Single plex branched DNA as an alternative assay to quantify p53-like mRNA levels in softshell clam Mya arenaria hemocytes.
Subject: Biotechnology industry (Analysis)
Genetic transcription (Analysis)
Tumor proteins (Analysis)
Messenger RNA (Analysis)
Anopheles (Analysis)
DNA (Analysis)
Authors: Siah, Ahmed
McKenna, P.
Johnson, G.
Berthe, F.C.J.
Pub Date: 08/01/2012
Publication: Name: Journal of Shellfish Research Publisher: National Shellfisheries Association, Inc. Audience: Academic Format: Magazine/Journal Subject: Biological sciences; Zoology and wildlife conservation Copyright: COPYRIGHT 2012 National Shellfisheries Association, Inc. ISSN: 0730-8000
Issue: Date: August, 2012 Source Volume: 31 Source Issue: 3
Topic: Canadian Subject Form: Tumour proteins
Product: Product Code: 2831812 Deoxyribonucleic Acid NAICS Code: 325414 Biological Product (except Diagnostic) Manufacturing SIC Code: 8731 Commercial physical research; 8733 Noncommercial research organizations
Organization: Company Name: Affymetrix Inc. Ticker Symbol: AFFX
Geographic: Geographic Scope: United States; Prince Edward Island; Canada Geographic Code: 1CPRI Prince Edward Island; 1CANA Canada
Accession Number: 303011392
Full Text: ABSTRACT Previous studies have shown that hemic neoplasia in softshell clams is related to the level of p53-like mRNA in hemocytes. Traditionally, the p53-like mRNA level has been quantified using quantitative real-time RT-PCR (Q RT-PCR). However, this technique requires several steps that are sources of contamination and may result in a low accuracy of the analysis. The novel aspect of this study is that the p53-like mRNA level was quantified directly from a lysate of hemocytes without any RNA extraction or reverse transcription steps. This assay is based on branched DNA (bDNA) signal amplification technology and enables quantification of p53-like mRNA levels in as few as 2,500 hemocytes, with a coefficient of variation close to 6% (range, 2-12%). A significant correlation ([R.sup.2] = 0.99, P [less than or equal to] 0.01, n = 5) was found between the p53-like mRNA quantified directly from hemocytes without RNA extraction and from 1 [micro]g total RNA extracted from hemocytes using the classic TRIzol protocol. To compare p53-like mRNA levels in hemocytes from diseased clams collected in North River (Prince Edward Island, Canada) and from healthy clams found in Havre aux Maisons at Magdalene Island (Quebec, Canada), the quantification of relative p53-like mRNA levels was performed using our single plex assay. Data showed a significantly (P [less than or equal to] 0.01, n = 5) high expression of p53-like in the hemocytes of clams collected from North River. Therefore, although Q RT-PCR remains the most widely used technique for the quantification of gene expression level, we believe that single plex using bDNA technology could represent a new generation of mRNA quantification tool, enabling a more efficient mollusc health management.

KEY WORDS: Mya arenaria, hemocytes, bDNA, single plex, p53-like mRNA, disseminated neoplasia

INTRODUCTION

The softshell clam Mya arenaria is susceptible to develop disseminated neoplasia, a condition believed to be responsible for high mortality records in Prince Edward Island in 1999 (McGladdery et al. 2001). Traditionally, neoplastic hemocytes are diagnosed based on their atypical morphology, characterized by a rounded shape and no or fewer filopodia (Moore et al. 1992). Hemocytes with disseminated neoplasia are principally characterized by a high number of circulating hemocytes containing pleomorphic nuclei with a high nucleus-to-cytoplasm ratio (Elston et al. 1992, Barber 2004), as well as a loss of their phagocytic ability (Beckmann et al. 1992). In addition, neoplastic cells can be diagnosed through the observation of their proliferative nature, and modifcation of their ploidy status as a reliable proxy of hemic neoplasia (Reno et al. 1994, Delaporte et al. 2008).

Our previous study has shown that the p53-like gene expression level was higher in some hemocytes with tetraploid status ranging between 15% and 50%, thus postulating that these organisms will become diseased (Siah et al. 2008). Described as a "guardian" of the human genome, p53 acts as a regulator of the integrity of the genome during the cell cycle (Hofseth et al. 2004). Under abnormal conditions of cell cycle proliferation--for instance, genotoxic stress--p53 gene expression is upregulated to stop the abnormal cell cycle progression or to direct the abnormal cells toward apoptosis (Toledo & Wahl 2006). A homolog for human p53-like has previously been cloned and characterized in M. arenaria (Kelley et al. 2001). Recently, it was pointed out that all the isoforms of p53-like family sequences identified in molluscs are from the same origin p63 gene (Stifanic et al. 2009). In this study, the target transcript (accession no. AF253323) could represent different isoforms of p53-like expressed sequences, such as p53/p63/p73 identified in softshell clams. The p53-like protein in M. arenaria is characterized by DNA binding domain II-V, a transactivation domain, and a tetramerization domain highly conserved with those of the human p53 protein. This suggests that the molecular mechanisms regulating the transcription of M. arenariap53-like gene are similar to those involved in human p53 gene expression (Kelley et al. 2001).

Quantification of target mRNA levels in clam hemocytes is currently conducted by quantitative real-time (Q) reverse-transcriptase (RT) polymerase chain reaction (PCR) (Siah et al. 2008). This technology requires several steps prior to analysis. The first step is the extraction of total RNA or mRNA from biological samples. This step is critical because the extract should be devoid of any DNA contamination and PCR inhibitors, and should be protected against RNases, the source of RNA degradation. To increase the purity and integrity of RNA extract, further steps of purification using DNAse and columns are needed to avoid any contamination of DNA and protein residues. However, it is well known that some residual compounds such as organic substances (phenol, ethanol, proteins) and salts are still present in the final extract and may affect the subsequent steps of RT and PCR processes (Tichopad et al. 2004). The second step, which is the reverse transcription of mRNA into cDNA, requires primers and RT enzyme activity, cDNA synthesis could be carried out using different primers, such as random hexamer, oligo-dT, or specific primers. Depending on primer design, the efficiency of the RT step can be affected. Indeed, specific primers decrease the background by the undesired target whereas random primers and oligo-dT increase the probability to amplify the small quantities of the target transcript (Schwabe et al. 2000). The third step includes the PCR processes characterized by their exponential amplification of the target template. The PCR processes are influenced greatly by the small quantities of the starting template, the specificity of the primers, and the temperature parameters enabling the primers to hybridize to the target (Zhang et al. 2005).

Although real-time Q RT-PCR is currently widely used as a frontline technology for quantification of low copies of target gene expression, contaminations in RNA extraction, potential bias caused by RT, and inherent variation in thermal cycling conditions during the PCR step are believed to be sources of inaccurate analysis (Tichopad et al. 2004). Bearing this in mind, a technology displaying a quantification of transcript specifically avoiding RNA extraction and enzymatic steps might be more robust and less time-consuming.

Alternatively, a technology based on branched DNA (bDNA) was developed by Bayer (Tsongalis 2006). This technique is based on the principle of sandwich hybridization of transcripts of interest and amplification of the signal using multiple bDNA. Instead of amplifying the mRNA target, bDNA amplify the signal. In this case, no RNA extraction or purification is required, thus decreasing the number of manipulation steps. Indeed, the samples are lysed using a lysis buffer that allows the release and stabilization of the RNA. The lysis step is followed by a hybridization step that enables the target transcript to hybridize to the panel of probe sets. Signal amplification is achieved using bDNA technology, and the detection step uses streptavidin phycoerythrin (or SAPE) biochemistry, thus enabling a signal detection proportional to the amount of the target transcript (Tsongalis 2006). By measuring mRNA target directly from cell lysates, all reverse transcription steps are avoided, thus increasing the accuracy of the assay (Yang et al. 2001). bDNA technology is currently used as a diagnostic tool for HIV and hepatitis B virus detection (Gleaves et al. 2002, Yao et al. 2004, Sarrazin et al. 2006).

In this study, the development of bDNA signal amplification technology for a direct quantification of p53-like gene expression (as a potential marker of heroic neoplasia) in M. arenaria hemocyte lysates was investigated. This method was used to compare the p53-like gene expression level in clams sampled in a pristine site (Havre aux Maisons, Magdalen Island, Quebec) and a site known to have a high prevalence of neoplastic clams (North River, Prince Edward Island).

MATERIALS AND METHODS

Sampling

Approximately 5-cm-long specimens of M. arenaria were collected at low tide with a hand rake at a depth of 15-20 cm in North River (46[degrees]15'01" N, 63[degrees]10'42" W; Charlottetown, Prince Edward Island, Canada), known as an endemic area for disseminated neoplasia, and Havre aux Maisons (47[degrees]25'29" N, 61[degrees]46'41" W; Magdalen Island, Quebec, Canada), where disseminated neoplasia has not been detected in softshell clams (Delaporte et al. 2008). After being washed with seawater, clams were transported to our aquatic facilities at the Atlantic Veterinary College (Charlottetown, Prince Edward Island, Canada). On arrival, animals were kept in tanks with static seawater at 18[degrees]C and a salinity of 28 for 2 days before analysis.

Single Plex bDNA Assay

Hemolymph (1 mL) of individual clams was withdrawn using a 3-mL syringe mounted with 25-gauge needles. To quantify the hemocytes, 10 [micro]L hemolymph was diluted 10 times by adding 90 [micro]L phosphate buffered saline, and hemocytes were quantified using a hemocytometer. Hemolymph samples were centrifuged at 500g for 15 min at 4[degrees]C. One volume (1 mL) of Lysis Mixture (QuantiGene 2.0 system; Affymetrix, Inc., CA) and 2 volumes (2 mL) of RNase-free water were added to the hemocyte pellets. Then, 1 [micro]L 50 [micro]g/[micro]L proteinase K/mL Lysis Mixture was added to the mixture to improve degradation of protean compounds. To raise the hemocyte lysis, the mixture was incubated at 37[degrees]C for 30 min. RNase-Free Water was used as a background for the analysis. Target p53-like (accession no. AF253323) and housekeeping 18S (accession no AF120560) gene probe sets (QuantiGene 2.0 system; Affymetrix, Inc.) containing 250 fmol/[micro]L, 1,000 fmol/[micro]L, and 500 fmol/[micro]L capture extender probe), blocking probe, and label extender probe, respectively, were added to the cell lysate. The mixture was then transferred to a capture well coated with capture probe. To quantify the 18S rRNA for the relative expression using single plex assay, the samples were diluted 2,000 times. Wells were incubated at 55[degrees]C for 16 h and washed 3 times with 300 [micro]L washing buffer. Two series of hybridizations at 55[degrees]C for 1 h with 100 [micro]L of a 1:1,000 dilution of bDNA amplifier and 100 [micro]L of 3'-alkaline phosphatase-conjugated Label Probe oligo (QuantiGene 2.0 system; Affymetrix, Inc.), respectively, were performed and followed by 3 washes with 300 [micro]L washing buffer after each incubation. To develop the amplified signal, the alkaline phosphatase substrate dioxetane (QuantiGene 2.0 system; Affymetrix, Inc.) was added to the wells and incubated at 50[degrees]C for 1 h. The signal was detected using a microtiter plate luminometer (Luminoskan Ascent; Thermo Fisher Scientific Corporation, MA).

Real- Time Quantitative Reverse Transcription-Polymerase Chain Reaction

The analysis of gene expression in the hemocytes of M. arenaria collected from Havre aux Maisons was performed by real-time quantitative PCR using SYBR Green I. Total RNAs were extracted from hemocytes using TRIzol Reagent (Sigma), treated with DNaseI (Sigma), and quality was analyzed on denaturing agarose gel (1.2% agarose, 2.1 M formaldehyde in 1x MOPS, ethidium bromide 0.5 [micro]g/mg). The quality of the RNA was visualized under UV light by fluorescence of ethidium bromide.

RNA concentrations were measured with a Nanodrop (ND 1000) spectrophotometer. First-strand synthesis was carried out in a 20-[micro]L reaction mixture containing 1 [micro]g total RNA, and the reaction was performed using the SuperScript III Platinum Two-Step Q RT-PCR Kit according to the manufacturer's protocol (Invitrogen). PCR amplifications were then performed on 1 [micro]L cDNA template using SYBR Green Supermix (total reaction volume, 25 [micro]L). Primer concentration was 0.4 [micro]M for both forward and reverse primers. Based on the published sequences (Barker et al. 1997), the forward 5'ACACAAATCG ACAGTCAGTGCTCATT3' and reverse 5'TCCCAGTACTTGA TTGTCTTT3' primers for p53-like mRNA and the forward 5'AGACTCCGGGAAACCAAAGT3' and reverse 5'AGACAA ATCGCTCCACCAAC3' primers for 18S ribosomal RNA were synthesized by Invitrogen Corporation (Burlington, ON, Canada). The 18S was used as a housekeeping gene to normalize the data. Real-time PCR was performed using the RotorGene system. The cycling conditions were as follows: 10 min at 95[degrees]C, followed by 40 cycles (20 sec at 95[degrees]C, 20 sec at 55[degrees]C, and 20 sec at 72[degrees]C). Melting curves were also plotted (60-95[degrees]C) to ensure that a single PCR product was amplified. To estimate the efficiency, a standard curve was constructed for each run using a 10-fold dilution of the cloned amplicons, which was generated using the TOPO TA cloning kit (Invitrogen, CA) according to the manufacturer's recommendations.

Data Analysis

Signals obtained from wells without target gene expression were subtracted as background signals from the signals detected from wells containing samples with p53-like transcripts. The limit of detection was determined as the signal detected in the presence of p53-like mRNA 3 times higher than the background signal. The software SigmaStat (San Jose, CA) was used to determine the regression analysis, which was carried out to identify the relationship between quantification of p53-like gene expression in clam hemocytes (n = 5) using Q RT-PCR and the single plex bDNA assay. The results of relative p53-like gene expression from hemocytes sampled at North River and Havre aux Maisons are presented as a mean [+ or -] SE. Student's t-test was used as a statistical test to compare the 2 groups.

RESULTS

For assay development, a 2-fold serial dilution was performed directly on hemocytes collected from the withdrawn hemolymph of M. arenaria. The data were compared with those generated using total RNA extracted from hemocytes. Last, data generated from both assays (Q RT-PCR and bDNA) were compared using 5 different samples of extracted total RNA.

Sensitivity of the Single Plex bDNA Assay Using Hemocytes

The number of hemocytes was quantified in collected hemolymph using a hemocytometer. An adequate volume of hemolymph was collected to perform the analysis, using 8 x [10.sup.4] hemocytes as a starting material. A 2-fold serial dilution of the number of hemocytes was performed to determine the analytical accuracy and sensitivity of the assay. The detected signal represented as relative light units (RLUs) is related proportionally ([R.sup.2] = 0.99, P < 0.01, n = 6) to the number of hemocytes (Fig. l). The assay allows the quantification of p53-like mRNA using as few as 2,500 hemocytes, which is represented by an RLU of 4.4; 8 x [10.sup.4] hemocytes represent a value of RLU of 135. The average coefficient of variation representing the data from 5 assays run in duplicate was 6% (range, 2-12%).

Correlation of the Single Plex bDNA Assay Using Hemocytes and Extracted RNA

The single plex bDNA was used to correlate the p53 mRNA signal detected directly from hemocytes and from extracted RNA samples. In this experiment, 4 x [10.sup.4] hemocytes were assessed directly, and the same number of hemocytes was used for RNA extraction. A correlation was performed between the quantification of p53-like from a 2-fold serial dilution of the number of hemocytes and from extracted RNA extracted using the TRIzol Reagent procedure (see Materials and Methods). The RLU is higher with RNA extracted from 4 x [10.sup.4] hemocytes (RLU = 93) than from lysed 4 x [10.sup.4] hemocytes (RLU = 68). Figure 2 shows a significant correlation ([R.sup.2] = 0.997, P < 0.01, n = 5) between the luminescence signal detected from RNA extract and from hemocyte lysate using a single plex assay (Fig. 2).

[FIGURE 1 OMITTED]

[FIGURE 2 OMITTED]

Correlation of the Single Plex bDNA Assay and Quantitative Real-Time RT-PCR Using Extracted RNA

To compare the quantification of p53-like in hemocytes, 5 samples were analyzed using the single plex assay from hemocyte lysate, and real-time Q RT-PCR was performed with SYBR Green as a dye. Based on our previous studies, [10.sup.6] hemocytes represent an average of 1 [micro]g total extracted RNA (Siah et al. 2008). In this experiment, 1 [micro]g total extracted RNA for Q RT-PCR and [10.sup.6] hemocytes for the single plex bDNA assay were used from the same sample. For Q RT-PCR, to ensure the amplification of 1 specific target, the melting curve was analyzed and only 1 unique peak was observed. In addition, a standard curve using a cloned p53 amplicon was used to estimate the efficiency, which ranged from 86 to 90%. To measure the 18S rRNA level using single plex bDNA, the samples were diluted 2,000 times because of the high level of 18S rRNA in the cells. The data represent the p53 mRNA level relative to the housekeeping gene 18S rRNA. Figure 3 shows a significant correlation ([R.sup.2] = 0.99, P < 0.01, n = 5) between the 2 procedures used to quantify relative gene expression in hemocytes from the softshell clam M. arenaria.

Comparison of p53-Like Transcript Levels in Hemocytes from Softshell Clams Sampled in Havre aux Maisons and North River

The relative p53-like gene expression level was determined using the single plex assay directly from the hemocytes (2 x [10.sup.5] cells) of clams collected in Havre aux Maisons (n = 5) and North River (n = 5). The relative p53-like gene expression was evaluated using 18S rRNA as a housekeeping gene.

Data showed that relative gene expression of p53-like is 2.5 times as high (P [less than or equal to] 0.05) in hemocytes from North River clams as in those collected at Havre aux Maisons (Fig. 4).

DISCUSSION

Previously, the relative quantification of the p53-like gene expression level has been performed using Q RT-PCR in neoplastic hemocytes of the softshell clam M. arenaria (Bottger et al. 2008, Siah et al. 2008). In the current study, we describe an assay used to quantify the level of expression of p53-like mRNA directly from hemocytes. It is believed that this technology will enable an alternative, simple assay to quantify the relative level of messenger as a potential marker of hemic neoplastic hemocytes in M. arenaria.

[FIGURE 3 OMITTED]

[FIGURE 4 OMITTED]

The single plex bDNA assay quantifies p53-like transcript directly from hemocytes without any RNA extraction, purification, or reverse-transcription steps. Luminescence is detected in RLUs and is related proportionally to the quantity of p53-like mRNA contained in hemocytes. A significant correlation was found between the level of p53-like mRNA quantified from hemocytes and total RNA extracted from hemocytes using TRIzol Reagent (Sigma). The level of p53-like mRNA was higher using extracted total RNA (RLU = 98) than when using lysed hemocytes (RLU = 63; Fig. 2). This difference could be explained by the complexity of the starting material (hemolymph) in comparison with the pure extracted RNA samples. Although the sensitivity of the assay is better using total RNA, the quantification of p53-like mRNA using hemocytes is in the same range as when using extracted RNA (Fig. 2).

In addition, our data showed that the quantification of p53-like mRNA directly from hemocytes using the single plex bDNA assay correlates significantly with the procedure of p53-like mRNA quantification using standard Q RT-PCR with SYBR Green as a dye (Fig. 3). The data showed a good correlation for the samples with high, intermediate, and low levels of p53-like mRNA. However, it is important to highlight that the level of 18S rRNA is high in the cells; thus, a dilution of the samples should be carried out to quantify 18S rRNA in the dynamic range of the assay. In our case, the samples were diluted 2,000 times so that 18S rRNA could be quantified in the dynamic range using the single plex bDNA assay. Using 18S rRNA as a housekeeping gene could be a limitation of the assay. In this case, alternative housekeeping genes with expression levels in the same dynamic range as the target gene could be chosen as suitable for the single plex bDNA assay.

Indeed, the simplicity of the analysis using the single plex bDNA assay by eliminating RNA extraction and reverse transcription steps will avoid risks of contamination between samples and RNA degradation (Dunbar 2006). Our analysis on softshell clam hemocytes demonstrates that this assay could be applicable to quantify transcript level similar to the use of real-time Q RT-PCR. Single plex bDNA has been widely used in biomedical sciences as an alternative tool to Q RT-PCR to quantify the level of biomarker gene expression in cancer cases (Sakamoto et al. 2003).

Using flow cytometry as a procedure to diagnose heroic neoplasia, Delaporte et al. (2008) showed that while the clam population from Havre aux Maisons in the Magdalene Islands (Quebec) is healthy, the population from North River in Prince Edward Island is affected by disseminated neoplasia. Furthermore, our previous work has shown that an upregulated p53-like gene expression could be used as an indicator of active transformation of the hemocytes toward hemic neoplasia (Stifanic et al. 2009). Using single plex assay, p53-like gene expression was evaluated in hemocytes from clams collected in Havre aux Maisons in the Magdalene Islands (Quebec) and North River in Prince Edward Island (Fig. 4). 18S rRNA was chosen as a housekeeping gene based on our previous studies on hemic neoplasia in softshell clams (Siah et al. 2008). In the current study, our results show that p53-like gene expression level was significantly higher (2.5 times) in clams collected from North River than in those from Havre aux Maisons. The difference in level of p53 mRNA is similar to the one found between neoplastic hemocytes and normal hemocytes (Siah et al. 2008). However, further studies should be undertaken to understand the link between the increase of p53-like gene expression by 2.5-3 times and the development of the disease in hemocytes of softshell clams.

CONCLUSION

Because of its high reproducibility and sensitivity, Q RT-PCR is commonly used and has become a "go-to" technology to quantify gene expression level. However, one limitation of Q RT-PCR is the high level of variation caused by RNA extraction steps (Freeman et al. 1999) and the reverse transcription procedure (Zhang & Byrne 1999). To avoid all these intermediate procedures and prevent contamination and/or degradation of target gene expression, a new approach known as the bDNA assay was developed. This novel technology is increasingly used in biomedical science as a diagnostic tool (Chen et al. 2000, Yang et al. 2001, Zhang et al. 2005, Flagella et al. 2006).

Our bDNA assay could be used as a single plex to detect and quantify one specific transcript, but it could also be used as an array platform to measure up to 100 different target transcripts in one unique sample as a multiplex assay (Dunbar 2006). For bivalve molluscs like the softshell clam M. arenaria, whose genome is poorly described, this novel array technology opens promising avenues to detecting and quantifying gene expression level.

ACKNOWLEDGMENTS

We sincerely acknowledge Garth Arsenault and Dr. Jeff Davidson for their valuable support to this study. This project was supported by NSERC AquaNet, the Canada Research Chairs (CRC) program, the Atlantic Canada Opportunities Agency (ACOA), and the Canada Foundation for Innovation (CFI).

LITERATURE CITED

Barber, B. J. 2004. Neoplastic diseases of commercially important marine bivalves. Aquat. Living Resour. 17:449-466.

Barker, C. M., R. J. Calvert, C. W. Walker & C. L. Reinisch. 1997. Detection of mutant p53 in clam leukemia cells. Exp. Cell Res. 232:240-245.

Beckmann, N., M. P. Morse & C. M. Moore. 1992. Comparative study of phagocytosis in normal and diseased hemocytes of the bivalve mollusc Mya arenaria. J. Invertebr. Pathol. 59:124-132.

Bottger, S., E. Jerszyk, B. Low & C. Walker. 2008. Genotoxic stress-induced expression of p53 and apoptosis in leukemic clam hemocytes with cytoplasmically sequestered p53. Cancer Res. 68:777-782.

Chen, J., M. A. Iannone, M. S. Li, J. D. Taylor, P. Rivers, A. J. Nelsen, K. A. Slentz-Kesler, A. Roses & M. P. Weiner. 2000. A microsphere-based assay for multiplexed single nucleotide polymorphism analysis using single base chain extension. Genome Res. 10:549-557.

Delaporte, M., S. Synard, J. Pariseau, P. McKenna, R. Tremblay, J. Davidson & F. C. J. Berthe. 2008. Assessment of hemic neoplasia in different soft shell clam Mya arenaria populations from eastern Canada by flow cytometry. J. Invertebr. Pathol. 98:190-197.

Dunbar, S. A. 2006. Applications of Luminex [R] xMAP [TM] technology for rapid, high-throughput multiplexed nucleic acid detection. Clin. Chim. Acta 363:71-82.

Elston, R. A., J. D. Moore & K. Brooks. 1992. Disseminated neoplasia of bivalve molluscs. Rev. Aquat. Sci. 6:405-466.

Flagella, M., S. Bui, Z. Zheng, C. T. Nguyen, A. Zhang, L. Pastor, Y. Ma, W. Yang, K. L. Crawford, G. K. McMaster, F. Witney & Y. Luo. 2006. A multiplex branched DNA assay for parallel quantitative gene expression profiling. Anal. Biochem. 352:50-60.

Freeman, W. M., S. J. Walker & K. E. Vrana. 1999. Quantitative RT-PCR: pitfalls and potential. Biotechniques 26:112-124.

Gleaves, C. A., J. Welle, M. Campbell, T. Elbeik, V. Ng, P. E. Taylor, K. Kuramoto, S. Aceituno, E. Lewalski, B. Joppa, L. Sawyer, C. Schaper, D. McNairn & T. Quinn. 2002. Multicenter evaluation of the Bayer VERSANT HIV-1 RNA 3.0 assay: analytical and clinical performance. J. Clin. Virol. 25:205-216.

Hofseth, L. J., S. P. Hussain & C. C. Harris. 2004. P53:25 years after its discovery. Trends Pharmacol. Sci. 25:177-181.

Kelley, M. L., P. Winge, J. D. Heaney, R. E. Stephens, J. H. Farell, R. J. Van Beneden, C. L. Reinisch, M. P. Lesser & C. W. Walker. 2001. Expression of homologues for p53 and p73 in the softshell clam (Mya arenaria), a naturally-occurring model for human cancer. Oncogene 20:748-758.

McGladdery, S. E., C. L. Reinisch, G. S. MacCallum, R. E. Stephens, C. L. Walker & J. T. Davidson. 2001. Hemic neoplasia in soft-shell clams (Mya arenaria): recent outbreaks in Atlantic Canada and discovery of a p53 gene homologue associated with the condition. Can. Bull. Aqua. Assoc. 101:19-26.

Moore, C. A., N. Beckmann & P. M. Morse. 1992. Cytoskeletal structure of diseased and normal hemocytes of Mya arenaria. J. Invertebr. Pathol. 60:141-147.

Reno, P. W., M. House & A. Illingworth. 1994. Flow cytometric and chromosome analysis of softshell clams, Mya arenaria, with disseminated neoplasia. J. Invertebr. Pathol. 64:163-172.

Sakamoto, S., M. Yokoyama, K. Prakash, J. I. Tsuruha, S. Masamoto, R. H. Getzenberg & Y. Kakehi. 2003. Development of quantitative detection assays for CYR61 as a new marker for benign prostatic hyperplasia. J. Biomol. Screen. 8:701.

Sarrazin, C., B. C. Gartner, D. Sizmann, R. Babiel, U. Mihm, W. P. Hofmann, M. von Wagner & S. Zeuzem. 2006. Comparison of conventional PCR with real-time PCR and branched DNA-based assays for hepatitis C virus RNA quantification and clinical significance for genotypes 1 to 5. J. Clin. Microbiol. 44:729.

Schwabe, H., U. Stein & W. Walther. 2000. High-copy cDNA amplification of minimal total RNA quantities for gene expression analyses. Mol. Biotechnol. 14:165-172.

Siah, A., M. Delaporte, J. Pariseau, P. McKenna & F. C. J. Berthe. 2008. Patterns of p53, p73 and mortalin gene expression associated with hemocyte polyploidy in the soft-shell clam, Mya arenaria. J. Invertebr. Pathol. 98:148-152.

Stifanic, M., M. Micic A. Ramsak, S. Blaskovic, A. Ruso, R. K. Zahn & R. Batel. 2009. P63 in Mytilus galloprovincialis and p53 family members in the phylum Mollusca. Comp. Biochem. Physiol. B 154: 264-273.

Tichopad, A., A. Didier & M. W. Pfaffl. 2004. Inhibition of real-time RT-PCR quantification due to tissue-specific contaminants. Mol. Cell. Probes 18:45-50.

Toledo, F. & G. M. Wahl. 2006. Regulating the p53 pathway: in vitro hypotheses, in vivo veritas. Nat. Rev. Cancer 6:909-923.

Tsongalis, G. J. 2006. Branched DNA technology in molecular diagnostics. Am. J. Clin. Pathol. 126:448-453.

Yang, L., D. K. Tran & X. Wang. 2001. BADGE, beads array for the detection of gene expression: a high-throughput diagnostic bioassay. Genome Res. 11:1888-1898.

Yao, J. D., M. G. Beld, L. L. Oon, C. H. Sherlock, J. Germer, S. Menting, S. Y. Se Thoe, L. Merrick, R. Ziermann, J. Surtihadi & H. J. Hnatyszyn. 2004. Multicenter evaluation of the VERSANT hepatitis B virus DNA 3.0 assay. J. Clin. Microbiol. 42:800-806.

Zhang, J. & C. D. Byrne. 1999. Differential priming of RNA templates during cDNA synthesis markedly affects both accuracy and reproducibility of quantitative competitive reverse-transcriptase PCR. Biochem. J. 337:231-241.

Zhang, A., L. Pastor, Q. Nguyen, Y. Luo, W. Yang, M. Flagella, R. Chavli, S. Bui, C. T. Nguyen, Z. Zheng, W. He, G. McMaster & F. Witney. 2005. Small interfering RNA and gene expression analysis using a multiplex branched DNA assay without RNA purification. J. Biomol. Screen. 10:549-556.

AHMED SIAH, (1,2) * P. MCKENNA, (2) G. JOHNSON (2) AND F. C. J. BERTHE (3)

(1) British Columbia Centre for Aquatic Health Sciences, B.C. CAHS, 871A Island Highway, V9W 2C2, Campbell River, BC, Canada, (2) Department of Pathology & Microbiology, Atlantic Veterinary College, University of Prince Edward Island, 550 University Avenue, C1A 4P3 Charlottetown, Prince Edward Island, Canada; (3) Animal Health and Welfare Unit, European Food Safety Authority (EFSA), Largo N, Palli 5IA, 1-43100 Parma, Italy

* Corresponding author. E-mail: ahmed.siah@cahs-bc.ca

DOI: 10.2983/035.031.0313
Gale Copyright: Copyright 2012 Gale, Cengage Learning. All rights reserved.