Study on genetic diversity of six duck populations with microsatellite DNA.
Article Type: Report
Subject: Ducks (Genetic aspects)
Population genetics (Research)
Biological diversity (Research)
Satellite DNA (Properties)
Phylogeny (Research)
Authors: Wu, Yan
Liu, Xiao-Lin
Hou, Shui-Sheng
Huang, Wei
Pub Date: 06/01/2008
Publication: Name: Asian - Australasian Journal of Animal Sciences Publisher: Asian - Australasian Association of Animal Production Societies Audience: Academic Format: Magazine/Journal Subject: Agricultural industry; Biological sciences Copyright: COPYRIGHT 2008 Asian - Australasian Association of Animal Production Societies ISSN: 1011-2367
Issue: Date: June, 2008 Source Volume: 21 Source Issue: 6
Topic: Event Code: 310 Science & research
Product: Product Code: 0259100 Ducks NAICS Code: 11239 Other Poultry Production SIC Code: 0259 Poultry and eggs, not elsewhere classified
Geographic: Geographic Scope: China Geographic Code: 9CHIN China
Accession Number: 179242347
Full Text: ABSTRACT: In this study, we investigated the genetic diversity and phylogenetic relationship of six duck populations by employing the genetic polymorphisms of 20 microsatellites. The parameters used in this study included number of alleles, average effective numbers of alleles (E) and average rates of heterozygosity of each population. The results showed that all the microsatellite loci were highly polymorphic except that the locus AJ515896 in Muscovy duck was 0. The average PIC (0.762), average h (0.7843) and average E (5.261) of the six duck populations were all high, indicating that the gene polymorphisms and genetic diversity were high. The test of Hardy-Weinberg equilibrium showed that the six populations in this study were all in Hardy-Weinberg disequilibrium. The F-statistic analysis results showed the range of [F.sub.ST] was from 0.0205 (AJ515895) to 0.2558 (AJ515896). The mean [F.sub.ST] was 0.0936. Phylogenetic study revealed that Peking duck (Z1 and Z4), Shaoxing duck, Cherry Valley duck and Aobaixing duck were clustered in one group, while the Muscovy duck was clustered in one group alone. The phylogenetic relationships among different populations were in accordance with their breeding history and distribution. Our data suggested that the 20 microsatellite loci were effective markers for analysis of genetic relationships among duck populations. (Key Words : Domestic Duck (Anas platyrhynchos), Microsatellite, Genetic Diversity, Population, China)

INTRODUCTION

China was one of the earliest nations in the world to domesticate ducks (Anas platyrhynchos) and currently raises the largest populations of these birds. However, in past decades, China has imported foreign ducks and used them to improve native duck performance. This resulted in the decrease of native duck populations and, even worse, caused the disappearance of some native populations. Since the native duck populations are invaluable genetic resources, it remains urgent to systematically investigate their genetic diversity and genetic characteristics. There have been many reports using microsatellites to study the genetic diversity of chickens (Romanov and Weigend, 2001; Chen et al., 2003; Wu et al., 2004; Chen et al., 2004; Osman et al, 2005; Kong et al., 2006; Osman et al., 2006; Liu et al, 2006; Chang et al, 2007; Ahlawat et al, 2008). In ducks, Chen et al. (2001), Zuo et al. (2004) and Yan et al. (2005) analyzed the genetic diversity of some populations using random amplification polymorphic DNA (RAPD) and amplification fragment length polymorphism (AFLP). Stai et al. (2003), Huang et al. (2005), Li et al. (2006) and Tang et al. (2007) separately analyzed wild and domestic Muscovy ducks and some native ducks in China by microsatellites. Microsatellites are characterized by a core sequence that consists of a number of tandemly repeated units with a length of 1-6 base pairs. They have high diversity and are easily examined. With the availability of high-throughout DNA sequencing, sizing of microsatellite alleles has become efficient. Therefore, microsatellites have been widely used in many applications. Microsatellites are deemed to be one of the most valuable genetic markers (Aranguren-Mendez et al., 2002; Wang et al., 2004). In this paper, we investigated the genetic diversity of six duck populations (Peking duck (Z1 and Z4), Muscovy duck, Shaoxing duck, Cherry Valley duck and Aobaixing duck) with 20 microsatellite loci.

MATERIAL AND METHODS

Population samples and microsatellite primers

Three hundred ducks were randomly chosen from six duck populations in China (50 ducks of each population): Peking duck Z1, Z4, Cherry Valley duck and Aobaixing duck from Beijing, Shaoxing duck and Muscovy duck from Zhejiang. Blood (5 ml) was collected from each duck into a tube containing 1 ml anticoagulant and was then preserved in a -20[degrees]C freezer.

Twenty microsatellite primers were designed based on the report of Maak et al. (2000, 2003). The sequences of primers are listed in Table 1.

Genomic DNA extraction and PCR condition

The hydroxybenzene-chloroform method was used to extract duck genomic DNA as described in the Molecular Cloning-A Laboratory Manual (2nd edition) (Sambrook et al., 1999). The PCR amplification was carried out in 20 [micro]l of a mixture containing 1 [micro]l DNA template (40 ng/[micro]l), 10 x PCR Buffer 2 [micro]l, 0.4 [micro]l dNTP(10 mmol/L), 2.0 [micro]l MgCL2 (20 mmol/L), 0.8 [micro]l of each primer (10 pmol/[micro]l) and 0.4 [micro]l Taq DNA polymerase (2 U/[micro]l) from Dingguo Biotech (Beijing). Double-distilled water was added to a final volume of 20 [micro]l. After a denaturing step of 5 min at 94[degrees]C, samples were processed through 30 cycles of 45 s at 94[degrees]C, 35 s at an optimal annealing temperature and 40 s at 72[degrees]C. The last elongation step was lengthened to 5 min at 72[degrees]C.

Electrophoresis

Both agarose gel (1.5-2%) and polyacrylamide gel (8%) were used to analyze PCR products. Finally, the Alphalmager software was used to analyze the segmental length of the genes.

[FIGURE 1 OMITTED]

Data analysis

Allele frequencies were computed by Pi = (2 (ii) + (ij1) + (ij2) + ... + (ijn))/2N, where Pi was the frequency of the ith allele for which i represented the allele, while j1, j2, ... jn were the co-dominant alleles to i, and n was the number of the allele.

Polymorphic information content (PIC) was calculated by the following formula (Botstein et al., 1980):

[MATHEMATICAL EXPRESSION NOT REPRODUCIBLE IN ASCII]

The formulas of Heterozygosity (h) and effective number of alleles (E) (Xiao, 2002) are listed below:

[MATHEMATICAL EXPRESSION NOT REPRODUCIBLE IN ASCII]

Where m was the number of the allele, and Pi and Pj were the frequencies of the ith and the jth allele, respectively.

The Hardy-Weinberg equilibrium was tested by [X.sup.2]. The formula is listed below:

[X.sup.2] = [k.summation over (i=l)] [([O.sub.i] - [E.sub.i]).sup.2] / [E.sub.i]

Where [O.sub.i] showed observed times of genotypes; [E.sub.i] showed expected times of genotypes; k showed the number of genotypes.

The F-statistic was calculated by the followed formula:

[1-F.sub.ST] = (1-[F.sub.IS]) x ([1-F.sub.IT])

Where [F.sub.IT] was the fixation indices of individuals relative to its subpopulations; [F.sub.IS] was the fixation indices of individuals relative to the total population; [F.sub.ST] was the fixation indices of subpopulation relative to the total population.

The genetic distance (Nei et al., 1983) and the dendrogram between different populations were estimated by the neighbor-joining method (NJ) (Saitou and Nei, 1987) in the DISPAN software (Ota, 1993).

RESULTS

Gene diversity and allele frequencies

Figure 1 shows one of the polyacrylamide gels (PAGE) of PCR products. The total number of alleles in 20 microsatellite loci of six populations was 281. There were 151, 176, 175, 171, 163 and 156 alleles in the Peking duck Z4, Peking duck Z1, Shaoxing duck, Muscovy duck, Cherry Valley duck and Aobaixing duck, respectively.

Polymorphism information content (PIC)

As shown in Table 2, the PIC of the microsatellite AJ515883 in the Peking duck Z1 was the highest (PIC = 0.9515), but PIC of the microsatellite AJ515896 in Muscovy duck was 0. Among microsatellite loci, the locus AJ515895 had the highest PIC (PIC = 0.8723) while the locus AJ515896 had the lowest PIC (0.5968). The average PIC of all sites and populations was 0.762. PIC of most microsatellite sites was more than 0.5. This indicated that the selected microsatellite loci had high diversity and can reflect the genetic relationship of different populations on a molecular level.

Heterozygosity (h)

The heterozygosity is summarized in Table 3; heterozygosity was the highest (0.8079) in Muscovy duck and varied from 0 to 0.9118; followed by the Peking duck Z1 (0.7954) which varied from 0.6289 to 0.9004; whereas the Aobaixing duck was lowest (0.7654) and varied from 0.5886 to 0.8881. The average h of all populations was 0.7843.

Effective number of alleles (E)

The effective number of alleles is also an index used to reveal the genetic diversity of the populations. Table 4 shows the results for the effective number of alleles. The E value of 20 microsatellite loci was the highest (5.7351) in Muscovy duck and, varied from 0 to 11.3443; while it was the lowest in Charry Valley duck (4.7289) and varied from 2.4534 to 7.9819. The average E of all populations was 5.261.

The test of Hardy-Weinberg equilibrium

The Hardy-Weinberg equilibrium was used for testing whether the genotypes were maintained in balance or deviated from balance. The test results of Hardy-Weinberg equilibrium are listed in Table 5. The six duck populations were all in Hardy-Weinberg disequilibrium.

F-statistic analysis

The F-statistic was used in testing the genetic differentiation among subpopulations. The F-statistics were calculated for 20 microsatellite loci. The results are shown in Table 6. In this study, the range of [F.sub.ST] was from 0.0205 (AJ515895) to 0.2558 (AJ515896). The mean of [F.sub.ST] was 0.0936.

Genetic distances and clustering of ducks

The Nei's genetic distance (DA) was calculated by the allele's frequencies and the results are summarized in Table 7. Genetic distance between Shaoxing duck and Cherry Valley duck was the shortest (0.1839), followed by Shaoxing duck and Peking duck Z1 (0.1947); the genetic distance between Muscovy duck and Peking duck Z4 was the longest (0.4558). The dendrogram was constructed using the NJ method of DISPAN software (Figure 2). The six populations were clustered into two groups. Peking duck Z4, Aobaixing duck, Peking duck Z1, Shaoxing duck and Cherry Valley duck were clustered together, while Muscovy duck was not included in the group.

[FIGURE 2 OMITTED]

DISCUSSION

Genetic diversity among loci and populations

In this study, we investigated the genetic diversity and phylogenetic relationships of six duck populations in China. The polymorphisms revealed differences among 20 microsatellite loci in the six populations. Average effective number of alleles of all microsatellite loci was 5.261, but it was different in each population and locus and varied from 0 to 11.407.

The PIC was a good index for genetic diversity evaluation. Botstein et al. (1980) first pointed out that PIC index can be used to evaluate the level of gene variation: when PIC>0.5, the locus has high diversity; when PIC< 0.25, the locus has low diversity; and the locus has intermediate diversity when PIC between 0.25 and 0.5. In this study, the PIC of 20 microsatellites in each population all showed high diversity except the AJ515896 locus in Muscovy duck. This suggested that the 20 microsatellite loci are all high diversity loci in the duck.

Heterozygosity (h) is one of the indices used to assay the genetic variation of each population. The values of h indicate the diversity level of the molecular marker. When the value is high, the molecular marker's diversity is high too. Among all loci studied, the h of the locus AJ515895 had the highest value (0.876), while the locus AJ515896 had the lowest h value (0.6212). In all populations, the h of Muscovy duck was the highest (0.8079), followed by Peking duck Z1 (0.7954), whereas Aobaixing duck was the lowest (0.7654). Our data indicated that genetic diversity of each population was high and there were enough gene resources in duck populations. This may be related to the breeding history and environment of each population.

Effective number of alleles (E) is used to assay the effect of alleles in each population. The result of this study revealed that the E of Muscovy duck was the highest (5.7351) and Cherry Valley duck was the lowest (4.7289) among all duck populations. Average E of all populations was 5.261. It was also shown that the E of 20 microsatellite loci in all duck populations was high. This result suggested that the populations have better abilities to keep the effective alleles when selection, mutation or genetic drift has occurred.

Taken together, each duck population used in this study had high average effective number of alleles (E), heterozygosity (h) and polymorphism information content (PIC), suggesting that genetic diversity of the 20 microsatellite loci in the six populations was high.

The structure of six duck populations

The Hardy-Weinberg equilibrium was used in testing whether the genotypes were maintained in balance or deviated from balance. In this study, the six duck populations were all in Hardy-Weinberg disequilibrium. These results showed that the structures of six duck populations were all being destroyed. Selection, nonrandom mating and inbreeding were the main reasons which induced the disequilibrium. In addition, in this study there were other reasons causing the disequilibrium, such as the excursion caused by mutation, genetic drift, selection, etc.

The F-statistic was used in testing the genetic differentiation among subpopulations. The [F.sub.IS] and FIT may be positive values or negative values, however, the [F.sub.ST] values were always positive. When there is no differentiation, the value of [F.sub.ST] is 0; when alleles among populations are quite different, the value of [F.sub.ST] equals 1. In this study, the range of [F.sub.ST] was from 0.0205 (AJ515895) to 0.2558 (AJ515896). The mean of [F.sub.ST] was 0.0936.

Phylogenesis of duck populations

There are many methods to measure the genetic distance. Nei showed that average codon margin of each locus can be estimated by the gene frequency of abundant loci. In this study, genetic distance and the dendrogram (Figure 2) between different populations were estimated by the neighbor-joining method (NJ) in the DIASPAN software.

The dendrogram of populations in Figure 2 reflected the genetic relationships of populations. The six populations clustered into two groups: one group included Peking duck Z4, Aobaixing duck, peking duck Z1, Cherry Valley duck and Shaoxing duck, while Muscovy duck was clustered into another group. In group one, Peking duck Z4 had the shortest genetic distance with Aobaixing duck, followed by Peking duck Z1, Cherry Valley duck and Shaoxing duck. The result of this cluster was consistent with breeding history and environment of the five populations. According to evolutional history, Peking duck appeared two hundred years ago. Peking duck Z1 and Z4 were new lines, which were cultivated in the 1980s in China. Female line Peking duck Z1 was mainly used to lay eggs, while Peking duck Z4 was the male line and used to breed with the Aobaixing duck. Cherry Valley duck was imported into China from England and Aobaixing duck from France (Zhou, 2002). They were crossed with Peking duck. Shaoxing duck was an egg-duck breed whose feather color, production performance, body size were different from Peking duck. Muscovy duck was another genera (Cairina moschata), and the form and biological characters were different from other duck populations. Therefore, it was clustered alone. The result was consistent with that of Yan et al. (2005).

In conclusion, our data suggested that 20 microsatellite loci could be used to investigate the genetic diversity and phylogenetic relationships among different duck populations.

Received June 30, 2007; Accepted November 26, 2007

REFERENCES

Ahlawat, S. P. S., R. K. Vijh, Bina Mishra, S. T. Bharani Kumar and M. S. Tantia. 2008. Genetic relationship in chicken breeds using molecular co-ancestry information. Asian-Aust. J. Anim. Sci. 21(1):6-10.

Aranguren-Mendez, J., M. Gomez and J. Jordana. 2002. Hierarchical analysis of genetic structure in Spanish donkey breeds using microsatellite markers. Heredity 89(3):207-211.

Botstein, D., R. L. White, M. Skolnick and R. W. Davis. 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. The American Journal of Human Genetics 32:314-331.

Chang, G. B., H. Chang, X. P. Liu, W. M. Zhao, D. J. Ji, Y. J. Mao, G. M. Song and X. K. Shi. 2007. Genetic diversity of wild quail in China ascertained with microsatellite DNA markers. Asian-Aust. J. Anim. Sci. 20(12):1783-1790.

Chen, G. H., X. S. Wu, D. Q. Wang, J. Qin, S. L. Wu, Q. L. Zhou, F. Xie, R. Cheng, Q. Xu, B. Liu, X. Y. Zhang and O. Olowofeso. 2004. Cluster analysis of 12 Chinese native chicken populations using microsatellite markers. Asian-Aust. J. Anim. Sci. 17(8):1047-1052.

Chen, H. J., Y. S. Yue, X. Z. Fan, CH. SH. Zhang and L. X. Du. 2003. Analysis of genetic diversity of Shandong indigenous chicken breeds using microsatellite markers. Acta Genetica Sinica. 30(9):855-860.

Chen, Y. X. and Z. H. Zuo. 2001. Study on genetic relationship and diversity in ducks by RAPD. Journal of Xiamen University (Natural Science) 40(1):141-145.

Huang, Y. H., J. F. Tu, X. B. Cheng, B. Tang, X. X. Hu, Z. L. Liu, J. D. Feng, Y. K. Lou, L. Lin, K. Xu, Y. L. Zhao and N. Li. 2005. Characterization of 35 novel microsatellite DNA markers from the duck (Anas platyrhynchos) genome and cross-amplification in others birds. Genet. Sel. Evol. 37:455-472.

Kong, H. S., J. D. Oh, J. H. Lee, K. J. Jo, B. D. Sang, C. H. Choi, S. D. Kim, S. J. Lee, S. H. Yeon, G. J. Jeon and H. K. Lee. 2006. Genetic variation and relationships of Korean native chickens and foreign breeds using 15 microsatellite markers. Asian-Aust. J. Anim. Sci. 19(11):1546-1550.

Liu, G. Q., X. P. Jiang, J. Y. Wang and Z. Y. Wang. 2006. Correlations between heterozygosity at microsatellite loci, mean d2 and body weight in a Chinese native chicken. AsianAust. J. Anim. Sci. 19(12):1671-1677.

Maak, S., K. Neumann, R. Gattermann and R. Gattermann. 2000. First seven microsatellites developed for the Peking duck (Anas platyrhynchos). Anim. Genet. 31:228-241.

Maak, S., K. Wimmers, S. Weigend and K. Neumann. 2003. Isolation and characterization of 18 microsatellites in the Peking duck (Anas platyrhynchos) and their application in other waterfowl species. Molecular Ecology Notes. 3:224-227.

Nei, M., F. Tajima and Y. Tateno. 1983. Accuracy of estimated phylogenetic trees from molecular data. J. Mol. Evol. 19:153-170.

Osman, S. A. M., M. Sekino, M. Nishibori, Y. Yamamoto and M. Tsudzuki. 2005. Genetic variability and relationship of native Japanese chicken assessed by microsatellite DNA profiling focusing on the breeds established in Kochi prefecture, Japan. Asian-Aust. J. Anim. Sci. 18(6):755-761.

Osman, S. A. M., M. Sekino, A. Nishihata, Y. Kobayashi, W. Takenaka, K. Kinoshita, T. Kuwayama, M. Nishibori, Y. Yamamoto and M. Tsudzuki. 2006. The genetic variability and relationships of Japanese and foreign chickens assessed by microsatellite DNA profiling. Asian-Aust. J. Anim. Sci. 19(10):1369-1378.

Ota, Y. 1993. DISPAN: Genetic distance and phylogenetic analysis. Pennsylvania State University. University Park, PA.

Romanov, M. N. and S. Weigend. 2001. Analysis of genetic relationships between various populations of domestic and jungle fowl using microsatellite markers. Poult. Sci. 80:1057-1063.

Sambrook, J., E. F. Fritsch, T. Maniatis, D. Y. Jin and M. F. Li. 1999. (Translation) Molecular Cloning-A Laboratory Mannual (2nd edition). Beijing: Science Press.

Saitou, N. and M. Nei. 1987. The neighbour-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425.

Stai and Hughes. 2003. Characterization of microsatellite loci in wild and domestic Muscovy ducks (Cairina moschata). Anim. Genet. 34(5):387-389.

Tang, Q. P., H. F. Li, Y. J. Tu, K. W. Chen, N. Yang, Y. H. Ma and D. W. Zhao. 2007. Analysis of genetic diversity of the domestic concern duck breeds in China. Journal of Northwest Sci-Tech University of Agriculture and Forestry 35(2):47-52.

Wang, J. Z., M. X. Chu, A. G. Wang, N. Li, J. L. Fu, F. Xie and G. H. Chen. 2004. Genetic relationships among seven sheep populations using four microsatellite markers. Hereditas. 26(5):637-643.

Wu, CH. X., G. H. Chen, D. Q. Wang, X. Y. Zhang, K. H. Wang, R. Chen, B. Liu, Q. Xu and Q. L. Zhou. 2004. Analysis of genetic diversity among Chinese native chicken breeds using microsatellite markers. Acta Genetica Sinica. 31(1):43-50.

Xiao, W. 2002. Study the genetic diversity of Chinese native pigs using blood protein polymorphism. China Agricultural University doctorate thesis.

Yan, F. H., ZH. H. Zuo, M. Chen, Y. Q. Song, L. J. Lu and Y. X. Chen. 2005. Analysis of genetic diversity and relationship among some Chinese domestic ducks and wild ducks using AFLP. Journal of Xiamen University (Natural Science). 44(5): 729-733.

Zhou, X. M. and G. Y. Chen. 2002. The technical manuals of efficient production duck. Shanghai, Shanghai Science and Technology Press. pp. 27-28.

Zuo, Z. H., Y. X. Chen and L. J. Lu. 2004. Studies on genetic diversity and molecular marker of Jinding duck. Journal of Xiamen Universit (Natural Science) 43(2):256-259.

Yan Wu (1, 2), Xiao-Lin Liu (2), *, Shui-Sheng Hou (1) and Wei Huang (1)

* Corresponding Author: Xiao-Lin Liu. Tel: +86-29-87092158, Fax: +86-29-87092164, E-mail: liuxiaolin@nwsuaf.edu.cn

(1) Institute of Animal Science, Chinese Academy of Agricultural Science, Beijing 100094, China

(2) College of Animal Science and Technology, Northwest A & F University, Yanglling Shaanxi 712100, China.
Table 1. Microsatellite primer sequences and snnealing temperature
([degrees]C)

                                       Annealing
                                      temperature     Allele
Locus      Primer sequence            ([degrees]C)   size (bp)

AJ272577   CACTTGCTCTTCACTTTCTTT           55         192-212
           GTATGACAGCAGACACGGTAA
AJ272578   AACCAAGACAGAATAATCCTTA          52         198-218
           GAACACAACTGCTTTGCTA
AJ272579   ACATCTTTGGCATTTTGAA             57         204-278
           CATCCACTAGAACACAGACATT
AJ272580   GGATGTTGCCCCACATATTT            57          82-138
           TTGCCTTGTTTATGAGCCATTA
AJ272581   ATTAGAGCAGGAGTTAGGAGAC          53         120-168
           GCAAGAAGTGGCTTTTTTC
AJ272582   GGACCTCAGGAAAATCAGTGTA          56         192-230
           GCAGGCAGAGCAGGAAATA
AJ272583   GAATAAAGTAACGGGCTTCTCT          52         154-182
           CTGCTTGGTTTTGGAAAGT
AJ515883   CACACGCGCAGCAGAGGA              55          86-130
           GTCGTCAGCCAGGGGTTTGAG
AJ515884   CCTCGGTATTGTTTTCCAT             63         152-230
           GCTCTGAAGGGCATTATTTAG
AJ515887   AAAGCCCTGTGAAGCGAGCTA           54          78-124
           TGTGTGTGCATCTGGGTGTGT
AJ515889   CAACGAGTGACAATGATAAA            53         174-212
           CAATGATCTCACTCCCAATAG
AJ515890   TGAATATGCGTGGCTGAA              62         178-198
           CAGTGAGGAATGTGTTTGAGTT
AJ515891   CCTTCTGAACCTTCGTAG              53         132-180
           AAATATAGACTTTTGTCCTGAA
AJ515893   TTCTGGCCTGATAGGTATGAG           55         216-272
           GAATTGGGTGGTTCATACTGT
AJ515895   ACCAGCCTAGCAAGCACTGT            56         124-156
           GAGGCTTTAGGAGAGATTGAAAAA
AJ515896   CTTAAAGCAAAGCGCACGTC            58         118-158
           AGATGCCCAAAGTCTGTGCT
AJ515897   GTTATCTCCCACTGCACACG            59         114-198
           CGACAGGAGCAAGCTGGAG
AJ515898   TCCTCTGCTCTAGTTGTGATGG          62         160-212
           CCTCAGCAGTCTTCCTCAGTG
AJ515899   TCAACCAGTGGTCAGAGAAAAA          57         118-184
           AGGTCAGCCCCCATTTTAGT
AJ515900   CCGTCAGACTGTAGGGAAGG            58         146-202
           AAAGCTCCACAGAGGCAAAG

Table 2. The PIC of 20 microsatellite sites in different duck
populations

Locus       Shaoxing    Muscovy     Peking Z4   Cherry Valley

AJ272577    0.6294      0.7742      0.8337      0.6866
AJ272578    0.7627      0.8024      0.8112      0.8512
AJ272579    0.6839      0.6735      0.8278      0.5691
AJ272580    0.8362      0.8498      0.7378      0.7854
AJ272581    0.6651      0.7175      0.4559      0.7471
AJ272582    0.7448      0.9111      0.8228      0.6863
AJ272583    0.6204      0.7614      0.7432      0.6699
AJ515883    0.911       0.8859      0.7154      0.8178
AJ515884    0.828       0.8499      0.7411      0.6684
AJ515887    0.7309      0.7752      0.776       0.7661
AJ515889    0.8326      0.8046      0.8453      0.8229
AJ515890    0.7872      0.7818      0.5711      0.8297
AJ515891    0.7949      0.8707      0.7128      0.6933
AJ515893    0.8296      0.8057      0.8633      0.8027
AJ515895    0.8597      0.847       0.872       0.8703
AJ515896    0.6584      0           0.6831      0.7666
AJ515897    0.7741      0.8168      0.8963      0.8428
AJ515898    0.8582      0.744       0.8399      0.6826
AJ515899    0.8446      0.7408      0.7527      0.8009
AJ515900    0.8147      0.7534      0.6864      0.6444
Mean        0.7733      0.7583      0.7594      0.7502

Locus       Aobaixing   Peking Z1   Mean

AJ272577    0.6649      0.6881      0.7128
AJ272578    0.8412      0.8759      0.8241
AJ272579    0.6989      0.822       0.7125
AJ272580    0.6761      0.86        0.7909
AJ272581    0.5275      0.6712      0.6307
AJ272582    0.7462      0.8259      0.7895
AJ272583    0.8014      0.6038      0.7
AJ515883    0.8674      0.9515      0.8582
AJ515884    0.8229      0.8336      0.7907
AJ515887    0.6929      0.726       0.7445
AJ515889    0.746       0.8386      0.815
AJ515890    0.5726      0.675       0.7029
AJ515891    0.7485      0.6257      0.741
AJ515893    0.8459      0.8175      0.8275
AJ515895    0.886       0.8988      0.8723
AJ515896    0.6794      0.793       0.5968
AJ515897    0.873       0.8556      0.8431
AJ515898    0.849       0.8576      0.8052
AJ515899    0.721       0.8502      0.785
AJ515900    0.6963      0.5909      0.6977
Mean        0.7479      0.783       0.762

Table 3. The heterozygosity of 20 microsatellite sites in
different duck populations

Locus      Shaoxing    Muscovy     Peking Z4   Cherry Valley

AJ272577   0.6799      0.7893      0.8392      0.7231
AJ272578   0.781       0.815       0.8218      0.8556
AJ272579   0.7188      0.6757      0.8297      0.5924
AJ272580   0.8416      0.8509      0.7388      0.7856
AJ272581   0.7025      0.7373      0.5279      0.7588
AJ272582   0.7681      0.9118      0.8316      0.7198
AJ272583   0.6701      0.7823      0.7625      0.7062
AJ515883   0.9123      0.8894      0.7426      0.8252
AJ515884   0.8364      0.8552      0.763       0.7079
AJ515887   0.7435      0.7836      0.7932      0.7734
AJ515889   0.8407      0.8181      0.8505      0.8327
AJ515890   0.8022      0.7986      0.6239      0.8383
AJ515891   0.8031      0.8731      0.7424      0.7245
AJ515893   0.8364      0.8148      0.8678      0.8146
AJ515895   0.8647      0.8523      0.8755      0.8747
AJ515896   0.6997      0           0.7197      0.7868
AJ515897   0.7769      0.8268      0.8978      0.8474
AJ515898   0.8597      0.7622      0.846       0.701
AJ515899   0.8474      0.7512      0.7626      0.8114
AJ515900   0.8247      0.7618      0.7229      0.6862
Mean       0.7905      0.8079      0.778       0.7683

Locus      Aobaixing   Peking Z1   Mean

AJ272577   0.689       0.7072      0.738
AJ272578   0.8483      0.879       0.8335
AJ272579   0.7066      0.8294      0.7254
AJ272580   0.68        0.8625      0.7932
AJ272581   0.5886      0.6923      0.6679
AJ272582   0.7651      0.8355      0.8053
AJ272583   0.8119      0.6597      0.7321
AJ515883   0.8712      0.881       0.8536
AJ515884   0.8316      0.8405      0.8058
AJ515887   0.7274      0.752       0.7622
AJ515889   0.766       0.8472      0.8259
AJ515890   0.6153      0.7118      0.7317
AJ515891   0.7702      0.6687      0.7637
AJ515893   0.85        0.8276      0.8352
AJ515895   0.8881      0.9004      0.876
AJ515896   0.716       0.8047      0.6212
AJ515897   0.8751      0.861       0.8475
AJ515898   0.8521      0.8616      0.8138
AJ515899   0.7257      0.8565      0.7925
AJ515900   0.7291      0.6289      0.7256
Mean       0.7654      0.7954      0.7843

Table 4. The effective number of alleles of 20 microsatellite
loci in different duck populations

Locus       Shaoxing    Muscovy     Peking Z4   Cherry Valley

AJ272577    3.1243      4.7451      6.2189      3.6109
AJ272578    4.566       5.4051      5.6117      6.9264
AJ272579    3.5556      3.0833      5.8716      2.4534
AJ272580    6.3116      6.7086      3.828       4.6651
AJ272581    3.361       3.8073      2.1182      4.1456
AJ272582    4.3131      11.3441     5.9387      3.569
AJ272583    3.0316      4.5937      4.21        3.4034
AJ515883    11.407      9.0427      3.8853      5.7203
AJ515884    6.1114      6.9041      4.2194      3.4239
AJ515887    3.8985      4.6201      4.8356      4.4136
AJ515889    6.2791      5.498       6.6872      5.9774
AJ515890    5.0549      4.9641      2.6589      6.1839
AJ515891    5.0782      7.8808      3.8822      3.6296
AJ515893    6.1107      5.401       7.5622      5.3944
AJ515895    7.3893      6.7712      8.0301      7.9819
AJ515896    3.3295      0           3.5676      4.6915
AJ515897    4.4831      5.7752      9.78        6.5549
AJ515898    7.1258      4.2056      6.4935      3.3444
AJ515899    6.5548      4.019       4.2123      5.3022
AJ515900    5.7035      4.1984      3.6085      3.1865
Mean        5.3394      5.7351      5.161       4.7289

Locus       Aobaixing   Peking Z1   Mean

AJ272577    3.2158      3.4154      4.0551
AJ272578    6.594       8.2645      6.228
AJ272579    3.4079      5.8613      4.0389
AJ272580    3.125       7.2711      5.3182
AJ272581    2.4308      3.2496      3.1854
AJ272582    4.2563      6.0805      5.917
AJ272583    5.3166      2.9389      3.9157
AJ515883    7.7645      8.4034      7.7039
AJ515884    5.9381      6.2694      5.4777
AJ515887    3.6684      4.0323      4.2448
AJ515889    4.2727      6.5455      5.8767
AJ515890    2.5995      3.4699      4.1552
AJ515891    4.3513      3.018       4.64
AJ515893    6.6646      5.8005      6.1556
AJ515895    8.9404      10.0409     8.1923
AJ515896    3.5217      5.1194      3.3716
AJ515897    8.0043      7.1954      6.9655
AJ515898    6.7604      7.2254      5.8592
AJ515899    3.6454      6.9695      5.1172
AJ515900    3.6909      2.6947      3.8471
Mean        4.9084      5.6933      5.261

Table 5. The test of HDW with [chi square] based on genotype
frequency of 20 microsatellites

                    Shaoxing                 Muscovy
Locus
             [chi square]     P       [chi square]     P

AJ272577        184.5862    0.0000       257.6276     0.0000
AJ272578        216.0555    0.0000       106.5886     0.0000
AJ272579        211.6453    0.0000       236.4039     0.0000
AJ272580        120.6654    0.0204       153.7299     0.0000
AJ272581         31.1652    0.0000       120.3796     0.0000
AJ272582        421.9551    0.0000       207.6931     0.0000
AJ272583        319.2170    0.0000       467.0140     0.0000
AJ515883        242.8270    0.0000       247.4830     0.0000
AJ515884        243.6624    0.0000       388.6876     0.0000
AJ515887        207.2695    0.0000        86.5307     0.0000
AJ515889        500.8848    0.0000       357.6970     0.0000
AJ515890        582.7834    0.0000       302.1075     0.0000
AJ515891        257.3773    0.0000       268.4272     0.0000
AJ515893        280.8617    0.0000       414.3798     0.0000
AJ515895        496.1704    0.0000       510.1399     0.0000
AJ515896         60.8402    0.0000         0.0000     1.0000
AJ515897        346.9879    0.0000       513.2889     0.0000
AJ515898        213.0434    0.0000       412.1290     0.0000
AJ515899        140.3411    0.0000       177.5165     0.0000
AJ515900        218.0968    0.0000        58.8103     0.0000

                     Z4 Peking             Cherry Valley
Locus
             [chi square]     P       [chi square]     P

AJ272577        632.6807    0.0000       349.9426     0.0000
AJ272578        147.4315    0.0000       254.8510     0.0000
AJ272579        230.7519    0.0000       288.6522     0.0000
AJ272580        116.0988    0.0000       197.5029     0.0399
AJ272581         95.2750    0.0000        67.1336     0.0000
AJ272582        381.3644    0.0000       472.5614     0.0000
AJ272583        291.0276    0.0000       243.6853     0.0000
AJ515883        141.3094    0.0000       345.1009     0.0000
AJ515884        146.5361    0.0000        80.5982     0.0000
AJ515887        170.6410    0.0000       158.0745     0.0000
AJ515889        274.2641    0.0000       336.3496     0.0000
AJ515890        296.4126    0.0000       376.4749     0.0000
AJ515891        119.9236    0.0000        88.3250     0.0000
AJ515893        421.3526    0.0000       255.3971     0.0000
AJ515895        540.1436    0.0000       630.4136     0.0000
AJ515896         47.2842    0.0479        41.5354     0.0003
AJ515897        259.9107    0.0000       162.0440     0.0000
AJ515898        170.6788    0.0000       314.3946     0.0000
AJ515899        115.5519    0.0000       342.0581     0.0000
AJ515900        165.0098    0.0000       226.5652     0.0000

                     Aobaixing                 ZI Peking
Locus
             [chi square]     P       [chi square]     P

AJ272577        265.9475    0.0000       349.9426     0.0000
AJ272578        139.4438    0.0000       254.8510     0.0000
AJ272579        145.6790    0.0000       288.6522     0.0000
AJ272580         74.8153    0.0000       197.5029     0.0000
AJ272581         40.7011    0.0061        67.1336     0.0000
AJ272582        296.4712    0.0000       472.5614     0.0000
AJ272583        467.8052    0.0000       243.6853     0.0000
AJ515883        331.3248    0.0000       345.1009     0.0000
AJ515884        322.0963    0.0000        80.5982     0.0000
AJ515887        187.4259    0.0000       158.0745     0.0000
AJ515889        348.1417    0.0000       336.3496     0.0000
AJ515890        237.7415    0.0000       376.4749     0.0000
AJ515891        198.6415    0.0000        88.3250     0.0000
AJ515893        307.8604    0.0000       255.3971     0.0000
AJ515895        512.5489    0.0000       630.4136     0.0000
AJ515896         45.3371    0.0016        41.5354     0.0479
AJ515897        164.1017    0.0000       162.0440     0.0000
AJ515898        164.5541    0.0000       314.3946     0.0000
AJ515899        218.5469    0.0000       342.0581     0.0000
AJ515900        111.1092    0.0000       226.5652     0.0000

Table 6. F-statistic analysis

Locus         [F.sub.IS]   [F.sub.IT]   [F.sub.ST] ([G.sub.ST])

AJ272577        0.9025       0.9109             0.0868
AJ272578        0.5853       0.6039             0.0449
AJ272579        0.7307       0.7778             0.1748
AJ272580       -0.0456       0.0505             0.0919
AJ272581        0.3360       0.4810             0.2185
AJ272582        0.8673       0.8767             0.0707
AJ272583        0.9644       0.9676             0.0882
AJ515883        0.5229       0.5520             0.0610
AJ515884        0.6171       0.6570             0.1043
AJ515887        0.6171       0.6532             0.0929
AJ515889        0.7950       0.8040             0.0443
AJ515890        1.0000       1.0000             0.0735
AJ515891        0.7764       0.7906             0.0635
AJ515893        0.8279       0.8337             0.0337
AJ515895        0.9192       0.9209             0.0205
AJ515896        0.3187       0.4930             0.2558
AJ515897        0.5448       0.5742             0.0646
AJ515898        0.1319       0.2179             0.0991
AJ515899        0.7043       0.7339             0.1003
AJ515900        0.7708       0.7948             0.1047
Mean            0.6477       0.6807             0.0936

Table 7. [D.sub.A] genetic distances among populations

                      Shaoxing    Muscovy     Peking Z4   Cherry
                                                          Valley

Shaoxing duck         0
Moscovy duck          0.381       0
Peking Z4             0.3046      0.4558      0
Cherry Valley duck    0.1839      0.4039      0.2572      0
Aobaixing duck        0.2824      0.4477      0.2102      0.2534
Peking Z1             0.1947      0.4338      0.2558      0.197

                      Aobaixing   Peking Z1

Shaoxing duck
Moscovy duck
Peking Z4
Cherry Valley duck
Aobaixing duck        0
Peking Z1             0.2463      0
Gale Copyright: Copyright 2008 Gale, Cengage Learning. All rights reserved.