What microbes are lurking in your house? Identification of unknown microorganisms using a PCR-based lab experiment.
Abstract: In an effort to update the microbiology teaching-lab curriculum by making lab experiments more current, we designed a microbiology lab experiment that used the polymerase chain reaction to identify microbes growing in students' homes. This experiment successfully engaged students, reinforced theoretical information presented in lectures, provided our students with valuable and current molecular technique exposure, and made molecular microbiology personally meaningful and exciting.

Key Words: Microbiology educational initiatives; polymerase chain reaction (PCR); universal primers; molecular detection; bacterial identification; innovative teaching laboratories.
Article Type: Report
Subject: Microbiology (Study and teaching)
Microorganisms (Study and teaching)
Authors: Rosenzweig, Jason A.
Jejelowo, Olufisayo
Pub Date: 08/01/2011
Publication: Name: The American Biology Teacher Publisher: National Association of Biology Teachers Audience: Academic; Professional Format: Magazine/Journal Subject: Biological sciences; Education Copyright: COPYRIGHT 2011 National Association of Biology Teachers ISSN: 0002-7685
Issue: Date: August, 2011 Source Volume: 73 Source Issue: 6
Organization: Organization: Texas Southern University
Accession Number: 265291903
Full Text: After teaching microbiology labs at numerous U.S. institutions, we noticed that the vast majority of clinical laboratory experiments were largely outdated. We thought to ourselves, "Why are we compromising our students' learning by not providing them with state-of-the-art molecular experiments that are used in both clinical and research microbiology labs throughout the world?" If we perpetuate the mistake and only instruct our students in how to perform decades-old lab techniques, they will leave the laboratory with a false sense of empowerment and preparedness for either microbiology careers or graduate schools. Thinking back on our own undergraduate experiences as microbiology students, we always assumed that what we were being taught was current, meaningful, and actually used in the real world at that time.

Unfortunately, we were duped, and cheated of learning contemporary microbiology lab techniques. Once we entered graduate school, we very quickly realized how little we actually knew, and how poorly prepared we were. Today, however, as a microbiology professor in a predominantly teaching institution of higher learning, Dr. Rosenzweig is able to do something about this problem by developing a meaningful microbiology lab that employs critical thinking as well as contemporary molecular techniques. In fact, this unique experiment can even be employed as a high school biology lab that could stimulate discussion and small-group presentations, and demystify concepts that students hear about in television programming (e.g., DNA forensic studies).

O Concept Explanation

In an effort to reshape our microbiology lab curriculum to make the course more engaging and relevant for our students, we sought to conduct a lab toward the end of the semester that would reinforce the theoretical lessons discussed in lecture as well as complement the existing laboratory experiments, which have become commonplace, perfunctory, and even outdated from a diagnostic perspective. In todays clinical/diagnostic and basic microbiology research worlds, identification of organisms is often achieved by employing molecular biology techniques, including the polymerase chain reaction (PCR) and DNA sequencing.

The polymerase chain reaction is a widely used molecular-biology technique that is, in essence, a cell-free (in vitro) DNA replication reaction carried out in a test tube. It emulates DNA replication that takes place in all living cells. All the ingredients required for DNA replication within a cell (in vivo) are also required for this in vitro reaction. After deoxynucleotide triphosphates (dNTPs, the building blocks of nucleic acids: adenine, guanine, cytosine, and thymine), short oligonucleotide primers (needed to initiate DNA synthesis), a thermostable DNA polymerase (that can withstand temperatures in excess of 94[degrees]C experienced during the PCR reaction), and some template DNA have been added to the tubes, DNA replication can be carried out through the use of a thermocycler (see Figure 1A). A thermocycler is a heat block that can be programmed by the user to cycle through various temperatures for defined periods. Standard thermocylcers are generally inexpensive, and for a high school application, if a thermocycler is not available, one could be borrowed from a neighboring university or community college. A commonly used cycling program is 30-35 cycles of the following temperatures for the indicated periods: 95[degrees]C for 1 minute (DNA melting/denaturation step), 55[degrees]C for 1 minute (primer annealing step), and 72[degrees]C for lminute/kilo-base (1000 nucleotides) of DNA (primer extension/elongation step) (see Figure 1B). At the conclusion of a successful reaction, one original molecule of template DNA will have been amplified more than [10.sub.8]-fold.

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

By contrast, DNA sequencing is PCR with a unique twist. DNA sequencing employs poisonous dideoxynucleotide tri-phosphates (diNTPs) in a 1:1 ratio with the nonpoisonous dNTPs. As a result, the DNA polymerase enzyme has an equal chance of incorporating either a poisonous or a nonpoisonous nucleotide at any given position in the newly synthesized DNA strand. Each of the four poisonous diNTPS is labeled with a unique fluorescent tag that can be identified by a computer and interpreted to determine which diNTP had terminated the DNA strand. On the basis of DNA strand length, the computer then determines the nucleotide sequence of the DNA in question (see Figure 2).

In the past, antibiotics were blindly selected while organism cultures and biochemical test results were awaited. Today, in hospitals or other clinical settings, rapid identification of a bacterial infectious agent (using the abovementioned molecular techniques) could allow the physician to customize more effective antibiotics, thus dramatically increasing the chance for a favorable outcome. Such an approach could mean the difference between life and death. Sequence identification of unknown organisms by PCR provides the advantage of rapidity, in that organisms do not need to be cultured and enzymatic reactions do not need to be carried out. Unfortunately, as currently structured, many microbiology teaching labs--including our own at Texas Southern University (TSU)--fail to expose undergraduate students to these current, and now somewhat standard, techniques. To address this, we developed a PCR-based molecular-detection lab to be conducted after students have attempted to identify unknown cultures using the more common metabolic tests (e.g., lactose fermentation, gelatinase, oxidase, and catalase tests).

To get our students excited about using molecular biology to identify unknown microbes, we developed a student-centered approach. The students made nutrient agar plates (a general medium that supports a broad range of microbial growth, including Gram negative and positive bacteria as well as fungi), which they took home along with a piece of parafilm (flexible plastic film) to seal the plate after growth of unknown microbes was achieved. The students exposed the sterile plates (by removing the lids) in areas within their homes where they suspected microbial growth (e.g., the bathroom and kitchen). The plates were uncovered and exposed to the environment for an 18-hour period after which the plates were sealed with the parafilm and then brought back to the laboratory (see Figure 3).

Once in the laboratory, the students evaluated each other's plates for diverse colony morphologies. Each colony represented an unidentified microorganism that was present in students' homes. The students were both surprised and alarmed to witness the diverse growth they discovered on their nutrient agar plates. This aspect of the project truly fascinated our students--they were actually taking their TSU microbiology education beyond the classroom and into their homes.

Using PCR and universal primers (primers that bind to a region of DNA that doesn't change within a wide range of organisms) obtained from two colleagues, we amplified a region of ribosomal DNA (rDNA) that encodes portions of ribosomal RNA (rRNA) from either fungi or bacteria. Ribosomal DNA is often used as a region for sequence comparison among organisms because little change occurs at the nucleotide level of DNA among organisms in this region. The advantage of such an approach is that after the universal primers bind to the highly conserved (little to no nucleotide changes) regions of the rDNA found on all bacteria or fungi, the amplified region that lies between the forward and reverse primers will be variable among organisms (see Figure 4). This variation can be determined after PCR-amplified products have been subjected to DNA sequencing (see Figure 2). Once the DNA sequences have been determined, they can be entered in a computer software program that algorithmically aligns the sequence to all sequences that have been deposited in the GenBank database (http://blast.ncbi. nlm.nih.gov/). Such an alignment generates a sequence-similarity hierarchy in which the most closely conserved sequence is listed first, thereby identifying the organisms which were most likely growing in the students' houses.

[FIGURE 3 OMITTED]

** Materials Needed

* Nutrient agar plates (can be made or purchased)

* Parafilm

* Sterile pipette tips for p200 and p10 micropipettes

* Thermocycler (can be purchased or borrowed)

* Taq 2X PCR Master mix (available from New England Biolabs)

* Universal fungal and bacterial primers (see sequences below), which can either be ordered or requested from referenced sources

* Agarose and gel electrophoresis tank

* Tris borate EDTA (TBE) or Tris acetic acid EDTA (TAE) running buffer (can be borrowed, made, or purchased)

* UV gel box for visualization and DNA extraction

* A gel extraction kit (QIAquick gel extraction kit--http:// www.qiagen.com)

* Sequence data: outsource to a DNA sequencing company (or DNA core facility at a local research university) to generate sequence data (about $7-15 per sequencing reaction); high schools often receive discounts for sequencing reactions (be sure to inquire)

To carry out the proposed experiment, several essential items were needed. First, the students needed sterile nutrient agar (NA) plates. If an autoclave is available, these solid media plates can easily be made; otherwise, NA plates are commercially available and inexpensive (http:// www.vwr.com). The students were then given a small piece of parafilm to seal their plates following 18-hour exposures in their homes. Additionally, a standard thermocycler will be needed for the subsequent PCR. This can be purchased for a reasonable fee, and high school teachers could borrow one from a neighboring community college or university.

To successfully carry out the PCR upon return to lab, several items were used. First, template was prepared by simply removing one colony from the plate using a sterile micropipette tip and adding it to the 25-[micro]-L PCR final reaction volume in a 0.5-mL microcentrifuge tube (http://www.vwr.com). The lysed bacteria then served as the starting material containing our template DNA after being subjected to the 95[degrees]C temperature for an initial 5-minute denaturing period in the thermocycler. This type of PCR is often referred to as "colony PCR" or "dirty PCR" because a colony, rather than purified DNA, is used as the source of template DNA.

However, template alone is not sufficient to carry out PCR, and the students can be asked about what is required for a PCR reaction as an exam question; primers, deoxynucleotide triphosphates (dNTPs), and a thermostable DNA polymerase are also needed.

[FIGURE 4 OMITTED]

Universal fungal primers were obtained from a colleague at Duke University, Dr. Vilgalys (http://www.biology.duke.edu/fungi/ mycolab/primers.htm). These primers, ITS1-F (CTTGGTCATTTA GAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC), amplify a ~750-nucleotide-long region of the fungal rDNA termed the "internal transcribed spacer regions" (ITS). The regions amplified include conserved nucleotides (where the universal primers bind) as well as some divergent variable regions that serve as the basis for comparison and identification of various fungi (Hibbett, 1992).

Bacterial universal primers that amplify a region of rDNA were obtained from another colleague, Dr. Michael Ferris at the Children's Hospital of New Orleans. His primer set of 27F (AGAGTTTGATCCTGGCTCAG) and 1387R (GGGCGGGTGTACAAGGC) amplifies a product of approximately 1360 nucleotides (Ferris et al., 2007). The regions amplified include conserved nucleotides (where the universal primers bind) as well as some divergent variable regions that serve as the basis for comparison and identification of various bacteria.

In setting up the dirty/colony PCR reactions, the students used a commercially available 2x concentrated Taq Master mix (New England Biolabs) that contained the necessary dNTPs (at 0.2 mM each) as well as 25 units m[L.sup.-1] of Taq polymerase derived from the hot-watergrowing Thermus aquaticus. The master mix was diluted as necessary to achieve a 25-[micro]L PCR final reaction volume in a 0.5-mL microcentrifuge tube (http://www.vwr.com). The students then programmed the thermocycler as described in Figure 1. The PCR products were then run on a 1% agarose gel using electrophoresis. For subsequent sequencing reactions, a gel extraction kit (QIAquick gel extraction kit; http://www.qiagen.com) would be required to excise the students' PCR products from the agarose gel prior to outsourcing for the sequencing reactions.

** Student Instruction

At the beginning of any research lies a general inquiry or question that can be addressed experimentally. This lab exercise is based on several such questions that can be posed to budding microbiologists, the first being "Is my house as clean and sterile as I believe it to be?" This will be answered by observable microbe growth on their NA plates. The second question to be investigated is "Can I identify any unknown microorganisms growing in my house using molecular techniques?" The second question can be answered by the students by employing PCR and DNA sequencing reactions. Before the PCR was set up, the students were reintroduced to the basic concept of PCR using computer animation (http://www.maxanim.com/genetics/PCR/PCR. htm) to remind them of what was previously presented in the lecture. In addition, they were given a detailed "hands-on" introduction to the thermocyler, and how it is programmed. Furthermore, we explained the significance of universal primers and how large the expected PCR products would be using the universal bacterial and fungal primers.

To promote critical thinking, we discussed explanations of what could potentially go wrong in the experiment and what troubleshooting measures could be taken. The students were also reminded that ~2% of all microbes have been identified, and that evidence of the existence of the remaining 98% unidentified microbes can only be obtained using molecular approaches like PCR using universal primers. The remainder of the instruction was hands-on, with the students divided into four groups, each of which added one of the components to the microcentrifuge tube: template/ colony, master mix, forward primer, or reverse primer. Four independent, putative bacterial colonies with different morphologies were used, as well as four putative mold colonies.

** Student Assessment

The students were assessed in two ways. The first was a conceptual assessment on a lab exam in which they were given essay questions that addressed troubleshooting and technical understanding of PCR and universal primers. The second was a practical assessment of the experimental results: were the students successful in generating PCR products? If not, they were expected to provide potential explanation(s) for the failure, describing their reasoning, in the discussion section of their lab report. In our PCR experiment, all four of the unique suspected bacterial colonies (based on colony morphology) yielded the expected size of PCR product (~1.3 kilobases/1300 nucleotides), based on the universal primer binding sites and the physical distance between the forward and reverse primers once bound (see Figure 5, last four lanes); however, no PCR products (of expected size ~750 nucleotides) were generated using the universal fungal primers (Figure 5, first four lanes). The students theorized that there may have been a problem with extraction of the mold DNA. That scenario could very realistically have affected the group's experimental outcome.

[FIGURE 5 OMITTED]

The students were then encouraged to identify independent, alternative mold-DNA extraction protocols using the Internet and to include such alternatives in their lab report with the appropriate citations in the discussion section.

** Teacher Implementation/Suggestions

Enhancing microbiology teaching to better prepare students to compete in the workplace requires an improved partnership between lecture material and practical laboratory experiences at the curriculum level. The two microbiology experiences (didactic lecture and laboratory) should work together synergistically and, ideally, reinforce one another. In that vein, it is insufficient to merely teach certain principles exclusively in theory. Rather, in order to more effectively educate undergraduate microbiology and high school students, some molecular techniques more routinely used in microbiology research labs around the world should be introduced into the laboratory curriculum. Such an approach would effectively reinforce theoretical material taught in the lecture and give students a hands-on opportunity, which can often facilitate student learning. This paper suggests one such experiment in which students can attempt to identify unknown microbes growing in their homes through the use of a molecular technique, PCR (using universal bacterial and fungal primers that amplify regions of rDNA).

From a technical perspective, to overcome the aforementioned problem associated with fungal DNA extraction, the use of a lysis buffer containing 0.5% sodium dodecyl sulfate (a detergent) and glass beads that serve to shear the chitinous cell wall (Rakeman et al., 2005) would be recommended to increase DNA yields from molds. In our experiment, budgetary constraints prevented us from sequencing the PCR products and thereby performing the comparative analysis and ultimate identification of the microbes in question. However, the alignments can still be performed after sequence of known organisms (derived from GenBank by the professor) is blindly supplied to the students, who would then be required to perform the algorithmic analysis for identification purposes. Such a follow-up experiment could enable the students to learn the same process and expose them to bioinformatics and in silico (in computer) data mining. This would be a much more cost-effective method to achieve the same educational result.

Taken together, this approach is unique in that undergraduate microbiology students at TSU are learning about environmental microbiology using updated molecular techniques in the context of a required lab course that has traditionally been dominated by clinical microbiology and related experiments. We believe that our efforts are having an immediate effect on the type of education that our students are receiving, which in turn will make our students better trained and prepared for whatever their futures may bring, be it grad school, professional studies, or the job market.

DOI: 10.1525/abt.2011.73.6.5

** Acknowledgments

We would like to acknowledge Abidat Lawal for her help in developing the microbiology teaching lab curriculum as well as Ayodotun Sodipe for all of his support in our endeavors. Work on this manuscript was supported by the National Aeronautics and Space Administration (NASA) cooperative agreement NNX08B4A47A

References

Ferris, M.J., Norori, J., Zozaya-Hinchliffe, M. & Martin, D.H. (2007). Cultivationindependent analysis of changes in bacterial vaginosis flora following metronidazole treatment. Journal of Clinical Microbiology, 45, 1016-1018.

Hibbett, D.S. (1992). Ribosomal RNA and fungal systematics. Transactions of the Mycological Society of Japan, 33, 533-556.

Rakeman, J.L., Bui, U., LaFe, K., Chen, Y., Honeycutt, R.J. & Cookson, B.T. (2005). Multilocus DNA sequence comparisons rapidly identify pathogenic molds. Journal of Clinical Microbiology, 43, 3324-3333.

JASON A. ROSENZWEIG (rosenzweigja@tsu.edu) is Assistant Professor and OLUFISAYO JEJELOWO (jejelowo_oa@tsu.edu) is Professor and former Chair of the Department of Biology at Texas Southern University, 3100 Cleburne Street, Houston, TX 77004.
Gale Copyright: Copyright 2011 Gale, Cengage Learning. All rights reserved.