|
A phylogenetic test of classical species groups in
Argia (odonata: coenagrionidae).
|
|
|
|
|
| Article Type: | Report |
| Subject: | Damselflies (Natural history) |
| Authors: |
Caesar, Ryan M. Wenzel, John W. |
| Pub Date: | 04/01/2009 |
| Publication: | Name: Entomologica Americana Publisher: New York Entomological Society Audience: Academic Format: Magazine/Journal Subject: Biological sciences; Science and technology Copyright: COPYRIGHT 2009 New York Entomological Society ISSN: 1947-5136 |
| Issue: | Date: April, 2009 Source Volume: 115 Source Issue: 2 |
| Geographic: | Geographic Scope: United States Geographic Code: 1USA United States |
|
|
|
| Accession Number: | 257814193 |
| Full Text: |
Abstract.--We present the first cladistic analysis of Argia
species, focusing on those occurring in North America north of Mexico.
Our analysis is based on mitochondrial 16S rDNA and morphological
characters of both sexes of adults and immatures. We reexamine classical
work on Argia taxonomy and phylogeny. Our results agree considerably
with previous hypotheses based morphology in an absence of phylogenetic
analysis, and thus our work represents and independent test of these
previous hypotheses. Argia is recovered as monophyletic. The clade
composed of A. funcki plus A. lugens is basal among the species studied
here. The species A. fumipennis, including the three subspecies, appears
to be a paraphyletic assemblage, and thus may warrant being considered
separate species as originally described. The feasibility of producing a
thorough phylogenetic analysis of the entire genus using multiple
sources of data is discussed. Key words: Argia, Coenagrionidae, Odonata, damselfly, phylogeny. INTRODUCTION Rambur described the genus Argia (Odonata: Zygoptera: Coenagrionidae: Argiinae) in 1842. Argia is extremely speciose in comparison to other odonate genera, with 118 valid described species (Garrison, 1994; Garrison and von Ellenrieder, 2007). The genus occurs throughout the New World, with its greatest diversity occurring in the neotropical region. There are approximately thirty six species that can be found in North America north of Mexico, with the highest diversity in the southwestern United States; twenty three species are known to occur in southeastern Arizona alone. The remaining species occur in subtropical, tropical and temperate regions of Meso- and South America. Populations of common Argia species can be quite large, and, like all odonates, they are voracious predators in all life stages. As such, they represent vital components of the trophic webs of aquatic ecosystems. Most species of Argia prefer low to mid order streams (Westfall and May, 1996), unlike the remainder of coenagrionids that tend to occur in lentic systems (Dunkle, 1990). Several species are rare, endemic, or threatened, and may be of conservation concern. For example, in Ohio, A. bipunctulata (Hagen) is listed as an endangered species, due to its restriction in the state mainly to the 182 hectare Cedar Bog Preserve and a few other fen habitats (Moody, 2002), although the species is fairly common in adjacent states. The recently described species A. sabino Garrison is known from very few localities in Arizona, most of which are continually threatened by forest fire, and thus it is considered a species of concern by biologists in that state (D. Turner, pers. comm.) Some of the more common species have been thoroughly studied from a behavioral and ecological perspective (Borror, 1934; Bick and Bick, 1965, 1971, 1982; Robinson et al., 1983; Conrad, 1992; Conrad and Pritchard, 1988, 1990). Little is known about the biology of most of the tropical species, and there has never been a phylogenetic study of the genus. The current taxonomy of Argia species has been established in the absence of an explicit phylogenetic hypothesis based on modern comparative methods. In his work on Central American Odonata, Calvert treated forty eight species of Argia (Calvert, 1901), eighteen of which occur in the United States (Garrison, 1994). Kennedy included some Argia species in his "phylogeny" of Zygoptera (Kennedy, 1920a), and he described several species (Kennedy, 1918, 1919). Leonora Gloyd did considerable taxonomic work on Argia throughout her life (Gloyd, 1958, 1968a, 1968b), although she died before much of her work was completed (Garrison, 1994). The larvae of some Mexican species were treated by Novelo-Gutierrez (1992). Garrison (1994) provided a thorough synopsis of the species of Argia occurring north of Mexico, including taxonomic keys for adults (these keys are reproduced in Westfall and May 1996), and several informal species groups were outlined. Forster (2001) provides updated taxonomic keys for some of the more common Central American species of Argia. Garrison is currently continuing the work of Leonora Gloyd on revising the tropical species (pers. comm.). Many undescribed species are thought to exist, and new species descriptions continue to be published (Daigle, 1991, 1995; Garrison, 1994, 1996; Garrison and von Ellenrieder, 2007). Here we provide the first modem phylogenetic hypothesis for Argia species based on multiple data sources and using two phylogenetic optimality criteria. These preliminary phylogenetic analyses allows us to test existing taxonomic hypotheses, contribute an improved understanding of species relationships, and provide a foundation for resolving the phylogeny of the genus. MATERIALS AND METHODS Taxon sampling Our matrix includes thirty eight of the 118 described Argia species, including nearly all of those found north of Mexico as well as several from Mesoamerica. A. bipunctulata, A. barretti Calvert and A. carlcooki Daigle are the only species currently known to occur north of Mexico that are missing from our matrix. Collection records for specimens used in this study are listed in Table 1, along with GenBank accession numbers. Where possible, we include in this study adult specimens that were recently collected in the field using a hand held aerial net and deposited directly into 95% ethyl alcohol for preservation. Additional specimens were donated by other collectors utilizing various collection and preservation techniques, or were borrowed from the International Odonata Research Institute (IORI; Gainesville, Florida). Additionally, we did not attempt to collect molecular data from some species for which few or single specimens were available. Species were identified on the basis of published keys based on morphological characters (Garrison, 1994; Westfall and May, 1996; Abbott, 2005.) A. sp. nov. is an undescribed species collected in northern Mexico; it has been known for several years but remains undescribed. The sister group of Argia is not known; we include six outgroup taxa representing other damselfly lineages. 16S sequences for these outgroup species were taken from GenBank (Table 1.) Specimens used in this study are deposited as vouchers at either the IORI or the Charles Triplehom Insect Collection at the Ohio State University (OSUC) in Columbus, Ohio. We coded ten morphological characters from imagos of both sexes as well as larvae for 35 Argia species. Characters of the head, thorax and abdomen, including secondary sexual characters of both sexes, are represented. Characters were initially chosen based on information in published dichotomous keys. These characters are unambiguous in their interpretation and do not seem to vary within species. The morphological matrix is presented in Table 2. Character 1. Thorax and head with metallic copper-red coloration (imagos): absent (0), present (1). This condition is also associated with copper-red to red eyes for specimens in vivo (imagos.) Species with this coloration are often referred to as being associated together in the "metallics" group. While pigmentation is generally not a very useful character for damselflies, as it is often variable within species, this condition is largely a result of structural coloration and is invariant within species. Character 2. Mesepistemal tubercles (females): absent (0), reduced (1), prominent (2). See Fig. 1. Character 3. Posterior lobes of mesostigmal plates (females): absent (0), broad and flange-like (1), elongate and finger-like (2). See Fig. 1. Character 4. Mesothoracic pits (females): absent (0), shallow (1), deep (2). This character has been discussed in very limited context in the literature, but it has been suggested that it might be informative for phylogenetics (Gloyd, 1958). Here we code it for the first time and show that it is useful. Character 5. Hairs lining mesothoracic pits (females): absent (0), sparse (1), dense (2). Character 6. Mesepisternal pits costate (females): absent (0), present (1). Character 7. Pronotal pits (females): absent (0), shallow (1), deep (2). This character is not utilized in keys or discussed much in the literature, but seems to be variable enough within Argia to be useful. Indeed, this region corresponds to the placement of the dorso-posterior potion of the male paraprocts during tandem linkage and copulation (see Fig. 1.) Character 8. Shape of cerci (males): entire (0), bifid (1), trifid (2). Cerci are a secondary sexual character, utilized as part of the clasping process during copulation. The cerci contact the female mesostigmal plates and mesepisternal tubercules when linked in copula and may be part of the mechanism by which females recognize and evaluate males. Character 9. Shape of paraprocts (males): entire (0), bifid (1), trifid (2). Character 10. Lateral gills with marginal fringe of stout setae (larvae): present (0), absent (1). Genomic DNA was extracted from specimens that were either freshly collected and preserved in 95% ethyl alcohol, or older museum specimens that were acetone-dried (up to 20 years old). A modification of the animal tissue protocol for Quiagen DNeasy extraction kits (Quiagen, Valencia, CA, USA; Caesar et al., 2005) was used to extract DNA from leg and thoracic muscle tissue that was isolated from specimens using sterile techniques. Dried specimens from which DNA was extracted were labeled as DNA vouchers. DNA template vouchers are stored at -80[degrees]C in the Wenzel Laboratory at the Museum of Biological Diversity, Ohio State University (MBD.) [FIGURE 1 OMITTED] 16S ribosomal DNA (0.6 kb) from the mitochondria was amplified by the polymerase chain reaction (PCR) run at 35 cycles with annealing temperature of 50[degrees]C. We used the primers LR-J-12887 (5' CCGGTCTGAACTCAGATCACGT 3') and LR-N-13398 (5' CGCCTGTTTAACAAAAACAT 3') (Simon et al., 1994), known to be useful in several odonate studies (e.g., Misof et al., 2000). Reactions were carried out in 25 [micro]l volumes, with 12.5 [micro]l of a TAQ master mix (Quiagen, Inc. Valencia, CA, USA), 3.5 [micro]l of H2O, 2.0 [micro]l of each primer (0.5 pmol/[micro]l), and 5.0 [micro]l genomic DNA template. A layer of mineral oil was applied to each sample, and reactions occurred on a PTC-100 Peltier thermal cycler (MJ Research, Ramsey, Minnesota, USA). Amplified DNA was separated in an agarose gel via electrophoresis and visualized under UV light for verification of presence of amplicon and to check for contamination. PCR products were purified using QIAquick PCR purification kit (Quiagen, Valencia, CA, USA), and purified DNA was sequenced at the Plant Microbe Genomics Facility (Ohio State University, Columbus, OH) or at Cogenics (Houston, TX). Editing and assembly of raw sequences was performed using Sequencher 4.1 (Gene Codes Corp., Ann Arbor, Michigan, USA). We sequenced PCR products in both directions, and and differences or ambiguities between strands were resolved by eye after examining the elecropherograms of each sequence. Edited sequences were initially aligned by eye in Sequencher 4.1, then submitted to CLUSTALW (Thompson et al., 1994) for further alignment using a 1:1 gap opening: extension cost. After editing and alignment, we utilized 551 base pairs (bp) as our molecular data matrix. All new sequences generated in this study were deposited in GenBank (Table 1). Phylogenetic analysis Calopteryx was designated as outgroup for all phylogenetic analyses. Parsimony analysis was performed on the molecular data only, and in combination with the morphological data. We used the parsimony ratchet implemented in NONA/WinClada (Nixon, 2000). By default, this implements TBR branch swapping. Gaps in the molecular matrix were treated as missing data. Bremer support values were generated in NONA using the command ">hold 15,000; bsupport 5;" to estimate relative clade support. This command generates as many as 15,000 trees that are up to five steps longer than the most parsimonious trees. Concordance among trees produced by different methods of phylogenetic reconstructions is considered by some to be a good test of phylogenetic accuracy (Huelsenbeck, 1997). Thus, we also performed Maximum Likelihood (ML) analysis on the molecular data. We did this using the program GARLI, version 0.96 (Zwickl, 2006), which uses a genetic algorithm to rapidly search for the nucleotide substitution model parameters, branch lengths, and topology that maximize the log likelihood score. Default parameters were used for 100 search replicates. RESULTS In some cases, DNA extraction and/or PCR amplification of the target sequence failed for older museum specimens that were otherwise available for study. Thus, our analyzed matrices do not include all available species. The ClustalW-aligned molecular matrix contains 126 informative sites and yields 38 most parsimonious trees (489 steps, CI = 0.54, RI = 0.61) in the MP analysis. The strict consensus (499 steps) of these is shown in Fig. 2. A monophyletic Argia is recovered with good support, but a basal polytomy with several weakly supported clades follows. The ML analysis of the molecular data produced two trees that differ only in the resolution of the clade containing the three species A. apicalis (Say), A. tarascana Calvert, and A. tezpi Calvert. The ML tree with the best likelihood score is shown in Fig. 3. Analysis of the morphological matrix (Table 2) alone yields trees (not shown) that are poorly resolved and not informative. Combining the morphological and molecular characters, we obtained six most parsimonious trees (573 steps, CI = 0.49, RI = 0.58). The consensus (578 steps) is shown in Fig. 4. These morphological data in the combined analysis improved resolution in comparison with the molecular data alone, with few changes in topology. Again Argia is recovered as monophyletic, although the Bremer support value improves from three to five. The basal polytomy resulting from the molecular only data is resolved, and we recover the clade of A. funcki (Selys) + A. lugens (Hagen) as basal to the rest of the genus. In the combined tree, A. moesta (Hagen) is more basal, closer to A. translata Hagen; A. munda Calvert falls out of the clade to which it belonged, sister to the component including A. pima Garrison and A. rhoadsi Calvert. Some taxa are derived more apically in the combined tree compared to the molecular tree, such as A. oculata Hagen, which is no longer sister to A. oenea Hagen in the basal paraphyly at the ingroup node of Fig. 2. The polytomy in the middle of the molecular tree (the component including A. alberta Kennedy, A. nahuana Calvert, A. leonorae Garrison, to A. anceps Garrison) has better resolution, and the A. pima-A, westfalli Garrison component is now sister to the remainder, with the A. emma Kennedy-A. extranea (Hagen) group coming out next. [FIGURE 2 OMITTED] [FIGURE 3 OMITTED] DISCUSSION All but three clades from the MP consensus from the combined matrix are found in the ML trees, as indicated by the dots on the shared nodes of the MP trees (Figs. 2, 4), and the ML trees (Fig. 3), demonstrating that the solution to our 16S data is generally stable, despite optimality criterion. The main difference is that the MP tree places A. funcki and A. lugens rather basally, and the A. rhoadsi and A. sedula (Hagen) group rather apically, whereas the ML tree places these lineages in the middle of the tree. This rather modest difference has the undesirable effect of compromising the monophyly of most groups along the spine of the tree even if the great majority of fundamental relationships remain the same. Monophyly of Argia is strongly supported by both data partitions and in all phylogenetic analyses conducted for this study (Figs. 2, 3, and 4). This is not surprising, and there are additional morphological features that are autapomorphic for Argia relative to other Coenagrionidae that support monophyly of Argia. These include the long length of tibial spines (Westfall and May, 1996) and absence of an angulate frons (Carle et al., 2008). O'Grady and May also recovered Argia as monophyletic in their morphological analysis of Coenagrionidae (2003), although only three species were included. We think that this result will be stable to the addition of data in future analyses. The solutions to the molecular-only (Fig. 2) or combined (Fig. 4) matrices appear very different, and a strict consensus of these trees provides little resolution. Strict consensus trees are usually used to illustrate groups that are monophyletic for all solutions, but it is not very useful when there is a great degree of agreement for certain networks of taxa among otherwise competing solutions. Problematic taxa and rooting issues that interrupt networks are often not disputed among very different solutions. While we are always interested in recovering monophyletic of lineages, especially for taxonomic work, analysis of "species groups" should also focus on stable networks of terminals, even if their placement is ambiguous. We offer Fig. 5 to demonstrate that the solutions of Figs. 2 and 4 are easily interpretable to be closely related, despite a poorly resolved consensus. Our discussion is based on three agreement subtrees, each of which is common to all solutions. We concentrate on the clade that is sister to A. oculata, where the appearance of discord is most evident. Excluded from discussion are A. munda and the pair A. agrioides Calvert and A. hinei Kennedy, because they are not informative for demonstrating agreement among trees. The first comparison is the sedula-pulla-rhoadsi component (Fig. 5A). This component can be placed either basally near A. oculata (Fig. 2), or apically in the clade of interest (Fig. 4). In both cases the root of this component is between A. sedula and the pair A. pulla Hagen in Selys plus A. rhoadsi. Next we discuss the component that includes the clades emma-extranea, and pima-westfalli (Fig. 5B). This combination of ten species is topologically identical in both Figs. 2 and 4, and also rooted in the same place. The difference is that in Fig. 2 the component is apical in the tree and monophyletic, whereas in Fig. 4 it is deeper in the tree and paraphyletic (but with components adjacent, hence identical in topology to the monophyletic interpretation). [FIGURE 4 OMITTED] [FIGURE 5 OMITTED] Fig. 5C summarizes the placement of these components by plotting the alternative arrangements simultaneously on the topology common to both solutions. The alternative placements in Fig. 5C produce either Fig. 2 or Fig. 4. This demonstration, requiring cropping only three species from a total of 27, illustrates that the molecular and combined matrices differ in modest ways with respect to the connection of species to each other, even if these differences have undesirable consequences for a strict consensus. Keeping in mind that the total number of trees possible from this set of 24 terminals is approximately 5 x 1026, it is evident that the matrices are concordant, or congruent, except in the alternatives shown in Fig. 5C. The fact that the entirety of the component of Fig. 5B is identical in both trees is also encouraging. We conclude from this exploration of agreement subtrees that our analyses identify the same close networks of species, even if there is ambiguity regarding the placement of those networks. The main lesson is that morphological data provide adequate phylogenetic signal to move the sedula-pulla-rhoadsi group apically, away from A. oculata Hagen in Selys, and place the component of Fig. 5b to a more basal portion of the tree, even in combination with molecular data. These findings demonstrate the importance of morphological data to complement molecular data in Argia, and warrant further investigation of potentially informative morphological characters. The combined parsimony tree (Fig. 4) in many ways accords with traditional groupings of species based on morphology alone. Having a phylogeny with which to compare to these previous nonphylogenetic hypotheses of relationship allows us to provide a test, and a revised hypothesis. Because our phylogeny is based on different characters and analytical methods, it represents an independent test of the classical morphologybased species groups of Calvert, Kennedy, Gloyd, Garrison and others. The close relationship between A. funcki and A. lugens, and their sister relationship to the remaining Argia, reflects the original placement of these species in the genus Hyponeura by Selys (1865) on the basis of veinational characters. Hyponeura, along with Diargia Calvert (which included the species bicellulata Calvert), was synonomized with Argia after it was determined that venational characters are unreliable for species distinction (Gloyd, 1968a). Kennedy (1920b) divided about 55 species of Argia into five subgenera on the basis of the morphology of the penes; indeed, omitting those taxa that do not fall into the geographic range of our study, we recover many of Kennedy's groups in our analyses, both molecular and combined: Cyanargia includes A. lacrimans (Hagen) and A. tonto Calvert; Heliargia is composed of A. vivida Hagen, A. plana Calvert, (plus A. immunda, which we pull out of this clade); Chalcargia, including A. translata, A. harknessi, A. cuprea, A. oenea, A. ulmeca, A. occulata, (A. garrisoni and A. sp. nov. were not available to Kennedy). He also placed here A. tezpi and A. sedula although our analyses do not support this. Kennedy defined his species groups solely on morphology of the intromittent penes, so it is satisfying that we find similar patterns based on molecular and morphological characters not used by Kennedy. Additionally, taxonomists have proposed close relationships among (A. vivida, A. plana, A. extranea), (A. fumipennis and A. pallens), (A. westfalli and A. anceps), and (A. tonto and A. lacrimans) (Gloyd, 1958; Garrison, 1994, 1996; Westfall and May, 1996), which our analyses support. A. plana was originally described as a variety of A. vivida by Calvert (1901), and Gloyd later elevated it to species status on the basis of clasper morphology (1958). Our results validate Gloyd, as we recover A. vivida as sister to A. plana plus A. extranea. The close relationship between the latter was suggested on the basis of coloration and morphology by Garrison (1994). In a thorough study of some Argia larvae, Novelo-Gutierrez separated species into groups on the basis of a single character: the degree of convexity of the ligula (1992). He placed species into three groups: those with very prominent ligulae (including A. emma, harknessi, insipida, moesta, oenea, tezpi, translata and ulmeca), moderately prominent ligulae (A. munda, taraseana, and tonto), and slightly prominent ligulae (A. fumipennis, laerimans, nahuana, plana, pulla, rhoadsi, and sedula). Our analysis suggests that this character is not homologous (Fig. 4), or at least is insufficient to accurately infer phylogenetic relationship. Larvae of Argia species remain poorly studied. Our limited inclusion of larval characters indicates their potential value as sources of phylogenetic characters, but further study of larval morphology is needed. Of the 118 species of Argia currently recognized, larvae are known from relatively few species. Argia fumipennis is composed of the three subspecies atra, fumipennis, and violacea. These were described as separate species largely on the basis of wing color; A. f violacea has the typical clear wing color, A. f fumipennis can have smokyhyaline wing color in parts of its range, while A. f atra has dark brown wing pigmentation. These species were unified on the basis of several morphological characters (Gloyd, 1968b). Closely related to A. fumipennis, on the basis of general size, appearance, and clasper morphology, is A. pallens (Westfall and May, 1996), a species restricted in the U.S. to southeastern Arizona. Our analyses do not include A. f fumipennis, but based on the molecular data we place A. pallens within the A. fumipennis group, sister to A. f violacea (Figs. 2, 3). The morphological data pull A. pallens out as sister to A. fumipennis (Fig. 4) in a monophyletic clade. Both results are only weakly supported, so further investigation of these relationships is warranted, as taxonomic changes may be justified. A somewhat surprising result is that we fail to recover in our analyses a monophyletic assemblage of the "metallic" species- those that have the cupreous coloration in the head and thorax (A. cuprea, A. oenea, A. orichaleea). We only code one morphological character related to the metallic condition in this study. Further analysis of this group is needed, and more detailed character analysis may provide additional synapomorphy for these species that have traditionally been considered close relatives. A plethora of additional characters, including several morphological features unique to Argia, are available for further study. For example, males have a unique pair of pad-like structures called "tori," located posterodorsally on the tenth abdominal segment between the cerci; the morphology of these, and of the cerci and paraprocts, are critical for species identification. These characters are used in published taxonomic keys (Garrison, 1994; Westfall and May, 1996; F6rster, 2001), yet have not been thoroughly explored as phylogenetic characters. Species of Argia also differ dramatically in morphology of the penes (Kennedy, 1920a), and while Kennedy used some of these structures in his "phylogeny" of Zygoptera, his work predated by many years the formal development of phylogenetic methodology. A careful reexamination of these structures in Argia is warranted. Additional mitochondrial genes, as well as both ribosomal and protein-coding genes such as 12S, 16S, cytochrome oxidases I and II, are already known to be informative for odonate phylogenetics (Chippendale et al., 1999; Misof et al., 2000; Turgeon et al., 2005; Bybee et al., 2008). In addition, it has been demonstrated that nuclear genes such as Histone 3, Elongation Factor 1alpha, 18S and 28S rDNA show adequate variation for species-level analyses in odonates (Ware et al., 2007; Bybee et al., 2008; Carle et al., 2008). We continue to code, refine, and expand upon our data set as we continue our work on the systematics and evolution of Argia. ACKNOWLEDGMENTS We thank several collectors who kindly donated specimens that were used in this study, listed in Table 1. Bill Mauffray of the IORI made the collection available on several occasions and providing and generously loaned specimens for this study. For discussion of various aspects of this study, we thank Joe Gillespie, Dennis Paulson, Mark McPeek, Ola Fincke, and members of the Wenzel Lab at OSU. The suggestions of two anonymous reviewers improved an earlier version of our manuscript. We owe special gratitude to Rosser Garrison for sharing his immense expertise on Neotropical Odonata with us. LITERATURE CITED Abbott, J. C. 2005. Dragonflies and Damselflies of Texas and the South-Central United States. Princeton University Press, Princeton, New Jersey, USA. Borror, D. J. 1934. Ecological studies of Argia moesta Hagen (Odonata: Coenagrionidae) by means of marking. Ohio Journal of Science 34: 97-108. Bick, G. H. and J. C. Bick. 1965. Color variation and significance of color in reproduction in the damselfly, Argia apicalis (Say) (Zygoptera: Coenagriidae) (sic). Canadian Entomologist 97(1): 32-41. Bick, G. H. and J. C. Bick. 1971. Localization, behavior, and spacing of unpaired males of the damselfly Argia plana Calvert (Odonata: Coenagrionidae). Proceedings of the Entomological Society of Washington 73: 146-152. Bick, J. C. and G. H. Bick. 1982. Behavior of adults of dark-winged and clear-winged subspecies of Argia fumipennis (Burmeister) (Zygoptera: Coanagrionidae). Odonatologica 11(2): 9~107. Bybee, S. M., T. H. Ogden, M. A. Branham and M. F. Whiting. 2008. Molecules, morphology and fossils: a comprehensive approach to odonate phylogeny and the evolution of the odonate wing. Cladistics 24(4): 477 514. Caesar, R. M., N. Gillette and A. I. Cognato. 2005. Population Genetic Structure of an Edaphic Beetle (Ptiliidae) Among Late Successional Reserves within the Klamath-Siskiyou Ecoregion, California. Annals of the Entomological Society of America 98(6): 931 940. Calvert, P. P. 1901. Odonata, in Biologia Centrali Americana: Insecta Neuroptera. R. H. Porter and Dulau and Co., London, UK. Carle, F. L., K. M. Kjer and M. L. May. 2008. Evolution of Odonata, with special reference to Coenagrionoidea (Zygoptera). Arthropod Systematics & Phylogeny 66(1): 37-44. Chippendale, P. T., D. Varshal, D. H. Whitmore and J. V. Robinson. 1999. Phylogenetic relationships of North American damselflies of the genus Ischnura (Odonata: Zygoptera: Coenagrionidae) based on sequences of three mitochondrial genes. Molecular Phylogenetics and Evolution 11:110-121. Conrad, K. F. 1992. Relationships of larval phenology and imaginal size to male pairing success in Argia vivida Hagen (Zygoptera: Coenagrionidae). Odonatologica 21(3): 335 342. Conrad, K. F. and G. Pritchard. 1988. The mating behavior of Argia vivida Hagen: as an example of female-control mating system (Zygoptera: Coenagrionidae). Odonatologica 17: 179-185. Conrad, K. F. and G. Pritchard. 1990. Pre-oviposition mate guarding and mating behavior of Argia vivda (Odonata: Coenagrionidae). Ecological Entomology 15: 363-370. Daigle, J. J. 1991. Argia garrisoni spec. nov. from Mexico (Zygoptera: Coenagrionidae). Odonatologica 20(3): 337 342. Daigle, J. J. 1995. Argia carlcooki spec. nov. from Mexico (Zygoptera: Coenagrionidae). Odonatologica 24(4): 467-471. Dunkle, S. W. 1990. Damselflies of Florida, Bermuda and the Bahamas. Scientific Publishers, Gainesville, Florida, USA. Forster, S. 2001. The dragonflies of Central America exclusive of Mexico and the West Indies. Gunnar Rehfeldt, Wolfenbiittel, Germany. Garrison, R. W. 1994. A synopsis of the genus Argia of the United States with keys and descriptions of new species, Argia sabino, A. leonorae, and A. pima (Odonata: Coenagrionidae). Transactions of the American Entomological Society 120(4): 287-368. Garrison, R. W. 1996. A synopsis of the Argia fissa group, with descriptions of two new species, A. anceps sp. n. and A. westfalli sp. n. (Zygoptera: Coenagrionidae). Odonatologica 25(1): 31-47. Garrison, R. W. and N. von Ellenrieder. 2007. The true Argia difficilis Selys, 1865, with the description of Argia yungensis sp. nov. (Odonata: Coenagrionidae). Transactions of the American Entomological Society 133(1): 189-204. Gloyd, L. K. 1958. The dragonfly fauna of the Big Bend region of Trans-Pecos Texas. Occasional Papers of the University of Michigan Museum of Zoology 658. Gloyd, L. K. 1968a. The union of Argia fumipennis (Burmeister, 1839) with Argia violacea (Hagen, 1861), and the recognition of three subspecies (Odonata). Occasional Papers of the University of Michigan Museum of Zoology. Gloyd, L. K. 1968b. The synonomy of Diargia and Hyponeura with the genus Argia (Odonata: Coenagrionidae: Argiinae). Michigan Entomologist 1(8): 271-274. Huelsenbeck, J. P. 1997. Is the Felsenstein zone a fly trap? Systematic Biology 46: 69-74. Kennedy, C. H. 1918. New species of Odonata from the southwestern United States. Part I. Three new Argias. Canadian Entomologist 50(7): 256-261. Kennedy, C. H. 1919. A new species of Argia (Odonata). Canadian Entomologist 51: 17-18. Kennedy, C. H. 1920a. The phylogeny of the zygopterous dragonflies as based on the evidence of the penes. Ohio Journal of Science 21: 1%32. Kennedy, C. H. 1920b. Forty-two hitherto unrecognized genera and subgenera of Zygoptera. The Ohio Journal of Science 21: 83-88. Misof, B., C. L. Anderson and H. Hadrys. 2000. A Phylogeny of the Damselfly Genus Calopteryx (Odonata) Using Mitochondrial 16S rDNA Markers. Molecular Phylogenetics and Evolution 15(1): 5-14. Moody, D. 2002. Coenagrionidae: Narrow-winged damselflies. In Glotzhober, R. C. and D. McShaffrey (eds.), The Dragonflies and Damselflies of Ohio. Ohio Biological Survey, Columbus, Ohio, USA. Nixon, K. C. 2000. Winclada version 0.99 (BETA). Published by the author, Ithaca, New York (available at www.cladistics.com). Novelo-Gutierrez, R. 1992. Biosystematics of the larvae of the genus Argia in Mexico (Zygoptera: Coenagrionidae). Odonatologica 21: 39-71. O'Grady, E. W. and M. L. May. December 2003. A phylogenetic reassessment of the subfamilies of Coenagrionidae (Odonata, Zygoptera). Journal of Natural History 37: 2807-2834. Rambur, M. P. 1842. Histoire Naturelle des Insectes Neuropteres. Librarie Encyclopedique de Roirot, Paris, France. Robinson, J. V., J. E. Dickerson and D. R. Bible. 1983. The demographics and habitat utilization of adult Argia sedula (Hagen) as determined by mark-recapture analysis (Zygoptera: Coenagrionidae). Odonatologica 12(2): 167-172. Simon, C., F. Frati, A. Beckenbach, B. Crespi, H. Liu and P. Flook. 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87(6): 651-70l. Thompson, J. D., D. G. Higgins and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673-4680. Turgeon, J., R. Stoks, R. A. Thum, J. M. Brown and M. A. McPeek. 2005. Simultaneous Quaternary Radiations of Three Damselfly Clades across the Holarctic. American Naturalist 165: E78-E107. Ware, J. M., M. L. May and K. Kjer. 2007. Phylogeny of the higher Libelluloidea (Anisoptera: Odonata): An exploration of the most speciose superfamily of dragonflies. Molecular Phylogenetics and Evolution 45: 289-310. Westfall, M. J. and M. L. May. 1996. Damselflies of North America. Scientific Publishers, Gainsville, FL. Zwickl, D. J. 2006. Genetic algorithm approaches for the phylogenetic analysis of large biological sequence datasets under the maximum likelihood criterion. Ph.D. dissertation, The University of Texas at Austin. Received 10 February 2009; accepted 22 November 2009 RYAN M. CAESAR (1,2) AND JOHN W. WENZEL (1) (1) Department of Entomology, Ohio State University, Columbus, OH (2) E-mail address for correspondence: caesar.6@osu.edu Table 1. Taxonomic information, collection records and GenBank
accession numbers for Argia and outgroup species used in
phylogenetic analyses.
Taxon Authority Sampling locality
Calopteryx aequibilis Say, 1839 unknown
C. maculata (Beauvois, 1805) unknown
Hetaerina americana (Fabricius, 1798) unknown
Neoneura esthera Williamson, 1917 unknown
Ceriagrion nipponicum Asahina, 1967 unknown
Argia agrioides Calvert, 1895 USA: Oregon
A. alberta Kennedy, 1918 USA: New Mexico
A. anceps Garrison, 1996 Mexico: Hidalgo
A. apicalis (Say, 1839) USA: Ohio
A. cuprea (Hagen, 1861) USA: Texas
A. emma Kennedy, 1915 USA: California
A. extranea (Hagen, 1861) Mexico: Sonora
A. fumipennis atra (Burmeister, 1839) USA: Florida
A. fumipennis violacea (Burmeister, 1839) USA: Ohio
A. funcki (Selys, 1854) Mexico: Sonora
A. garrisoni Daigle, 1991 Mexico: Tamaulipas
A. harknessi Calvert, 1899 Mexico: Sonora
A. hinei Kennedy, 1918 USA: Texas
A. immunda (Hagen, 1861) USA: Texas
A. lacrimans (Hagen, 1861) USA: Arizona
A. leonorae Garrison, 1994 USA: Texas
A. lugens (Hagen, 1861) USA: Arizona
A. moesta (Hagen, 1861) USA: Texas
A. munda Calvert, 1902 USA: Arizona
A. nahuana Calvert, 1902 USA: Texas
A. sp. nov. Not applicable Mexico: Sonora
A. oculata Hagen in Selys, 1865 Mexico: Tamaulipas
A. oenea Hagen in Selys, 1865 Mexico: San Luis Potosi
A. pallens Calvert, 1902 USA: Arizona
A. pima Garrison, 1994 USA: Arizona
A. plana Calvert, 1902 USA: Texas
A. pulla Hagen in Selys, 1865 Nicaragua: Jinotega
A. rhoadsi Calvert, 1902 Mexico: San Luis Potosi
A. sabino Garrison, 1994 USA: Arizona
A. sedula (Hagen, 1861) USA: Oklahoma
A. tarascana Calvert, 1902 USA: Arizona
A. tezpi Calvert, 1902 Honduras: Francisco
Morazan
A. tibialis (Rambur, 1842) USA: Ohio
A. tonto Calvert, 1902 USA: Arizona
A. translata Hagen in Selys, 1865 USA: Texas
A. ulmeca Calvert, 1907 Mexico: Tamaulipas
A. vivida Hagen in Selys, 1865 USA: California
A. westfalli Garrison, 1996 Mexico: Tamaulipas
GenBank
accession
Taxon Collector number
Calopteryx aequibilis GenBank AF170961
C. maculata GenBank AF170960
Hetaerina americana GenBank AF170951
Neoneura esthera GenBank AF170948
Ceriagrion nipponicum GenBank AB127067
Argia agrioides R. Caesar FJ592218
A. alberta J. Abbott FJ592211
A. anceps K. Tennessen FJ592233
A. apicalis R. Caesar FJ592212
A. cuprea T. Gallucci FJ592227
A. emma C. Barrett FJ592228
A. extranea R. Behrstock FJ592231
A. fumipennis atra K. Holt FJ592230
A. fumipennis violacea R. Caesar FJ592232
A. funcki D. Paulson FJ592197
A. garrisoni R. Behrstock FJ592213
A. harknessi D. Paulson FJ592199
A. hinei J. Abbott FJ592207
A. immunda A. Cognato FJ592214
A. lacrimans R. Behrstock FJ592216
A. leonorae R. Behrstock FJ592226
A. lugens R. Caesar FJ592215
A. moesta A. Cognato FJ592229
A. munda R. Caesar FJ592223
A. nahuana T. Gallucci FJ592225
A. sp. nov. D. Paulson FJ592198
A. oculata R. Behrstock FJ592221
A. oenea R. Behrstock FJ592217
A. pallens W. Mauffray FJ592224
A. pima J. Daigle FJ592208
A. plana J. Abbott FJ592196
A. pulla J. Abbott FJ592222
A. rhoadsi R. Behrstock FJ592206
A. sabino J. Daigle FJ592202
A. sedula H. Song FJ592209
A. tarascana R. Caesar FJ592200
A. tezpi S. Dunkle FJ592220
A. tibialis R. Caesar FJ592203
A. tonto R. Caesar FJ592204
A. translata A. Cognato FJ592210
A. ulmeca R. Behrstock FJ592205
A. vivida J. Abbott FJ592201
A. westfalli R. Behrstock FJ592219
Table 2. Morphological character matrix used for
parsimony analysis of Argia. See Methods for coding.
Taxon Characters (1-10)
Het.ameri ??????????
A.plana1 0111202?11
A.extrane 0101?01111
A.vivida1 0211100011
A.emma1 0222111111
A.munda1 00???1?010
A.anceps2 0110000000
A.westfa1 011120000?
A.sabino1 011110211?
A.lacrima 0?10001110
A.tonto1 0010001110
A.pima1 001??0?11?
A.f.atra1 0121201211
A.f.viola 0121201211
A.pallens 0010001211
A.funcki1 00212?110?
A.lugens1 0122102100
A.moesta1 0222201100
A.hinei1 0020002211
A.agrioid 0120001011
A.alberta 0000000010
A.leonora 000??0?01?
A.nahuana 0110001011
A.pulla1 0000001121
A.rhoadsi 0022101001
A.sedula1 0010102011
A.tarasca 0221101110
A.apicali 0100001210
A.tezpi 0221101010
A.tibiali 0000000110
A.immunda 0001001111
A.transla 0222102010
A.ulmeca1 0101002110
A.n.sp.1 0??????11?
A.garriso 002000111?
A.harknes 0?????????
A.oculata 001100201?
A.cuprea1 1221102100
A.oenea1 1021102110
Cal.aequa ??????????
Cal.macu1 ??????????
Ceri.nipp ??????????
Neo.esthe ?????????? |
| Gale Copyright: | Copyright 2009 Gale, Cengage Learning. All rights reserved. |