AE,de la Torre JR,Walker CB,Waterbury JB,Stahl DA. Isolation of an autotrophic ammonia-oxidizing marine archaeonNatureYear: 200543754354616177789
Lam P,Jensen MM,Lavik G,McGinnis DF,Muller B,Schubert CJ,Amann R,Thamdrup B,Kuypers MMM. Linking crenarchaeal and bacterial nitrification to anammox in the Black SeaProc Natl Acad Sci USAYear: 20071047104710917420469
Lliros M,Alonso-Saez L,Gich F,Plasencia A,Auguet O,Casamayor EO,Borrego CM. Active bacteria and archaea cells fixing bicarbonate in the dark along the water column of a stratified eutrophic lagoonFEMS Microbiol EcolYear: 20117737038421517915
Love JL,Scholes P,Gilpin B,Savill M,Lin S,Samuel L. Evaluation of uncertainty in quantitative real-time PCRJ Microbiol MethodsYear: 20066734935616735069
Martens-Habbena W,Berube PM,Urakawa H,de la Torre JR,Stahl DA. Ammonia oxidation kinetics determine niche separation of nitrifying Archaea and BacteriaNatureYear: 200946197697919794413
Menendez C,Bauer Z,Huber H,Gad'on N,Stetter KO,Fuchs G. Presence of acetyl coenzyme A (CoA) carboxylase and propionyl-CoA carboxylase in autotrophic Crenarchaeota and indication for operation of a 3-hydroxypropionate cycle in autotrophic carbon fixationJ BacteriolYear: 1999181108810989973333
Merbt SN,Auguet JC,Casamayor EO,Marti E. Biofilm recovery in a wastewater treatment plant-influenced stream and spatial segregation of ammonia-oxidizing microbial populationsLimnol OceanogrYear: 20115610541064
Mincer TJ,Church MJ,Taylor LT,Preston C,Karl DM,DeLong EF. Quantitative distribution of presumptive archaeal and bacterial nitrifiers in Monterey Bay and the North Pacific Subtropical GyreEnviron MicrobiolYear: 200791162117517472632
Moss J,Lane MD. Biotin-dependent enzymesAdv Enzymol Relat Areas Mol BiolYear: 1971353213314150153
Ouverney CC,Fuhrman JA. Marine planktonic Archaea take up amino acidsAppl Environ MicrobYear: 20006648294833
Pearson A,McNichol AP,Benitez-Nelson BC,Hayes JM,Eglinton TI. Origins of lipid biomarkers in Santa Monica Basin surface sediment: a case study using compound-specific Delta C-14 analysisGeochim Cosmochim ActaYear: 20016531233137
Prakash A,Sheldon RW,Sutcliffe WH. Geographic-Variation of Oceanic C-14 Dark UptakeLimnol OceanogrYear: 1991363039
Pratscher J,Dumont MG,Conrad R. Ammonia oxidation coupled to CO2 fixation by archaea and bacteria in an agricultural soilP Natl Acad Sci USAYear: 201110841704175
Ramos-Vera WH,Berg IA,Fuchs G. Autotrophic carbon dioxide assimilation in Thermoproteales revisitedJ BacteriolYear: 20091914286429719411323
Reinthaler T,van Aken H,Veth C,Aristegui J,Robinson C,Williams PJB,Lebaron P,Herndl GJ. Prokaryotic respiration and production in the meso- and bathypelagic realm of the eastern and western North Atlantic basinLimnol OceanogrYear: 20065112621273
Reinthaler T,Aken HMv,Herndl GJ. Major contribution of autotrophy to microbial carbon cycling in the North Atlantic's interiorDeep-Sea Res Pt IIYear: 20105715721580
Romanenko VI. Heterotrophic CO2 assimilation by water bacterial floraMikrobiologiyaYear: 19643367968314242449
Roslev P,Larsen MB,Jorgensen D,Hesselsoe M. Use of heterotrophic CO2 assimilation as a measure of metabolic activity in planktonic and sessile bacteriaJ Microbiol MethodsYear: 20045938139315488281
Sorokin DY. Influence of thiosulfate on activity of carbon-dioxide assimilation by marine heterotrophic thiosulfate-oxidizing BacteriaMicrobiologyYear: 199362488493
Stoll MH,Bakker K,Nobbe GH,Haese RR. Continuous-flow analysis of dissolved inorganic carbon content in seawaterAnal ChemYear: 2001734111411611569799
Swan BK,Martinez-Garcia M,Preston CM,et al. Potential for chemolithoautotrophy among ubiquitous bacteria lineages in the dark oceanScienceYear: 20113331296130021885783
Teira E,Lebaron P,van Aken H,Herndl GJ. Distribution and activity of Bacteria and Archaea in the deep water masses of the North AtlanticLimnol OceanogrYear: 2006a5121312144
Teira E,van Aken H,Veth C,Herndl GJ. Archaeal uptake of enantiomeric amino acids in the meso- and bathypelagic waters of the North AtlanticLimnol OceanogrYear: 2006b516069
Treusch AH,Leininger S,Kletzin A,Schuster SC,Klenk HP,Schleper C. Novel genes for nitrite reductase and Amo-related proteins indicate a role of uncultivated mesophilic crenarchaeota in nitrogen cyclingEnviron MicrobiolYear: 200571985199516309395
Varela MM,van Aken HM,Sintes E,Herndl GJ. Latitudinal trends of Crenarchaeota and Bacteria in the meso- and bathypelagic water masses of the Eastern North AtlanticEnviron MicrobiolYear: 20081011012418211271
Varela MM,van Aken HM,Sintes E,Reinthaler T,Herndl GJ. Contribution of Crenarchaeota and Bacteria to autotrophy in the North Atlantic interiorEnviron MicrobiolYear: 2011131524153321418496
Ward BB,Eveillard D,Kirshtein JD,Nelson JD,Voytek MA,Jackson GA. Ammonia-oxidizing bacterial community composition in estuarine and oceanic environments assessed using a functional gene microarrayEnviron MicrobiolYear: 200792522253817803777
Werkman CH,Wood HG. Heterotrophic assimilation of carbon dioxideAdv Enzymol Relat Subj BiochemYear: 19422135182
Wuchter C,Schouten S,Boschker HTS,Damste JSS. Bicarbonate uptake by marine CrenarchaeotaFEMS Microbiol LettYear: 200321920320712620621
Wuchter C,Abbas B,Coolen MJL,et al. Archaeal nitrification in the oceanP Natl Acad Sci USAYear: 20061031231712322
Yakimov MM,La Cono V,Denaro R. A first insight into the occurrence and expression of functional amoA and accA genes of autotrophic and ammonia-oxidizing bathypelagic Crenarchaeota of Tyrrhenian SeaDeep-Sea Res Pt IIYear: 200956748754
Yakimov MM,Cono VL,Smedile F,et al. Contribution of crenarchaeal autotrophic ammonia oxidizers to the dark primary production in Tyrrhenian deep waters (Central Mediterranean Sea)ISME JYear: 2011594596121209665
Supporting Information

Additional Supporting Information may be found in the online version of this article:

Fig. S1. Cross-section through the Romanche Fracture Zone (down to 4500 m depth) showing the horizontal and vertical variation of the prokaryotic dissolved inorganic carbon (DIC) fixation rates (μmol C m−3 days−1). Dots indicate positions where the respective parameter was measured.

Fig. S2. Depth profiles of mean abundances of archaeal amoA genes obtained with two different primer sets (Table 2), 16S rRNA gene abundance of marine Thaumarchaeota and accA-like genes determined by Q-PCR. Dashed lines delineate the water mass sampled, see Table 1.

Table S1. Mean ± SD of raw (not normalized) gene abundances obtained with the different primers (Table 2) and their mean ± SD of Ct values calculated for 103 samples (in triplicate reactions) along a depth profile (Table 1).

Table S2. Mean ± SD of nucleic acid concentrations of 103 samples extracted along the Romanche fracture zone throughout the pelagic realm (100–7500 m).

Data S1. Supplementary methods.

Click here for additional data file (fem0084-0461-SD5.txt)

Click here for additional data file (fem0084-0461-SD6.txt)

Click here for additional data file (fem0084-0461-SD7.txt)

Click here for additional data file (fem0084-0461-SD8.txt)

Click here for additional data file (fem0084-0461-SD9.docx)


Figures

[Figure ID: fig01]
Fig. 1 

Map of the study area in the tropical Atlantic with the Stations 8–26 indicated by dots along a transect from the western to the eastern basin of the Atlantic through the Romanche Fracture Zone. Sampling was performed during the Archimedes-3 expedition in December 2007 to January 2008.



[Figure ID: fig02]
Fig. 2 

Cross-section through the Romanche Fracture Zone (down to 7150 m depth) showing (a) the distribution of picoplankton abundance determined by flow cytometry, (b) the abundance of the 16S rRNA genes of marine Thaumarchaeota, (c) the abundance of accA-like genes and (d) the summed abundance of archaeal amoA genes determined by Q-PCR. Dots indicate positions where respective parameters were measured. For details on the depth range and the physical and chemical characteristics of the water masses, see Table 1.



[Figure ID: fig03]
Fig. 3 

Depth profiles of accA-like gene abundances and ratio of accA-like gene abundance to 16S rRNA gene abundance of marine Thaumarchaeota in the western (W, Sts. 8–19) and eastern (E, Sts. 20–26) stations determined by Q-PCR. The mean ± SD gene abundance is given for each depth for the eastern and the western stations. Dashed lines delineate the water mass sampled, see Table 1.



[Figure ID: fig04]
Fig. 4 

Relation of the abundance of archaeal amoA genes with accA-like genes determined by Q-PCR. Different symbols indicate different water masses, see Table 1.



Tables
[TableWrap ID: tbl1] Table 1 

Physical characteristics and nutrient concentrations of the main water masses in the (sub)tropical North Atlantic sampled during the cruise Archimedes -3 at the stations 8–26


Water mass Depth (m) Temperature (°C) Salinity AOU (μmol kg−1) (μmol kg−1) NO3(μmol kg−1) (μmol kg−1)
Subsurface 100 14.1–15.9 35.434–35.716 71.5–150.3 0.8–1.4 11.0–22.1 4.3–7.1
SACW 200–500 11.0–12.4 34.521–35.224 164.9–184.2 1.6–1.8 25.4–29.4 9.8–11.8
AAIW 500–1200 4.7–5.1 34.455–34.509 144.5–165.1 2.2–2.3 28.8–34.4 27.8–28.4
uNADW 1200–2500 3.8–4.0 34.976–34.982 70.2–82.0 1.27–1.33 19.3–20.2 16.2–17.7
mNADW 2500–3500 2.3–2.8 34.891–34.928 80.2–90.6 1.4–1.5 20.8–21.7 30.9–40.9
lNADW 3500–4250 2.0–2.4 34.870–34.902 76.1–87.7 1.3–1.5 19.6–21.4 32.6–45.2
AABW 4200–5500 0.9–1.4 34.749–34.779 112.9–121.4 1.8–2.0 27.2–29.3 82.7–94.5

Ranges are given for each water mass where samples were collected.

AOU, Apparent Oxygen Utilization; SACW, South Atlantic Central Water; AAIW, Antarctic Intermediate Water; uNADW, upper North Atlantic Deep Water; mNADW, middle North Atlantic Deep Water; lNADW, lower North Atlantic Deep Water; AABW, Antarctic Bottom Water.


[TableWrap ID: tbl2] Table 2 

Q-PCR efficiencies and compilation of acetyl-CoA carboxylase alpha subunit–specific primers, 16S rRNA gene-targeting primers specific to Thaumarchaea and the archaeal amoA primer sets used to detect and quantify the respective genes


Target Gene Primer Fragment length Annealing temp. (°C) Q-PCR Efficiency Sequence (5′ to 3′) Reference
Thaumarchaea 16S rRNA MCGI-391-for MCGI-554-rev 122 61.0 84–96% (r2 = 0.983–0.997) AAGGTTARTCCGAGTGRTTTC Wuchter et al. (2006)
TGACCACTTGAGGTGCTG
Archaeal amoA (1) amoA Arch-amoA-for Arch-amoA-rev 256 58.5 98% (r2 = 0.998) CTGAYTGGGCYTGGACATC Wuchter et al. (2006)
TTCTTCTTTGTTGCCCAGTA
Archaeal amoA (2) amoA Arch-amoA-for Arch-amoA-rev NEW 256 58.5 101% (r2 = 0.999) CTGAYTGGGCYTGGACATC Wuchter et al. (2006), Konstantinidis et al. (2009)
TTCTTCTTCGTCGCCCAATA
Thaumarchaea Biotin carboxylase, accA Crena_529-for Crena_981-rev 452 51 73% (r2 = 0.994) GCWATGACWGAYTTTGTYRTAATG Yakimov et al. (2009)
TGGWTKRYTTGCAAYTATWCC

[TableWrap ID: tbl3] Table 3 

Mean ± SD of dissolved inorganic carbon (DIC) fixation rates in the dark and abundance of the accA gene, the sum of archaeal amoA genes and the ratio of the sum of archaeal amoA genes: thaumarchaeal 16S rRNA gene. The standard deviations are given in parenthesis. For the gene abundance ratio, the mean values for the western and eastern parts of the RFZ are given separately in parenthesis. N.D. – not determined, SW – seawater


Depth [m] Dark DIC fixation rate [μmol C m−3 days−1] accA [n × 103 genes mL−1 SW] amoA [n × 103 genes mL−1 SW] Ratio (∑archaeal amoA):Thaumarchaea (western/eastern basin of the RFZ)
100 4.25 (± 0.7) 27.1 (± 16.0) 130.3 (± 87.0) 1.2 (1/0.6)
250 6.21 (± 4.16) 140.7 (± 134.8) 52.6 (± 45.3)
500 0.11 (± 0.03) N.D. N.D. N.D.
750 0.12 (± 0.13) 508.5 (± 40.2) 11.1 (± 5.0) 0.3 (0.2/0.3)
1750 0.1 (± 0.05) 16.0 (± 11.5) 3.0 (± 1.8) 0.4 (0.3/0.4)
2750 0.26 (± 0.34) 21.5 (± 13.0) 2.9 (± 1.7) 0.4 (0.3/0.3)
3500–4700 0.12 (± 0.17) 16.0 (± 14.6) 2.2 (± 2.6) 0.7 (0.2/0.5)


Article Categories:
  • Research Articles

Keywords: chemoautotrophy, deep ocean, biotin carboxylase (accA), Thaumarchaeota, DIC fixation, equatorial Atlantic, Romanche Fracture Zone.

Previous Document:  can transvaginal ultrasononographic evaluation of the endocervical glandular area predict preterm la...
Next Document:  Computer use in educational activities by students with ADHD.