Search Results
Results 1 - 50 of 1542
1 2 3 4 5 6 7 8 9 10 >
Tiwari Prakash P Environmental Carcinogenesis Division, CSIR-Indian Institute of Toxicology Research, Mahatma Gandhi Marg, Lucknow -226001, - - 2014
We explored the basis of the combinatorial chemopreventive effect of Butyric acid (BA), Nicotinamide (NA) and Calcium Glucarate (CAG) on mouse skin exposed to 7, 12-dimethylbenz (a) anthracene (DMBA). We studied the effects of topical application of DMBA in the presence or absence of BA, NA and CAG on the ...
Ravindran Nivedita N RAFT Institute of Plastic Surgery, Mount Vernon Hospital, Northwood, - - 2014
Although they were the first to coin the term, it had been observed by a handful of scientists since the mid nineteenth century and described under names such as "necrobiosis" and "chromatolysis" (2). By mid 1900's spontaneous cell death was a concept known to developmental biologists but the features involved ...
Cerny Daniela D Singapore Immunology Network, Agency for Science, Technology and Research, Singapore; School of Biological Sciences, Nanyang Technological University, - - 2014
Dengue is a growing global concern with 390 million people infected each year. Dengue virus (DENV) is transmitted by mosquitoes, thus host cells in the skin are the first point of contact with the virus. Human skin contains several populations of antigen-presenting cells which could drive the immune response to ...
Johnson Ariel A Center for Wound Healing and Tissue Regeneration, College of Dentistry, University of Illinois at Chicago , Chicago, - - 2014
Objectives: Dermal and mucosal healing are mechanistically similar. However, scarring and closure rates are dramatically improved in mucosal healing, possibly due to differences in apoptosis. Apoptosis, nature's preprogrammed form of cell death, occurs via two major pathways, extrinsic and intrinsic, which intersect at caspase3 (Casp3) cleavage and activation. The purpose ...
Jozic Ivan I Wound Healing and Regenerative Medicine Research Program, Department of Dermatology and Cutaneous Surgery, University of Miami Miller Medical School, Miami, Florida, - - 2014
The skin has recently been found to be an extra-adrenal site for glucocorticoid (GC) synthesis that likely acts to modulate local inflammation. Psychological, physiological, and physical stress, both acute and chronic, triggers immune-protective or -damaging responses, including increases in systemic GC levels, which, according to Lin et al. (this issue), ...
Cela E M EM Cátedra de Inmunología - Instituto de Estudios de la Inmunidad Humoral (IDEHU), Universidad de Buenos Aires - CONICET, Junín 956, C1113AAD, Buenos Aires, - - 2014
The modulatory effects of solar ultraviolet radiation (UVR) on the immune system have been widely studied. As the skin is the main target of UVR, our purpose was to compare the impact of two contrasting ways to be exposed to sunlight on the skin innate immunity. Hairless mice were UV ...
Salimi Maryam - - 2014
Innate lymphoid cells are an emerging family of effector cells that contribute to lymphoid organogenesis, metabolism, tissue remodelling and protection against infections. They maintain homeostatic immunity at barrier surfaces such as lung, skin and gut (Nature 464:1367-1371, 2010, Nat Rev Immunol 13: 145-149, 2013). Several human and mouse studies suggest ...
Stephan Alexander A Department of Dermatology, Center for Molecular Medicine Cologne, University of Cologne, - - 2014
Neutrophil extracellular traps (NETs), large chromatin structures casted with various proteins, are externalized by neutrophils upon induction by both self- and non-self stimuli. It has become clear that NETs are potent triggers of inflammation in autoimmune skin diseases. Moreover, the ability of NETs to trap pathogens suggests a crucial role ...
Ratz-Łyko Anna - - 2014
Abstract The seedcakes are a potential source of natural bioactive substances: antioxidants, protein and carbohydrates. Thus, that may scavenging free radicals and affect on the stratum corneum hydration and epidermal barrier function. The aim of the study was to evaluate the in vivo and ex vivo properties of emulsions with ...
Kadouch Jonathan A JA Departments of *Dermatology, and †Pathology, Free University Medical Center (VUmc), Amsterdam, the Netherlands; and ‡Department of Pathology, Onze Lieve Vrouwe Gasthuis, Amsterdam, the - - 2014
Soft-tissue augmentation with permanent fillers can lead to severe granulomatous foreign-body reactions (GFBRs), but the immune pathomechanism of this complication is still unknown. We performed conventional histologic examination and immunostaining for plasmacytoid dendritic cells (pDCs) in skin sections from patients with GFBR to 4 permanent filler agents, which have been ...
Dang N N NN Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province, - - 2015
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase ...
Dang N N NN Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province, - - 2014
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase ...
Furudate Sadanori S Department of Dermatology, Tohoku University Graduate School of Medicine, Sendai, - - 2014
Background: M2 macrophages play a critical role in the induction of T helper 2 (Th2) polarization. Methods: To investigate the contribution of M2 macrophages to the pathogenesis of bullous pemphigoid (BP) and pemphigus vulgaris (PV), we employed immunohistochemical staining for CD163 and CD206, as well as pSTAT1, pSTAT6, interleukin (IL)-4, ...
Vogt Annika A Clinical Research Center for Hair and Skin Science, Department of Dermatology and Allergy, Charité-Universitätsmedizin Berlin, Charitéplatz 1, 10117, Berlin, Germany; Sorbonne Universités, UPMC University Paris 06, UMR S CR7, Centre d Immunologie et de Maladies Infectieuses Paris (Cimi-Paris), Paris, France; INSERM U1135, Cimi-Paris, Paris, - - 2014
Transcutaneous immunization (TCI) requires targeting of a maximum number of skin antigen-presenting cells as non-invasive as possible on small skin areas. In two clinical trials, we introduced cyanoacrylate skin surface stripping (CSSS) as a safe method for TCI. Here, using ex vivo human skin, we demonstrate that one CSSS procedure ...
Kim Ji Hye JH School of Food Science and Biotechnology, Kyungpook National University, Daegu, 702-701, Republic of - - 2014
Ginsenoside F1 (GF1) is a metabolite produced by hydrolysis of the ginsenoside Re and Rg1 in Panax ginseng. According to various studies, high amounts of ginseng components are absorbed in the metabolized form, which are key constituents responsible for the biological effects of P. ginseng. Recently, GF1 was reported to ...
Xu Wei W Laboratory for Wound Repair and Regenerative Medicine, Department of Surgery/Plastic Surgery - - 2014
Although it is known that the inflammatory response which results from disruption of epithelial barrier function after injury results in excessive scarring, the upstream signals remain unknown. It has also been observed that epithelial disruption results in reduced hydration status and that the use of occlusive dressings which prevent water ...
Picardo Mauro M Laboratory of Cutaneous Physiopathology, San Gallicano Dermatologic Institute (IRCCS), Rome, - - 2014
The imbalance and/or the perturbation of the microbial populations that colonize the skin and that contribute to its defense may represent one of the causes of the development of noninfectious skin diseases. Atopic dermatitis, psoriasis, acne, and rosacea can be listed among these kinds of pathologies. In particular, considering that ...
Burian Marc M Department of Dermatology, Eberhard-Karls-University Tübingen, Tübingen, - - 2014
In healthy human skin host defense molecules such as antimicrobial peptides (AMPs) contribute to skin immune homeostasis. In patients with the congenital disease ectodermal dysplasia (ED) skin integrity is disturbed and as a result patients have recurrent skin infections. The disease is characterized by developmental abnormalities of ectodermal derivatives and ...
Kim Brian S BS Division of Dermatology, Department of Medicine, Center for the Study of Itch, Washington University School of Medicine, St. Louis, Missouri, - - 2014
Innate lymphoid cells (ILCs) are part of a heterogeneous family of innate immune cells with newly identified roles in mediating immunity, tissue homeostasis, and pathologic inflammation. Here, we review recent studies delineating the roles of ILCs in the pathogenesis of multiple inflammatory skin disorders and their unique effector functions. Finally, ...
Ibrahim Mohamed M MM From the Division of Plastic and Reconstructive Surgery, Department of Surgery, Duke University School of Medicine, Durham, - - 2014
Hypertrophic scar contraction (HSc) following burn injury causes contractures. Contractures are painful and disfiguring. Current HSc therapies are marginally effective. To study pathogenesis and develop new therapies, a murine model is needed. We have created a validated immune-competent murine HSc model. A third-degree burn was created on the dorsum of ...
Nakamizo Satoshi S Department of Dermatology, Kyoto University School of Medicine, 54 Shogoin-Kawahara, Kyoto, 606-8507, - - 2014
The skin is the human body's largest organ and is home to a diverse and complex variety of innate and adaptive immune functions that protect against pathogenic invasion. Recent studies have demonstrated that cutaneous commensal bacteria modulated the host immune system. For example, Staphylococcus epidermidis, a skin commensal bacterium, has ...
Agrawal Rumjhum R Department of Pharmaceutics, University Institute of Pharmaceutical Sciences, Panjab University, Chandigarh, 160014, - - 2014
Curcumin has diverse biological activities including antioxidant and anti-inflammatory activity. However, its clinical use for topical application is limited due to its poor aqueous solubility and thus, minimal cutaneous bioavailability. Elastic vesicles (EVs) of curcumin were prepared to improve its cutaneous bioavailability and to use it for topical anti-inflammatory effect. ...
Kulkarni Nagaraj M NM Department of Biology, Drug Discovery Research, Orchid Chemicals and Pharmaceuticals Ltd., Old Mahabalipuram Road, Shozhanganallur, Chennai, 600119, - - 2014
Atorvastatin is a 3-hydroxy-3-methylglutaryl coenzyme-A reductase inhibitor used in the treatment of atherosclerosis and dyslipidemia. Studies have evaluated the utility of statins in the treatment of skin inflammation but with varied results. In the present study, we investigated the effect of atorvastatin on TNF-α release and keratinocyte proliferation in vitro ...
Zhao Zhao Z College of Agriculture and Biology, Shanghai Jiaotong University, Shanghai, - - 2014
Blue light induced oxidative damage and ER stress are related to the pathogenesis of age-related macular degeneration (AMD). However, the mechanism of blue light-induced damage remained obscure. The objective of this work is to assess the photooxidative damage to retinal pigment epithelial cells (RPE) and oxidation-induced changes in expression of ...
Plötz Sabine G SG Dermatology Munich-Harlaching, Grünwalderstraße 248, 81545 Munich, - - 2014
Introduction: Atopic eczema (AE) is a chronic relapsing inflammatory skin condition and one of the most common, potentially debilitating diseases with increasing incidence. Areas covered: The complex etiology of AE with multiple systemic and local immunologic and inflammatory responses and interactions between susceptibility genes and environmental factors leading to defects ...
Jahns A C AC Department of Medical Biosciences/Pathology, Umeå University, Umeå, - - 2014
The pathogenesis of acne vulgaris is multi-factorial with increased sebum production, alteration of the quality of sebum lipids, dysregulation of the hormone microenvironment, follicular hyperkeratinisation and Propionibacterium acnes-driven inflammation as major contributory factors. Hyperproliferation of keratinocytes is believed to contribute to hypercornification and eventually leads to comedone development. While the ...
Gaber Mohamed Abdelwahed MA Department of Dermatology and Andrology, Faculty of Medicine, Menoufia University , Shebeen-Elkoum , Egypt - - 2014
Abstract Background: Lichen planus (LP) is a chronic inflammatory papulosquamous skin disease characterized by epidermal basal cell damage and a particular band-like infiltrate predominantly of T cells in the upper dermis. It is characterized by the formation of colloid bodies representing apoptotic keratinocytes. The apoptotic process mediated by CD8+ cytotoxic ...
Mouret Stéphane S Unité BrÛlure Chimique, Département de Toxicologie et Risques Chimiques, Institut de Recherche Biomédicale des Armées, Centre de Recherches du Service de Santé des Armées, 24 avenue Maquis du Grésivaudan, 38700 La Tronche, France. Electronic address: - - 2014
Sulfur mustard (SM) is a strong bifunctional alkylating agent that produces severe tissue injuries characterized by erythema, edema, subepidermal blisters and a delayed inflammatory response after cutaneous exposure. However, despite its long history, SM remains a threat because of the lack of effective medical countermeasures as the molecular mechanisms of ...
Wang Yan Y The Cleveland Clinic, United - - 2014
A balanced turnover of dermal fibroblasts is crucial for structural integrity and normal function of the skin. During recovery from environmental injury (such as UV exposure and physical wounding), apoptosis is an important mechanism regulating fibroblast turnover. We are interested in the role that hyaluronan (HA), an extracellular matrix molecule ...
Murueva A V AV Institute of Biophysics, Siberian Division of Russian Academy of Sciences, Krasnoyarsk, - - 2014
We studied the effects of anti-inflammatory substances incorporated in polymeric microparticles made of degradable natural polyhydroxyalkanoate polyesters on experimental skin wounds caused by chemical burns in laboratory animals. Treatment with encapsulated forms of anti-inflammatory substances (applied in gel) accelerated wound healing in comparison with routine therapy (estimated by area of ...
Fernandéz José R JR Signum Dermalogix, 133 Wall Street, Princeton, New Jersey, - - 2014
The skin is the first line of defense against exposure to microbial, physical, environmental and chemical insults. In mobilizing a protective response, several different cell types located in our skin release and respond to pro-inflammatory cytokines ensuring skin homeostasis and health. However, chronic activation of this response, eventually causes damage ...
Li Hui H Department of - - 2014
Ultraviolet radiation (UVR) induces immunosuppression and is a major factor for development of skin cancer. Numerous efforts have been made to determine mechanisms for UVR induced immunosuppression and to develop strategies for prevention and treatment of UVR induced cancers. In the current study, we use IL-17 receptor (IL-17R) deficient mice ...
Nisar Muhammad Farrukh MF The Base of "111 Project" for Biomechanics & Tissue Repair Engineering; Key Laboratory of Biorheological Science and Technology, Ministry of Education, Bioengineering College, Chongqing University, Chongqing, 400044, - - 2014
Long wave UVA radiation (340-400 nm) causes detrimental as well as beneficial effects on human skin. Studies of human skin fibroblasts irradiated with UVA demonstrate increased expression of both anti-fibrotic heme oxygenase-1 (HO-1) and matrix metalloproteinase 1 (MMP-1). The use of UVA -induced MMP-1 is well studied in treating skin ...
Haniffa Muzlifah M Institute of Cellular Medicine, Newcastle University, NE2 4HH, UK; Department of Dermatology, Newcastle Upon Tyne NHS Trust, NE1 4LP, UK. Electronic address: - - 2014
Dendritic cells (DCs) are specialized antigen presenting cells abundant in peripheral tissues such as skin where they function as immune sentinels. Skin DCs migrate to draining lymph node where they interact with naïve T cells to induce immune responses to microorganisms, vaccines, tumours and self-antigens. In this review, we present ...
Nadim M M Centre de Biophysique Moléculaire, UPR4301 CNRS, 45071, Orléans, Cedex2, France; LibraGen-Induchem Company, 3, rue des satellites, Bat. Canal Biotech, 31400, Toulouse, - - 2014
Polyphenols are strong antioxidant molecules allowing prevention of skin photo-aging damages but their use is limited due to low solubility and toxicity towards skin cells. We postulated that enzymatic glucosylation could improve their solubility, stability and, consequently, their efficacy. The aim of this work is to study changes induced by ...
Akbik Dania D Faculty of Pharmacy, University of Sydney, Sydney, NSW 2006, - - 2014
Turmeric (Curcuma longa) is a popular Indian spice that has been used for centuries in herbal medicines for the treatment of a variety of ailments such as rheumatism, diabetic ulcers, anorexia, cough and sinusitis. Curcumin (diferuloylmethane) is the main curcuminoid present in turmeric and responsible for its yellow colour. Curcumin ...
Ruocco Eleonora E Department of Dermatology, Second University of Naples, via Sergio Pansini, 5, 80131 Naples, Italy. Electronic address: - - 2014
Ionizing and ultraviolet radiations, as well as burns, can selectively damage and immunologically mark the cutaneous area they act on through direct and indirect mechanisms. After the causal event has disappeared, the affected skin district may appear clinically normal, but its immune behavior is often compromised forever. In fact, irradiated ...
Lotti Torello T Chair of Department of Dermatology and Venereology, University of Rome "G. Marconi," Rome, - - 2014
Neuropeptides (NPs) and neurotransmitters are a heterogeneous group of soluble factors that make connections within the neuroendocrine and immune systems. NPs, including substance P (SP), vasoactive intestinal peptide (VIP), α melanocyte-stimulating hormone (α-MSH), and calcitonin gene-related peptide (CGRP), released by nerves that innervate the skin, can modulate the action of ...
Hsieh Chia-Yuan CY Institute of Clinical Medicine, College of Medicine, National Cheng Kung University, Tainan 701, - - 2014
IFN-γ mediates chemically induced skin inflammation; however, the mechanism by which IFN-γ-producing cells are recruited to the sites of inflammation remains undefined. Secretion of macrophage migration inhibitory factor (MIF), a proinflammatory cytokine, from damaged cells may promote immune cell recruitment. We hypothesized that MIF triggers an initial step in the ...
Pal Harish Chandra HC Department of Dermatology, University of Alabama at Birmingham, Birmingham, AL, - - 2014
Solar ultraviolet B (UVB) radiation has been shown to induce inflammation, DNA damage, p53 mutations, and alterations in signaling pathways eventually leading to skin cancer. In the present study, we investigated whether fisetin reduces inflammatory responses and modulates PI3K/AKT/NFκB cell survival signaling pathways in UVB exposed SKH-1 hairless mouse skin. ...
Jin Sun Hee SH Natural Products Research Institute, College of Pharmacy, Seoul National University, Seoul 151-742, Republic of - - 2014
Keratinocytes are the major cellular components of human epidermis and play a key role in the modulating cutaneous inflammation and toxic responses. In human chronic skin diseases, the common skin inflammatory phenotypes like skin barrier disruption and epidermal hyperplasia are manifested in epidermal keratinocytes by interactions with T helper (Th) ...
Kim Brian S BS Department of Microbiology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104; Institute for Immunology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104; Department of Dermatology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA - - 2014
Type 2 inflammation underlies allergic diseases such as atopic dermatitis, which is characterized by the accumulation of basophils and group 2 innate lymphoid cells (ILC2s) in inflamed skin lesions. Although murine studies have demonstrated that cutaneous basophil and ILC2 responses are dependent on thymic stromal lymphopoietin, whether these cell populations ...
Nasti Tahseen H TH The Department of Dermatology, University of Alabama at Birmingham School of Medicine, Birmingham, Alabama, - - 2014
Skin pigmentation is due to the accumulation of two types of melanin granules in the keratinocytes. Besides being the most potent blocker of ultraviolet radiation (UVR), the role of melanin in photo-protection is complex. This is because one type of melanin called eumelanin is UV absorbent whereas the other, pheomelanin, ...
Hemmerle Teresa T Department of Chemistry and Applied Biosciences, ETH Zürich, Wolfgang-Pauli-Strasse 10, CH-8093 Zurich, - - 2014
The antibody-mediated delivery of cytokines ("immunocytokines") to sites of pathological angiogenesis represents an attractive strategy for the development of innovative biopharmaceuticals, capable of modulating the activity of the immune system in cancer and in chronic inflammatory conditions. Recombinant IL4 has previously been shown to be therapeutically active in patients with ...
Wittmann Miriam M Leeds Institute of Rheumatic and Musculoskeletal Medicine, University of Leeds, Leeds LS7 4SA, UK; NIHR Leeds Musculoskeletal Biomedical Research Unit, Chapel Allerton Hospital, Leeds LS7 4SA, UK; Centre for Skin Sciences, University of Bradford, Bradford BD7 1DP, UK. Electronic address: - - 2014
This review focuses on treatment targets for the most common inflammatory skin diseases, eczema and psoriasis with an emphasis on cytokines expressed in the uppermost layer of the skin which is easily accessible for diagnostic and therapeutic approaches. Recently, a significant body of research has highlighted the influence of the ...
Pollott G E GE Department of Production and Public Health, Royal Veterinary College, Royal College Street, London, NW1 0TU, UK. Electronic address: - - 2014
Milk production from dairy animals has been described in terms of 3 processes: the increase in secretory cell numbers in late pregnancy and early lactation, secretion rate of milk per cell, and the decline in cell numbers as lactation progresses. This latter process is thought to be determined by the ...
Berens-Riha Nicole - - 2014
Malaria has been shown to change blood counts. Recently, a few studies have investigated the alteration of the peripheral blood monocyte-to-lymphocyte count ratio (MLCR) and the neutrophil-to-lymphocyte count ratio (NLCR) during infection with Plasmodium falciparum. Based on these findings this study investigates the predictive values of blood count alterations during ...
Glushakova Svetlana S Program in Physical Biology, Eunice Kennedy Shriver National Institute of Child Health and Development, National Institutes of Health, Bethesda, MD, 20892, - - 2014
Background. The mechanisms by which α-thalassemia and sickle cell traits confer protection from severe Plasmodium falciparum malaria are not yet fully elucidated. We hypothesized that hemoglobinopathic erythrocytes reduce the intraerythrocytic multiplication of P. falciparum, potentially delaying the development of life threatening parasite densities until parasite clearing immunity is achieved.Methods. We developed a ...
Wynant Niels N Molecular Developmental Physiology and Signal Transduction, Department of Animal Physiology and Neurobiology, KU Leuven, Naamsestraat 59, P.O. Box 02465, B-3000 Leuven, Belgium. Electronic address: - - 2014
Desert locusts are characterized by a highly sensitive and effective RNA interference (RNAi) response. Moreover, delivery of dsRNA into the open body cavity will elicit potent silencing effects throughout the body. On the other hand, many other insect species, such as Bombyx mori and Drosophila melanogaster, lack the ability to ...
Moore Kathryn J KJ Marc and Ruti Bell Vascular Biology and Disease Program, Leon H. Charney Division of Cardiology, Department of Medicine, New York University School of Medicine, New York, NY 10016, - - 2014
Macrophages in atherosclerotic plaques are activated, inflammatory cells that directly contribute to the disease process. De Nardo et al. (2013), now report that high-density lipoproteins (HDL) can reprogram macrophages to be less inflammatory through an ATF3-dependent pathway, providing another mechanistic basis for the atheroprotective properties of HDL.
1 2 3 4 5 6 7 8 9 10 >