Document Detail

The ability of PVX p25 to form RL structures in plant cells is necessary for its function in movement, but not for its suppression of RNA silencing.
Jump to Full Text
MedLine Citation:
PMID:  22916231     Owner:  NLM     Status:  MEDLINE    
Abstract/OtherAbstract:
The p25 triple gene block protein of Potato virus X (PVX) is multifunctional, participating in viral movement and acting as a suppressor of RNA silencing. The cell-to-cell movement of PVX is known to depend on the suppression function of p25. GFP-fused p25 accumulates in rod-like (RL) structures with intense fluorescence in cells. By monitoring the location of fluorescence at different times, we have now shown that the RL structure is composed of filaments. P25 mutants without the conditional ability to recover movement function could not form RL structures while the mutants that had the ability did form the structure, suggesting that the ability of p25 to form RL structures is necessary for its function in cell-to-cell movement, but not for its suppressor function. Moreover, chemical inhibition of microfilaments in cells destroyed the formation of the complete RL structure. Additionally, TGBp2 and TGBp3 were recruited into the RL structure, suggesting a relationship between the TGBps in virus movement.
Authors:
Fei Yan; Yuwen Lu; Lin Lin; Hongying Zheng; Jianping Chen
Publication Detail:
Type:  Journal Article; Research Support, Non-U.S. Gov't     Date:  2012-08-16
Journal Detail:
Title:  PloS one     Volume:  7     ISSN:  1932-6203     ISO Abbreviation:  PLoS ONE     Publication Date:  2012  
Date Detail:
Created Date:  2012-08-23     Completed Date:  2013-01-16     Revised Date:  2013-04-02    
Medline Journal Info:
Nlm Unique ID:  101285081     Medline TA:  PLoS One     Country:  United States    
Other Details:
Languages:  eng     Pagination:  e43242     Citation Subset:  IM    
Affiliation:
State Key Laboratory Breeding Base for Zhejiang Sustainable Pest and Disease Control, Zhejiang Academy of Agricultural Sciences, Hangzhou, China. fei.yan@mail.zaas.ac.cn
Export Citation:
APA/MLA Format     Download EndNote     Download BibTex
MeSH Terms
Descriptor/Qualifier:
Fluorescence
Green Fluorescent Proteins / genetics,  metabolism
Mutation
Plant Cells / metabolism*
Potexvirus / metabolism*
RNA Interference / physiology*
Tobacco / virology*
Viral Proteins / chemistry*,  genetics,  metabolism*
Chemical
Reg. No./Substance:
0/Viral Proteins; 147336-22-9/Green Fluorescent Proteins
Comments/Corrections

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine

Full Text
Journal Information
Journal ID (nlm-ta): PLoS One
Journal ID (iso-abbrev): PLoS ONE
Journal ID (publisher-id): plos
Journal ID (pmc): plosone
ISSN: 1932-6203
Publisher: Public Library of Science, San Francisco, USA
Article Information
Download PDF
Copyright: 2012 Yan et al
License:
Received Day: 4 Month: 4 Year: 2012
Accepted Day: 18 Month: 7 Year: 2012
collection publication date: Year: 2012
Electronic publication date: Day: 16 Month: 8 Year: 2012
Volume: 7 Issue: 8
E-location ID: e43242
ID: 3420909
PubMed Id: 22916231
Publisher Id: PONE-D-12-10575
DOI: 10.1371/journal.pone.0043242

The Ability of PVX p25 to Form RL Structures in Plant Cells Is Necessary for Its Function in Movement, but Not for Its Suppression of RNA Silencing Alternate Title:Function of PVX p25 Rod-Like Structures
Fei Yan123*
Yuwen Lu123
Lin Lin123
Hongying Zheng123
Jianping Chen12*
Boris Alexander Vinatzeredit1 Role: Editor
1State Key Laboratory Breeding Base for Zhejiang Sustainable Pest and Disease Control, Zhejiang Academy of Agricultural Sciences, Hangzhou, China
2Key Laboratory of Biotechnology in Plant Protection (Ministry of China), Zhejiang Academy of Agricultural Sciences, Hangzhou, China
3Institute of Virology and Biotechnology, Zhejiang Academy of Agricultural Sciences, Hangzhou, China
Virginia Tech, United States of America
Correspondence: * E-mail: fei.yan@mail.zaas.ac.cn (FY); jpchen2001@yahoo.com.cn (JC)
[conflict] Competing Interests: The authors have declared that no competing interests exist.
Contributed by footnote: Conceived and designed the experiments: FY YL JC. Performed the experiments: FY YL LL HZ. Analyzed the data: FY YL. Wrote the paper: FY JC.

Introduction

The genome of Potato virus X (PVX, genus Potexvirus) has five open reading frames, three of which overlap and are termed the triple gene block (TGB). The three TGB proteins have molecular masses of 25, 12, and 8 kDa. TGBp1 (p25) is required for virus cell-to-cell movement. Studies using microinjection and biolistic bombardment have shown that p25 increases the size exclusion limit (SEL) of plasmodesmata (PD) and chaperones viral RNA and coat protein (CP) across PD [1], [2], [3], [4]. TGBp2 and TGBp3 also participate in, but are not sufficient for, viral movement [5], [6], [7], [8]. A recent article reviewed the movement strategies employed by TGB-encoding viruses and proposed models for viruses in the genera Potexvirus, Hordeivirus, and Pomovirus[9]. In these models, there are roles for the TGB proteins, coat protein and RNAs of the virus and also for the microfilaments, endoplasmic reticulum (ER), Golgi and PD of the host cell [9].

p25 is a multifunctional protein that also acts as a suppressor of RNA silencing [10] by affecting RDR6, a key component of the RNA silencing mechanism [11], [12], [13]. It has recently been shown that p25 interacts with Argonaute1 (Ago1), another central component of the mechanism, and mediates its degradation, probably indicating that p25 can suppress the plant RNA silencing mechanism by degrading Ago1 [14]. Analyses of virus mutants have shown that PVX movement is dependent on the suppression function of p25 but that suppression of silencing is not sufficient to allow virus movement between cells [15]. It is probable that other known properties of p25, such as its ATPase activity and its interaction with CP and cellular features, are also involved in virus movement.

In PVX-infected plant cells, GFP-fused p25 localizes to the nucleus, PD and cytoplasm where intensely fluorescent rod-like (RL) inclusions are seen [16]. When GFP-fused p25 is expressed alone under the control of the Cauliflower mosaic virus (CaMV) 35S promoter, the rod-like structures are still seen but p25 does not localize to PD, suggesting that other viral factors are needed for PD localization of p25 [16]. Research with the potexvirus Bamboo mosaic virus (BaMV) suggests that the RL structure is an active pool of TGBp1 but its role is unclear [3]. TGBp2 and TGBp3 are ER-associated proteins that co-localize [7], [8], [16]. When p25 and TGBp2 are co-expressed, ER-derived TGBp2 vesicles are seen along p25-labeled strands of cytoplasm [16]. When p25 and TGBp3 are co-expressed, the proteins seem to be closely associated [16].

We have investigated the formation of p25 RL structures and now report that the RL structure is composed of filaments. We have also provided evidence that the RL structure is necessary for the movement function of p25, but not for its ability to suppress RNA silencing. TGBp2 and TGBp3 were recruited into the RL structure, suggesting a joint involvement of the TGBps in virus movement.


Results
Formation of p25 Rod-like Structures in Nicotiana benthamiana Cells

It has previously been reported [16] that expressed p25 fused with GFP at its N-terminus (GFP-p25) formed rod-like structures in both PVX-infected and uninfected cells. In our experiments, the structures also occurred when GFP fused with p25 at its C-terminus (p25-GFP) was expressed either alone under the control of CaMV 35S promoter or from the PVX-Δp25 vector with the duplicated coat protein subgenomic promoter (Fig. 1A and B). To study the process of formation of the structure, we expressed p25-GFP by agroinfiltration and detected the subcellular distribution of fluorescence 1, 2 and 3 days post infiltration (dpi) under the confocal microscope. At 1 dpi, p25-GFP fluorescence was distributed evenly at the cell periphery and there were also a few sporadic spots in the cytoplasm (Fig. 1C). At 2 dpi, the fluorescence on the cell periphery had diminished, while single fluorescent rods with intense fluorescence had started to appear (Fig. 1D). These rods moved within cells; a series of photos shows one fluorescent rod approaching and merging with a stationary one at 2 dpi (Fig. 1 D1–4). At 3 dpi, the fluorescence on the cell periphery was barely detected, while the RL structure was clearly formed (Fig. 1E). These observations suggest that the RL structure is progressively assembled from p25 protein.

The Rod-like Structure is Composed of Filaments

The structure formed from GFP-fused p25 always showed intense fluorescence, and appeared to be composed of thick fluorescent rods when examined at a single focal plane under confocal microscopy. To examine the structure in detail, we decreased the strength of the exciting laser and monitored and recorded the fluorescence at a serial of focal planes and then combined them together. The combined figure showed that the structure was in fact composed of thin filaments (Fig. 1F) even though it looked like a thick rod when it was monitored at a single focal plane with a strong exciting laser. This is consistent with earlier reports from electron microscopy that the p25 formed “beaded sheets” [17].

The Ability to Form the RL Structure is Necessary for p25 Movement but not for its Suppressor Function

To determine whether the RL structure is associated with the movement or suppression functions of p25, we attempted to interfere with the formation of the RL structure by fusing an ER or NLS location signal at its amino terminal. NLSp25 expressed by agrobacterium remained a silencing suppressor but did not form an RL structure (Fig. 2A). In contrast, ERp25 could still form an RL structure (although its structure was not perfect) but its suppression of RNA silencing was greatly diminished (Fig. 2A, Fig. S1). Furthermore, ERp25, but not NLSp25, recovered the cell-to-cell movement of PVX-GFPΔp25 with the heterologous silencing suppressor p19 (Fig. 2B; the average diameter of thirty infection loci was about 700 µm). These results imply that the ability of p25 to form the RL structure is necessary for its cell-to-cell movement function, but not for its ability to act as a suppressor.

To confirm these findings, twelve single amino acid mutants of p25 reported previously were used for analysis [15]. Eleven of the mutants, N94S, P111L, T117A, P122S, K124E, K153E, K153I, T193A, V195M, T214A and Y221H, are deficient in both virus movement and silencing suppression (double functional deficient or DFD mutants), and of these T117A and Y221H are reported to recover the cell-to-cell movement of PVX-GFPΔp25 when co-expressed with another suppressor. The twelfth mutant, A104V, is deficient in movement but not in suppression. We examined the RL structure of each mutant fused with GFP in agrobacterium-infiltrated cells. The RL structure was not formed in cells expressing GFP-fused A104V, which supported the view that formation of the structure was not necessary for p25 to act as a suppressor (Fig. 3). Among the DFD mutants, typical RL structures were seen where GFP was fused to T117A or Y221H, some slender RL structures were seen with P122S, but there were no structures with the other mutants (Fig. 3). Thus, with the exception of P122S, only those DFD mutants with the conditional ability to recover movement function formed the RL structures. This gives further support to the conclusion that the ability of p25 to form the RL structure is necessary for its function in cell-to-cell movement but not for its ability to act as a suppressor (Fig. 3). We then re-investigated the reported inability of mutant P122S to recover the movement of PVX-GFPΔp25 when co-expressed with another suppressor. Results from more than three repeats showed that when P122S was co-expressed with p19, fluorescence was visible in 6–10 cells at almost all loci whereas in the negative control it was limited to a single cell. This indicated that P122S could indeed recover the movement of PVX-GFPΔp25 when co-expressed with the suppressor p19, although the recovery was weak and the helper virus moved only into limited layers of neighboring cells (Fig. 3; the average diameter of thirty infection loci was about 200 µm, compared to the positive control of about 700 µm). Hence, the result from P122S also supported the conclusion above.

Formation of RL Structures is Inhibited by LatB

The microfilaments and microtubules that form the host cytoskeleton are implicated in the movement of both plant and animal viruses. It has been reported that treatment with the microfilament inhibitor latrunculin B (LatB) severely limited the spread of PVX in plants [18]. Since the RL structure is necessary for PVX movement, we next examined the relationship between microfilaments and RL structures. Tobacco epidermal cells were treated with different concentrations of LatB (5 µM, 10 µM and 20 µM) for 3 h before infiltration with the agrobacterium containing the vector expressing GFP-fused p25. At 3 dpi, the treated cells were examined under the confocal microscope. No complete RL structures, but only single fluorescent filaments, were seen in cells treated with LatB at any concentration, while the entire normal-looking RL structure was seen in the control cells treated with DMSO (Fig. 4). The RL structure was not affected by treatment with LatB 3 days after p25 had been expressed, showing that microfilaments were necessary during the formation of the RL structures, but not after they were formed. The microtubule inhibitor oryzalin did not affect the formation of the structure, whether treated before or after p25 expression (Fig. 4) suggesting that microtubules are unnecessary for RL structure formation.

TGBp2 and TGBp3 are Recruited to the RL Structure

Since both TGBp2 and TGBp3 are known to be necessary for PVX movement, we fused them individually with RFP and co-expressed them with GFP-fused p25 in tobacco epidermal cells by agroinfiltration. Examination of the fluorescence 3 dpi showed that both RFP-fused TGBp2 and TGBp3 formed granules as described in previous reports and that almost all these granules were recruited into the RL structure and not merely attached to the outside (Fig. 5A, B). At high resolution, it could be seen that red granules aligned on the filaments of the RL structure, hinting that p25 was associated with both TGBp2 and TGBp3 (Fig. 5 A, B). Because no detectable interactions have been reported between these proteins in previously reported yeast two-hybrid (YTH) experiments [16], we then used bimolecular fluorescence complementation analysis (BiFC) to analyze the interactions between p25 and TGBp2 or TGBp3. BiFC is a powerful tool for studying protein-protein interactions in living cells, and its results are better than YTH in reflecting natural interactions. Interactions between TGBp1 and TGBp2 of the potexvirus BaMV have previously been reported using this technique [19]. Here, yellow fluorescence (recorded as green during imaging) was seen at 3 dpi in the cells co-expressing pCV-n(c)YFP-p25 and either pCV-c(n)YFP-TGBp2 or pCV-c(n)YFP-TGBp3 (Fig. 6), but not in the control cells co-expressing pCV-n(c)YFP-p25 and pCV-c(n)YFP-pΔGUS, or pCV-c(n)YFP-TGBp2 and pCV-n(c)YFP-pΔGUS, or pCV-c(n)YFP-TGBp3 and pCV-n(c)YFP-pΔGUS (Fig. 6). This suggests that there are indeed interactions between p25 and both TGBp2 and TGBp3 in plant cells.


Discussion

Rod-like inclusions were first found associated with p25 by electron microscopy of PVX-infected tissues [3], [17], [20]. Subsequently, Samuels et al. used confocal microscopy to observe the typical rod-like structures in both PVX-infected and p25-expressing epidermal cells [16]. We have now shown that the rod-like structure is actually composed of interweaved filaments. This may have been overlooked because GFP-fused p25 is usually expressed at high levels because of its suppression function, and so appeared rod-like.

In our experiments, p25 was first expressed generally in cells (the first day) and by the second day had assembled into the primary RL filaments. These were then recruited into the complete structure by the third day. This process must require self-interaction of p25, which has been experimentally demonstrated in several experiments, satisfying the requirement of the model [16], [21]. Previous studies with virus mutants have shown that the movement and suppression functions of p25 are separate properties, and that suppression is a precondition, but is not sufficient for, movement [15]. In our studies, only those mutants that could form the RL structure were able to recover the movement of p25-deficient PVX, suggesting that the ability to form the RL structure may also be a precondition for the movement function of p25.

Microfilaments are known to be essential for PVX cell-to-cell movement. Vesicles containing GFP-TGBp2 protein have been seen adjacent to microfilaments in plant cells, and treatment with LatB caused dispersal of these vesicles [18]. Our studies show that microfilaments are also necessary for the formation of the RL structures particularly at the stage where the filaments are recruited into the complete structure (Fig. 3). A recent paper reported that PVX p25 reorganized the actin cytoskeleton [22]. Both results therefore show a relationship between p25 and microfilaments during PVX movement.

Both TGBp2 and TGBp3 are known to be necessary and to function together with p25 for cell-to-cell movement of PVX. GFP-fused TGBp2 forms ER-derived granular vesicles that are necessary for virus movement and which can be seen alongside the p25-formed strands in the cytoplasm [7], [8], [16]. GFP-fused TGBp3 is mainly located in the ER network when expressed alone [5], [7], but has a similar location to TGBp2 and co-localizes with p25 in the nucleus when expressed with PVX [16], [23]. It is thought that TGBp2 may direct TGBp3 into the same ER-derived vesicles during virus infection [4]. Consistent with a recent paper that reports the recruitment of TGBp2 and TGBp3 to the TGBp1 aggregates [22], we here present evidence that PVX TGBp2 and TGBp3 granules align on the filaments of the p25 RL structure (Fig. 5). Our BiFC results also demonstrate an in vivo interaction between p25 and both TGBp2 and TGBp3 (Fig. 6). The results therefore suggest the possibility that TGBp2 and TGBp3 of PVX are recruited into the RL structure by interaction with p25 to enable viral movement.

In PVX-infected plant cells, the perinuclear whorl-like X-body is another inclusion structure. Tilsner et al (2012) recently reported that PVX TGBp1 organized the formation of the X-body by re-modeling host actin and endomembranes, and that TGBp2/3 were recruited to the structure. It was speculated that the X-body plays a role as a viral replication factory, although virus replication and assembly can proceed without it albeit with reduced efficiency [22]. Here, we show that the RL structure formed by p25 may participate in the cell-to-cell movement function of p25, but not in its suppressor function. Meanwhile, further research is needed to investigate the relationship between the p25-formed RL structure and the X-body.


Materials and Methods
Bacterial Strains and Plasmids

Construction of all plasmids followed standard cloning techniques. Escherichia coli strain TG1 was used for transformation [24]. All constructed plasmids are shown in Fig. 7. pCV:GFP, pCV:RFP were as described previously [25]. p25 which was introduced into pGEM-T (Promega, Madison, WI) with forward primer ([gene: 5′-TCTAGAATGGATATTCTCATCAGTAGTT -3′], Xba I site underlined) and reverse primer ([gene: 5′-GGATCCCTATGGCCCTGCGCGGA -3′], BamH I site underlined), was digested with Xba I and BamH I, and ligated into the pCV:GFP and digested with the same enzymes to generate pCV:p25-GFP. pCV: RFP-TGBp2 and pCV: RFP-TGBp3 were produced with primer pairs ([gene: 5′-GGATCCATGTCCGCGCAGGGCCATA-3′], BamH I site underlined, [gene: 5′-GAGCTCCTAATGACTGCTATGATTGTC-3′], Sac I site underlined) and ([gene: 5′-GGATCCATGGAAGTAAATACATATCTCA-3′], BamH I site underlined [gene: 5′-GAGCTCTCAATGGAAACTTAACCGTTC-3′]Sac I site underlined), respectively. To express p25-GFP in a virus vector, the pGR106-Δp25 vector was used. p25-GFP was amplified from pCV:p25-GFP with primer pair [gene: 5′-ATCGATATGGATATTCTCATCAGTAGTT-3′] (Cla I site underlined) and [gene: 5′-GTCGACTCACTTGTACAGCTCGTCC-3′] (Sal I site underlined), then ligated into the pGR106-Δp25 digested with the same enzymes to generate pGR106-Δp25- p25-GFP.

The BiFC assay used pCV:cYFP and pCV:nYFP [25]. The same primers and restriction sites listed above were used in constructing the vectors of p25, TGBp2 and TGBp3. The p25 mutants were obtained by PCR according to the mutant sequences reported [15]. The ER location site ([gene: ATGAAGACTAATCTTTTTCTCTTTCTCATCTTTTCACTTCTCCTATCATTATCCTCGGCCGAA]) used in previous reports [26] and the widely-used NLS of Simian virus 40 large T antigen ([gene: ATGCCTCCAAAAAAGAAGAGAAAGGTC]) were used for fusion PCR to produce vectors expressing ERp25 and NLSp25.

Plant Material and Agrobacterium Infiltration

Subcellular targeting of proteins by fluorescence was explored in Nicotiana benthamiana. N. benthamiana line 16 c was used to analyse gene silencing suppression as previously reported [10]. Briefly, agrobacterium mixtures carrying 35S-green fluorescent protein (35S-GFP) and the individual constructs were infiltrated into leaves of 16c plants. GFP fluorescence was viewed under long-wavelength UV light 5 dpi. Agrobacterium strains C58C1 and GV3101 were used for agrobacterium infiltration at OD600 = 1.0 except where stated. Equal volumes of individual agrobacterium cultures (OD600 = 1.0) were mixed before co-infiltration. The analysis using chemical inhibition of the cytoskeleton was carried out as reported [18].

Microscopy

The Leica TCS SP5 (Leica Microsystems, Bannockburn, IL) confocal laser scanning microscope system was used to examine the fluorescence of GFP, RFP and YFP. Unless otherwise stated, fluorescence was monitored at 5 dpi. GFP was excited at 488 nm and the emitted light captured at 505–525 nm; RFP was excited using 543 nm and captured at 590–630 nm; YFP was excited at 514 nm and captured at 555–575 nm. All images were processed using Adobe Photoshop version 7.0 software (Adobe Systems Inc., San Jose, CA).

Recovery Experiments Using p25 Mutants

PVX movement recovery experiments were carried out according to previous reports [15]. Briefly, an agrobacterium culture GV3101 with the 35S:PVX-GFPΔp25 (pGR106) was diluted 10,000-fold, then mixed 1∶1∶1 with agrobacterium culture C58C1 carrying 35S:p19 and 35S:p25 mutants.


Supporting Information Figure S1

Northern blot showing that NLSp25, but not ERp25, retains the wild-type ability of PVX p25 to suppress RNA silencing.gfp mRNAs in infiltrated zones (shown in Fig. 2A) were hybridized with a GFP DNA probe.

(TIF)


Click here for additional data file (pone.0043242.s001.png)


We thank Professor M. J. Adams, Rothamsted Research, Harpenden, UK for his value advice on the manuscript and help in correcting the English.


References
1. Morozov SY,, Solovyev AG, (Year: 2003) Triple gene block: modular design of a multifunctional machine for plant virus movement. J Gen Virol84: 1351–136612771402
2. Lough TJ,, Netzler NE,, Emerson SJ,, Sutherland P,, Carr F,, et al. (Year: 2000) Cell-to-cell movement of potexviruses: evidence for a ribonucleoprotein complex involving the coat protein and first triple gene block protein. Mol Plant Microbe Interact13: 962–97410975653
3. Hsu HT,, Hsu YH,, Bi IP,, Lin NS,, Chang BY, (Year: 2004) Biological functions of the cytoplasmic TGBp1 inclusions of bamboo mosaic potexvirus. Arch Virol149: 1027–103515098116
4. Verchot-Lubicz J,, Ye CM,, Bamunusinghe D, (Year: 2007) Molecular biology of potexviruses: recent advances. J Gen Virol88: 1643–165517485523
5. Krishnamurthy K,, Heppler M,, Mitra R,, Blancaflor E,, Payton M,, et al. (Year: 2003) The Potato virus X TGBp3 protein associates with the ER network for virus cell-to-cell movement. Virology309: 135–15112726734
6. Mitra R,, Krishnamurthy K,, Blancaflor E,, Payton M,, Nelson RS,, et al. (Year: 2003) The potato virus X TGBp2 protein association with the endoplasmic reticulum plays a role in but is not sufficient for viral cell-to-cell movement. Virology312: 35–4812890619
7. Ju HJ,, Samuels TD,, Wang YS,, Blancaflor E,, Payton M,, et al. (Year: 2005) The potato virus X TGBp2 movement protein associates with endoplasmic reticulum-derived vesicles during virus infection. Plant Physiol138: 1877–189516055678
8. Ju HJ,, Brown JE,, Ye CM,, Verchot-Lubicz J, (Year: 2007) Mutations in the central domain of potato virus X TGBp2 eliminate granular vesicles and virus cell-to-cell trafficking. J Virol81: 1899–191117151124
9. Verchot-Lubicz J,, Torrance L,, Solovyev AG,, Morozov SY,, Jackson AO,, et al. (Year: 2010) Varied movement strategies employed by triple gene block-encoding viruses. Mol Plant Microbe Interact23: 1231–124720831404
10. Voinnet O,, Lederer C,, Baulcombe DC, (Year: 2000) A viral movement protein prevents spread of the gene silencing signal in Nicotiana benthamiana. Cell103: 157–16711051555
11. Qu F,, Ye X,, Hou G,, Sato S,, Clemente TE,, et al. (Year: 2005) RDR6 has a broad-spectrum but temperature-dependent antiviral defense role in Nicotiana benthamiana. J Virol79: 15209–1521716306592
12. Schwach F,, Vaistij FE,, Jones L,, Baulcombe DC, (Year: 2005) An RNA-dependent RNA polymerase prevents meristem invasion by potato virus X and is required for the activity but not the production of a systemic silencing signal. Plant Physiol138: 1842–185216040651
13. Xie Q,, Guo HS, (Year: 2006) Systemic antiviral silencing in plants. Virus Res118: 1–616368157
14. Chiu MH,, Chen IH,, Baulcombe DC,, Tsai CH, (Year: 2010) The silencing suppressor P25 of Potato virus X interacts with Argonaute1 and mediates its degradation through the proteasome pathway. Mol Plant Pathol11: 641–64920696002
15. Bayne EH,, Rakitina DV,, Morozov SY,, Baulcombe DC, (Year: 2005) Cell-to-cell movement of potato potexvirus X is dependent on suppression of RNA silencing. Plant J44: 471–48216236156
16. Samuels TD,, Ju HJ,, Ye CM,, Motes CM,, Blancaflor EB,, et al. (Year: 2007) Subcellular targeting and interactions among the Potato virus X TGB proteins. Virology367: 375–38917610926
17. Davies C,, Hills G,, Baulcombe DC, (Year: 1993) Sub-cellular localization of the 25-kDa protein encoded in the triple gene block of potato virus X. Virology. 197: 166–175
18. Harries PA,, Park JW,, Sasaki N,, Ballard KD,, Maule AJ,, et al. (Year: 2009) Differing requirements for actin and myosin by plant viruses for sustained intercellular movement. Proc Natl Acad Sci U S A106: 17594–1759919805075
19. Wu CH,, Lee SC,, Wang CW, (Year: 2011) Viral protein targeting to the cortical endoplasmic reticulum is required for cell-cell spreading in plants. J Cell Biol193: 521–53521518793
20. Rouleau M,, Smith RJ,, Bancroft JB,, Mackie GA, (Year: 1994) Purification, properties, and subcellular localization of foxtail mosaic potexvirus 26-kDa protein. Virology204: 254–2657522371
21. Leshchiner AD,, Minina EA,, Rakitina DV,, Vishnichenko VK,, Solovyev AG,, et al. (Year: 2008) Oligomerization of the potato virus X 25-kD movement protein. Biochemistry (Mosc)73: 50–5518294129
22. Tilsner J, Linnik O, Wright KM, Bell K, Roberts AG, et al. . (2012) The TGB1 movement protein of potato virus X re-organises actin and endomembranes into the ‘X-body’, a viral replication factory. Plant Physiol.
23. Schepetilnikov MV,, Manske U,, Solovyev AG,, Zamyatnin AA Jr,, Schiemann J,, et al. (Year: 2005) The hydrophobic segment of Potato virus X TGBp3 is a major determinant of the protein intracellular trafficking. J Gen Virol86: 2379–239116033986
24. Sambrook J, Fritsch EF, Maniatis T, editors (1989) Molecular cloning: a laboratory manual. 2nd ed. New York: Cold Spring Harbor Laboratory.
25. Lu Y,, Yan F,, Guo W,, Zheng H,, Lin L,, et al. (Year: 2011) Garlic virus X 11-kDa protein granules move within the cytoplasm and traffic a host protein normally found in the nucleolus. Mol Plant Pathol12: 666–67621726366
26. Haseloff J,, Siemering KR,, Prasher DC,, Hodge S, (Year: 1997) Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly. Proc Natl Acad Sci U S A94: 2122–21279122158

Figures

[Figure ID: pone-0043242-g001]
doi: 10.1371/journal.pone.0043242.g001.
Figure 1  Rod-like structure formed by GFP-fused p25 (p25-GFP).

A and B show the RL structure in Nicotiana benthamiana epidermal cells formed by p25-GFP expressed respectively from PVX-Δp25 and by agrobacterium infiltration. C, D and E show the location of p25-GFP expressed in cells at 1, 2 and 3 dpi, respectively. D1–D4 show a single moving fluorescent rod approaching a stationary one and merging with it at 2 dpi. F is a combined figure from a series of focal planes, showing that the RL structure is composed of thin filaments. Scale bar, 50 µm.



[Figure ID: pone-0043242-g002]
doi: 10.1371/journal.pone.0043242.g002.
Figure 2  ERp25 loses its suppression function but can recover the cell-to-cell movement of PVX-GFPΔp25 when co-expressed with the heterologous silencing suppressor p19, while the opposite occurs with NLSp25.

Panel A shows the suppression function analysis and localization of p25 fused to either the ER location signal or the NLS. NLSp25, but not ERp25, suppresses RNA silencing of GFP when co-expressed with GFP. When fused with GFP, ERp25 still formed an RL structure (although the structure is not entirely typical), but NLSp25 did not. White boxes show the locally enlarged regions. Panel B shows the ability of NLSp25 and ERp25 to recover cell-to-cell movement of the mutant virus PVX-GFPΔp25. Under long wave UV, fluorescent speckles are visible in the zones co-expressing ERp25 plus p19 and PVX-GFPΔp25 at 3 dpi, but not in those co-expressing NLSp25 and PVX-GFPΔp25 (top left panel). In the confocal micrographs, the fluorescence is limited to single epidermal cells when NLSp25 and PVX-GFPΔp25 are co-expressed (bottom left panel), but the fluorescence diffuses into the neighboring cells when ERp25 and PVX-GFPΔp25 are co-expressed together with p19 (right panel). Scale bar, 250 µm.



[Figure ID: pone-0043242-g003]
doi: 10.1371/journal.pone.0043242.g003.
Figure 3  Investigating the RL structure of the reported p25 mutants.

Upper panels: twelve single amino acid mutants of p25 were fused with GFP and expressed in epidermal cells. An RL structure is visible in cells expressing T117A, P122S or Y221H fused with GFP, but not in cells expressing the other GFP-fused mutants. Lower panels: Recovery analysis of viral movement with mutant P122S. Fluorescence diffuses into the neighboring cells in nearly all the loci when P122S and PVX-GFPΔp25 (pGR106) are co-expressed together with p19 (bottom left), suggesting that P122S can recover the movement of PVX-GFPΔp25 when co-expressed with the suppressor p19. The recovery is weak compared to the wild-type control (p25/pGR106, bottom right) but nevertheless helps virus move into limited layers of neighboring cells (average about 200 µm) compared to the negative control (pGus/pGR106/p19). Scale bar, 50 µm.



[Figure ID: pone-0043242-g004]
doi: 10.1371/journal.pone.0043242.g004.
Figure 4  Effect of chemical inhibition of microfilaments or microtubules on the formation of the RL structure.

At 5–20 µM, LatB, an inhibitor of microfilaments, inhibits the formation of the complete RL structure, but not the formation of primary RL filaments. After formation of the RL structure, LatB treatment has no effect. Treatment with Oryzalin, an inhibitor of microtubules, has no effect on the formation of the structure either before or after the structure is formed. Scale bar, 50 µm.



[Figure ID: pone-0043242-g005]
doi: 10.1371/journal.pone.0043242.g005.
Figure 5  TGBp2 and TGBp3 are aligned on the RL structure.

A shows the co-location of RFP fused-TGBp2 and GFP-fused p25 at different scales. B shows the co-location of RFP fused-TGBp3 and GFP-fused p25 at different scales. Scale bar, 20 µm.



[Figure ID: pone-0043242-g006]
doi: 10.1371/journal.pone.0043242.g006.
Figure 6  Interaction of TGBp2 and TGBp3 with p25 in BiFC assay.

Scale bar, 20 µm.



[Figure ID: pone-0043242-g007]
doi: 10.1371/journal.pone.0043242.g007.
Figure 7  Diagram showing the plasmids used in this work.

Plamsids were constructed into the pCV1300 binary vector that was developed from pCAMBIA1300 with the CaMV 35S promoter.



Article Categories:
  • Research Article
Article Categories:
  • Biology
    • Microbiology
      • Virology
    • Plant Science
      • Plant Pathology


Previous Document:  Combined species identification, genotyping, and drug resistance detection of Mycobacterium tubercul...
Next Document:  Modeling of arylamide helix mimetics in the p53 peptide binding site of hDM2 suggests parallel and a...