|
Rapid genotyping of swine influenza
viruses.
|
|
|
|
|
| Article Type: | Report |
| Subject: |
Animal genetic engineering
(Research) Swine (Health aspects) Swine (Research) Swine (Genetic aspects) Swine influenza (Research) Swine influenza (Genetic aspects) Swine influenza (Causes of) Influenza viruses (Research) Influenza viruses (Health aspects) |
| Authors: |
Mak, Polly W.Y. Wong, Chloe K.S. Li, Olive T.W. Chan, Kwok Hung Cheung, Chung Lam Ma, Edward S. Webby, Richard J. Guan, Yi Peiris, Joseph S. Malik Poon, Leo L.M. |
| Pub Date: | 04/01/2011 |
| Publication: | Name: Emerging Infectious Diseases Publisher: U.S. National Center for Infectious Diseases Audience: Academic; Professional Format: Magazine/Journal Subject: Health Copyright: COPYRIGHT 2011 U.S. National Center for Infectious Diseases ISSN: 1080-6040 |
| Issue: | Date: April, 2011 Source Volume: 17 Source Issue: 4 |
| Topic: | Event Code: 310 Science & research |
| Product: | Product Code: 0213000 Hogs NAICS Code: 11221 Hog and Pig Farming SIC Code: 0213 Hogs |
|
|
|
| Accession Number: | 254403842 |
| Full Text: |
Co-infection of influenza A viruses enables viral gene
reassortments, thereby generating progeny viruses with novel genotypes.
Such reassortants may pose a serious public health threat, as
exemplified by the emergence of pandemic influenza (H1N1) in 2009 (1).
Transmission of pandemic (H1N1) 2009 virus from humans to pigs has been
reported (2-5). We recently identified a reassortment between pandemic
(H1N1) 2009 virus and swine influenza viruses in pigs (6). These results
emphasize the potential role of pigs as a mixing vessel for influenza
viruses and the need for screening tests that can identify major
reassortment events in pigs. We previously developed 8 monoplex SYBR green-based quantitative reverse transcription-PCRs to detect all 8 gene segments derived from the pandemic (H1N1) 2009 virus or virus segments that are closely related to this lineage (i.e., neuraminidase [NA] and matrix protein from the Eurasian avian-like swine linage and polymerase basic protein [PB] 2, PB1, polymerase acidic protein [PA], hemagglutinin [HA], nucleocapsid protein [NP], and nonstructural protein [NS]) from triple reassortant swine linage (5). Using these PCRs, we identified swine viruses of atypical genotypes. However, with the exception of the HA-specific assay, the melting-curve signals of pandemic (H1N1) 2009 virus may be indistinguishable from the positive signals generated from its sister clade as indicated above. To differentiate between these closely related groups of viruses, we further optimized these assays by adding sequence-specific hydrolysis probes in the SYBR green assays. The Study For this study, all SYBR green assays were modified from the previously described assays (5), with the exception of the reverse primers for the newly designed PB1 and NS segments (Table 1). The subtype H1N1 swine influenza viruses isolated in Hong Kong during the past few years were mainly derived from the Eurasian avian-like swine lineage (6,7). To generate more precise genotyping data for our ongoing surveillance, the NA segment-specific assay was specifically designed to react with the pandemic (H1N1) 2009 virus and a portion of Eurasian avian-like swine viruses that are circulating in southeastern China (online Technical Appendix Figure 1, www.cdc.gov/EID/content/17/4/691-Techapp.pdf). To avoid overlapping the emission spectrum of SYBR green, we labeled all pandemic (H1N1) 2009 virus-specific hydrolysis probes (Integrated DNA Technologies, Inc., Coralville, IA, USA) with cyanine 5 (Cy5) and Black Hole Quencher-2 dyes at their 5' and 3' ends, respectively (Table 1). To enable use of short oligonucleotide sequences without compromising the annealing temperature of these probes, we modified the probes with locked nucleic acids (7). RNA extraction and complimentary DNA synthesis were identical to the protocols described (5,8). One microliter of 10-fold diluted complimentary DNA sample was amplified in a 20-[micro]L reaction containing 10 [micro]L of Fast SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA) and the corresponding primer probe set (0.5 [micro]mol/L each). All reactions were optimized and performed simultaneously in a 7500 Sequence Detection System (Applied Biosystems) with the following conditions: 20 s at 95[degrees]C, followed by 30 cycles of 95[degrees]C for 3 s and 62[degrees]C for 30 s. SYBR green and Cy5 signals from the same reaction were captured simultaneously at the end of each amplification cycle. The expected PCR results of virus segment derived from different swine viral lineages are shown in Table 2. The dissociation kinetics of PCR amplicons were studied by a melting curve analysis at the end of the PCR (60[degrees]C-95[degrees]C; temperature increment 0.1[degrees]C/s). We also tested various probe and SYBR green concentrations under different PCR conditions. The condition described above gave the most robust and consistent DNA amplification (data not shown). We tested 31 human pandemic (H1N1) 2009 and 63 human seasonal influenza viruses (33 subtype H1N1, 30 subtype H3N2) as controls. As expected, all human pandemic influenza viruses were double positive (i.e., positive with SYBR green and Cy5) and all seasonal influenza samples were double negative in all 8 assays. To evaluate the sensitivity of the assays, we tested serial diluted plasmid DNA of the corresponding segments of influenza A/California/4/2009 virus as a standard. The fluorescent signals generated from the SYBR green reporter dye in all assays were highly similar to those previously reported (5), and the modified assays had a linear dynamic detection range from [10.sup.2] to [10.sup.8] copies/reaction (online Technical Appendix Figure 2). As expected, the threshold cycle values deduced from the Cy5 reporter signal were generally higher than those from the SYBR green reporter (online Technical Appendix Figure 2) (9). This finding can be partly explained by the nature of these 2 kinds of real-time PCR chemistries: a single Cy5 fluorophore of the hydrolysis probe was released from quenching for each amplicon synthesized while multiple SYBR green dyes bound to a single amplicon (10). After 35 PCR amplification cycles, the linear dynamic detection range of Cy5 signals generated from these reactions was 102 to [10.sup.8] copies/reaction (data not shown). However, to avoid nonspecific SYBR green signals, we purposely limited the number of amplification cycles to 30. Using these assays, we tested 41 swine virus isolates collected during January 2009-January 2010. In all 8 reactions, 10 pandemic (H1N1) 2009 virus samples transmitted from humans to pigs (6) were double positive (online Technical Appendix Figure 1, pink). In these assays, gene segments of another 31 swine isolates were either SYBR green positive/Cy5 negative (online Technical Appendix Figure 1, yellow) or double negative (online Technical Appendix Figure 1, green), indicating that these virus segments were derived from the sister clade of pandemic (H1N1) 2009 virus or other swine lineages (except NA), respectively. For example, the reassortant of pandemic (H1N1) 2009 virus (A/swine/ Hong Kong/201/2010 [H1N1]) was double positive for NA, double negative for HA and matrix protein, and SYBR green positive/Cy5 negative for PB2, PB1, PA, NP, and NS (Figure; other data not shown). All genotyping results of the studied viruses were consistent with results of previous phylogenetic analyses (5,6), indicating that our modified probes and SYBR green assays can provide more accurate genotyping results. With these genotyping data, viruses with atypical positive signal patterns might suggest a novel viral reassortment event and can be highlighted for investigation with sequencing-based methods. [FIGURE OMITTED] To demonstrate the potential use of these assays in studying swine viruses circulating in other geographic locations, we tested 7 recent swine isolates (1 pandemic influenza subtype H1N1, 4 subtype H1N2, and 2 subtype H3N2) collected in the United States. Genotyping results agreed 100% with data deduced from sequence analyses (online Technical Appendix Table 1). We also analyzed all 436 contemporary (2008-2010) US swine virus segments available from the National Center for Biotechnology Information influenza virus sequence database. On the basis of the in silico analysis of sequences targeted by our primers and probes, 95% of the sequences (n = 413) are predicted to yield the expected results (online Technical Appendix Table 2). Conclusions This study was supported by the Area of Excellence Scheme of the University Grants Committee Hong Kong (grant AoE/M-12/06), the Research Grant Council of Hong Kong (HKU 773408M to L.L.M.P.), the Seed Funding for Basic Research (Hong Kong University), Research Fund for the Control of Infectious Disease Commissioned Project Food and Health Bureau (Hong Kong), and the National Institutes of Health (National Institute of Allergy and Infectious Diseases contract HHSN266200700005C). Ms Mak is a postgraduate student in the Department of Microbiology, The University of Hong Kong. Her research focuses on molecular diagnosis of influenza virus. DOI: 10.3201/eid1704101726 References (1.) Novel Swine-Origin Influenza A (H1N1) Virus Investigation Team, Dawood FS, Jain S, Finelli L, Shaw MW, Lindstrom S, et al. Emergence of a novel swine-origin influenza A (H1N1) virus in humans. N Engl J Med. 2009;360:2605-15. DOI: 10.1056/NEJMoa0903810 (2.) Pasma T, Joseph T. Pandemic (H1N1) 2009 infection in swine herds, Manitoba, Canada. Emerg Infect Dis. 2010;16:706-8. (3.) Pereda A, Cappuccio J, Quiroga MA, Baumeister E, Insarralde L, Ibar M, et al. Pandemic (H1N1) 2009 outbreak on pig farm, Argentina. Emerg Infect Dis. 2010;16:304-7. (4.) Howden KJ, Brockhoff EJ, Caya FD, McLeod LJ, Lavoie M, Ing JD, et al. An investigation into human pandemic influenza virus (H1N1) 2009 on an Alberta swine farm. Can Vet J. 2009;50:1153-61. (5.) Poon LL, Mak PW, Li OT, Chan KH, Cheung CL, Ma ES, et al. Rapid detection of reassortment of pandemic (H1N1) 2009 influenza virus. Clin Chem. 2010;56:1340-4. DOI: 10.1373/clinchem.2010.149179 (6.) Vijaykrishna D, Poon LL, Zhu HC, Ma SK, Li OT, Cheung CL, et al. Reassortment of pandemic (H1N1) 2009 influenza A virus in swine. Science. 2010;328:1529. DOI: 10.1126/science.1189132 (7.) Johnson MP, Haupt LM, Griffiths LR. Locked nucleic acid (LNA) single nucleotide polymorphism (SNP) genotype analysis and validation using real-time PCR. Nucleic Acids Res. 2004;32:e55. DOI: 10.1093/nar/gnh046 (8.) Poon LL, Chan KH, Smith GJ, Leung CS, Guan Y, Yuen KY, et al. Molecular detection of a novel human influenza (H1N1) of pandemic potential by conventional and real-time quantitative RT-PCR assays. Clin Chem. 2009;55:1555-8. DOI: 10.1373/clinchem.2009.130229 (9.) Papin JF, Vahrson W, Dittmer DP. SYBR green-based real-time quantitative PCR assay for detection of West Nile virus circumvents false-negative results due to strain variability. J Clin Microbiol. 2004;42:1511-8. DOI: 10.1128/JCM.42.4.1511-1518.2004 (10.) Buh Gasparic M, Tengs T, La Paz JL, Holst-Jensen A, Pla M, Esteve T, et al. Comparison of nine different real-time PCR chemistries for qualitative and quantitative applications in GMO detection. Anal Bioanal Chem. 2010;396:2023-9. DOI: 10.1007/s00216-009 3418-0 Address for correspondence: Leo L. M. Poon, Department of Microbiology, University Pathology Building, Queen Mary Hospital, Pokfulam, Hong Kong Special Administrative Region, People's Republic of China; email: llmpoon@hkucc.hku.hk Polly W.Y. Mak, Chloe K.S. Wong, Olive T.W. Li, Kwok Hung Chan, Chung Lam Cheung, Edward S. Ma, Richard J. Webby, Yi Guan, Joseph S. Malik Peiris, and Leo L.M. Poon Author affiliations: The University of Hong Kong, Hong Kong Special Administrative Region, People's Republic of China (P.W.Y. Mak, C.K.S. Wong, O.T.W. Li, K.H. Chan, C.L. Cheung, E.S. Ma, Y. Guan, J.S.M. Peiris, L.L.M. Poon); St. Jude Children's Research Hospital, Memphis, Tennessee, USA (R.J. Webby); and Hong Kong University-Pasteur Research Centre, Hong Kong (J.S.M. Peiris) Table 1. Primer-probe sets selective for pandemic (H1N1) 2009
virus gene segments *
Sequence, 5' [right arrow]
Segment Primer and probef 3' (doubel dagger])
PB2 PB2-1877F ([section]) AACTTCTCCCCTTTGCTGCT
PB2-2062R ([section]) GATCTTCAGTCAATGCACCTG
PB2-2028RP Cy5-A(A)C(T)GTAAG(T)C(G)TTT
(G)GT-BHQ2
PB1 PB1-825F ([section]) ACAGTCTGGGCTCCCAGTA
PB1-1023R GAACCACTCGGGTTGATTTCTG
PB1-863FP Cy5-CC(A)AA(C)T(G)GC(A)AA
(T)G-BHQ2
PA PA-821F ([section]) GCCCCCTCAGATTGCCTG
PA-1239R ([section]) GCTTGCTAGAGATCTGGGC
PA-844FP Cy5-CC(T)C(T)TT(G)CC(A)TC
(A)GC-BHQ2
HA HA-398F ([section]) GAGCTCAGTGTCATCATTTGAA
HA-570R ([section]) TGCTGAGCTTTGGGTATGAA
HA-470FP Cy5-CA(A_AGG(T)GT(A)AC(G)GCA-BHQ2
NP NP-593F ([section]) TGAAAGGAGTTGGAACAATAGCAA
NP-942R ([section]) GACCAGTGAGTACCCTTCCC
NP-872RP Cy5-AG(G)CA(G)GA(T)T(T)A(T)G
(T)G-BHQ2
NA NA-163F ([section]) CATGCAATCAAAGCGTCATT
NA-268R ([section]) ACGGAAACCACTGACTGTCC
NA-248RP Cy5-A(G)CA(G)CA(A)A(G)TT(G)
GTG-BHQ2
M M-504F ([section]) GGTCTCACAGACAGATGGCT
M-818R ([section]) GATCCCAATGATATTTGCTGCAATG
M-530FP Cy5-ACC(A)A(T)CCA(C)T(A)A(T)CA
(G)G-BHQ2
NS NS-252F ([section]) ACACTTAGAATGACAATTGCATCTGT
NS-345R GCATGAGCATGAACCAGTCTCG
NS-288FP Cy5-C(G)CT(A)CCT(TT)CT(G)AC(A)
T/BHQ2/
* PB, polymerase basic protein; PA, polymerase acidic protein; HA,
hemagglutinin; NP, nucleocapsid protein; NA, neuraminidase; M, matrix
protein; NS, nonstructural protein; Cy5, cyanine 5; BHQ2, Black Hole
Quencher 2.
([dagger]) Number represents nucleotide position of the first base in
the target sequence (cRNA sense).
([double dagger]) Locked nucleic acid-modified bases are underlined.
([section]) Primers adapted from the assays as previously described
(5,6).
Note: Locked nucleic acid-modified bases are ().
Table 2. Summary of expected genotyping results of swine and human
influenza viruses *
Virus PB2 PB1
Pandemic (H1N1) 2009 + (a) + (b) + (a) + (b)
Swine Eurasian avian-like - (a) - (b) - (a) - (b)
Swine triple reassortant - (a) + (b) (c) - (a) + (b) (c)
Human seasonal subtypes - (a) - (b) - (a) - (b)
H1 and H3
Virus PA HA
Pandemic (H1N1) 2009 + (a) + (b) + (a) + (b)
Swine Eurasian avian-like - (a) - (b) - (a) - (b)
Swine triple reassortant - (a) + (b) (c) - (a) + (b) (c)
Human seasonal subtypes - (a) - (b) - (a) - (b)
H1 and H3
Virus NP NAT
Pandemic (H1N1) 2009 + (a) + (b) + (a) + (b)
Swine Eurasian avian-like - (a) - (b) - (a) + (b) (c)
Swine triple reassortant - (a) + (b) (c) - (a) - (b)
Human seasonal subtypes - (a) - (b) - (a) - (b)
H1 and H3
Virus M NS
Pandemic (H1N1) 2009 + (a) + (b) + (a) + (b)
Swine Eurasian avian-like - (a) + (b) (c) - (a) - (b)
Swine triple reassortant - (a) - (b) - (a) + (b) (c)
Human seasonal subtypes - (a) - (b) - (a) - (b)
H1 and H3
* PB, polymerase basic protein; PA, polymerase acidic protein; HA,
hemagglutinin; NP, nucleocapsid protein; NA, neuraminidase; M,
matrix protein; NS, nonstructural protein. Red symbols indicate
pandemic (H1N1) 2009 virus-specific probe results; black symbols
indicate SYBR Green results; gray shading indicates sister clade of
pandemic (H1N1) 2009 virus for each virus segment.
([dagger]) N2 and some of the N1 within swine Euarasian avian-like
lineage are expected to be double negative in the NA test.
(a) symbols indicate pandemic (H1N1) 2009 virus-specific probe
results; (b) symbols indicate SYBR Green results; (c) shading
indicates sister clade of pandemic (H1N1) 2009 virus for each virus
segment |
| Gale Copyright: | Copyright 2011 Gale, Cengage Learning. All rights reserved. |