Phylogeography of Francisella tularensis subsp. holarctica, Europe.
Article Type: Report
Subject: Francisella tularensis (Research)
Francisella tularensis (Genetic aspects)
Single nucleotide polymorphisms (Research)
Genotype (Research)
Authors: Gyuranecz, Miklos
Birdsell, Dawn N.
Splettstoesser, Wolf
Seibold, Erik
Beckstrom-Sternberg, Stephen M.
Makrai, Laszlo
Fodor, Laszlo
Fabbi, Massimo
Vicari, Nadia
Johansson, Anders
Busch, Joseph D.
Vogler, Amy J.
Keim, Paul
Wagner, David M.
Pub Date: 02/01/2012
Publication: Name: Emerging Infectious Diseases Publisher: U.S. National Center for Infectious Diseases Audience: Academic; Professional Format: Magazine/Journal Subject: Health Copyright: COPYRIGHT 2012 U.S. National Center for Infectious Diseases ISSN: 1080-6040
Issue: Date: Feb, 2012 Source Volume: 18 Source Issue: 2
Topic: Event Code: 310 Science & research
Geographic: Geographic Scope: Europe Geographic Code: 4E Europe
Accession Number: 281175407
Full Text: Fraancisella tularensis is the etiologic agent of tularemia and a highly virulent category A biothreat agent (1,2). The most widely distributed subspecies is F. tularensis subsp. holarctica, which is found throughout much of the Northern Hemisphere and is the only subspecies found in Europe (3). Despite its wide geographic distribution, F. tularensis subsp. holarctica contains low genetic diversity, which indicates recent emergence (4). A recent global phylogeographic analysis (5), and several subsequent analyses (6-9), assigned most isolates from Europe to 2 phylogenetic groups: B.FTNF002-00 and B.13 (includes multiple subclades descended from branch B.13 [5,6,8]; branch and subclade nomenclature from [5] has been shortened by removing Br and extra 0s from individual branch and subclade names). These groups appear to be geographically segregated: only isolates from B.FTNF002-00 have been reported from the western European countries of Spain, France, and Switzerland, whereas B.13 is the only or dominant type reported from the Czech Republic, Finland, Georgia, Russia, Slovakia, and Ukraine (5-9). We provide additional information about the geographic distribution of these 2 groups using existing phylogenetic signatures (5,8) to place 45 isolates from Austria, Germany, Hungary, Italy, and Romania (online Appendix Table, wwwnc.cdc.gov/EID/article/18/2/11 1305-TA1.htm) into the existing global phylogeographic framework.

[FIGURE 1 OMITTED]

The Study

All of the isolates were assigned to group B.FTNF002-00 or to group B.13. All 3 isolates from Italy were assigned to group B.FTNF002-00 (Figure 1, panel A). Although the sample size was small, these isolates were obtained in 3 different years (online Appendix Table), which suggests that this group is ecologically established in Italy. These results increase the known geographic distribution of this group, which appears to be the dominant clone in western Europe (Figure 2, panel A, purple shading). All 42 isolates from Austria, Germany, Hungary, and Romania were assigned to group B.13 (Figure 1, panel A), further demonstrating that B.13 is the most prevalent group of F. tularensis subsp. holarctica in central and eastern Europe (Figure 2, panel A, red shading). Within group B.13, one isolate from Hungary was assigned to subclade B.23/14/25 (Figure 1, panel A); isolates from Finland, Russia, and Sweden were previously assigned to this subclade (6,8) (Figure 2, panel B). However, the other 41 isolates were assigned to subclade B.20/21 (Figure 1, panel A).

[FIGURE 2 OMITTED]

We identified new genomic signatures to provide increased genetic resolution within subclade B.20/21. Next-generation sequencing technology (Illumina Inc., San Diego, CA, USA) was used to sequence the genome of an isolate from Hungary (Tul07/2007, GenBank accession no. SRX025133) assigned to subclade B.20/21. Putative single nucleotide polymorphisms (SNPs) were identified in the resulting sequence and the genomes of 4 other strains previously assigned to group B.13 (LVS, AM233362.1; FSC 200, AASP00000000; RC503, SRX000104; Georgia F0673, SRX025885) by using an existing bioinformatics pipeline (5). The more distantly related strain OSU18 (CP000437.1) genome was also included as an outgroup. A maximum-parsimony tree was constructed by using the resulting [approximately equal to] 700 putative SNPs and PAUP 4.0b10 software (Sinauer Associates, Inc., Sunderland, MA, USA) (Figure 1, panel B). Most of the putative SNPs separated OSU18 from the B.13 strains (data not shown), but the remaining putative SNPs provided resolution among the B.13 strains, including 20 putative SNPs specific to the branch leading to the strain from Hungary (Figure 1, panel B). Consistent with previous analyses (Figure 1, panel A), the strain from Hungary clustered as a sister taxon to strain FSC 200 (Figure 1, panel B).

To show additional phylogenetic structure within subclade B.20/21, we designed genotyping assays targeting the 20 putative SNPs along the branch leading to the strain from Hungary (Figure 1, panel B) and screened them across 64 isolates assigned to subclade B.20/21. This analysis included the 41 isolates from Austria, Germany, Hungary, and Romania, as well as 23 additional isolates from central Europe, the Czech Republic, Finland, Russia, and Sweden that were previously assigned to this subclade (6,8) (online Appendix Table). The assays were constructed and performed as described (5) by using an annealing temperature of 60[degrees]C. All 20 SNPs were laboratory confirmed, and 52 of the isolates were assigned to 6 new subclades (B.33/34, B.34/35, B.35/36, B.36/37, B.37/38, and B.Tul07/2007); the 12 other isolates remained in the basal subclade, now identified as B.20/21/33 (Figure 2, panel B; online Appendix Table). Information about assays targeting canonical SNPs for the branches leading to the 6 new subclades are presented in the Table.

Conclusions

Our results are consistent with complex dispersal patterns within the B.13 group of F. tularensis subsp. holarctica. Several of the B.13 subclades identified in this study are broadly distributed throughout central and eastern Europe (Figure 2, panel A), including subclades B.20/21/33, B.33/34, and B.34/35. All of the new subclades containing >1 isolate have representatives from multiple countries (Figure 2, panel B). Other previously identified B.13 subclades, including B.27/28, B.LVS, B.23/14/25, and B.21/22 are also broadly distributed (Figure 2, panel A).

This study and previous studies have increased understanding of F. tularensis subsp. holarctica in Europe by placing isolates from multiple countries into the existing global phylogeographic framework. As a result, the genetic background is becoming defined for each country (i.e., the specific subtypes reported from each country). This information can be useful for identifying intentional (e.g., bioterrorism) or unintentional movement of F. tularensis subsp. holarctica between countries. For example, the isolate from Romania examined in this study was actually isolated in Italy from an infected hare that was shipped from Romania for hunting. Genotyping results are consistent with a Romanian origin for this isolate because it was assigned to the B.13 group that is widespread in central and eastern Europe (Figure 2, panel A) and not to the B.FTNF002-00 group, to which the isolates from Italy were assigned (Figure 1, panel A).

Understanding global phylogeographic patterns is possible only if isolates from multiple geographic locations are placed within the same framework (i.e., examined with the same genomic signatures). Because F. tularensis is genetically monomorphic and highly clonal, SNPs are preferred signatures for determining phylogenetic structure within this species (3). Vogler et al. (5) conducted the first SNP-based global phylogeographic analysis of F. tularensis. Subsequent studies (6-8) have used the SNP signatures described by Vogler et al. (5) and new SNPs discovered from new whole-genome sequences or multiple sequence typing data to further refine phylogeographic patterns within F. tularensis, particularly F. tularensis subsp. holarctica. These new signatures, when screened across diverse isolate collections, have identified new subclades within preexisting subclades. This pattern will continue as whole-genome sequencing becomes less expensive and more widely available. As a result, the nomenclature of phylogenetic groups within F. tularensis and the particular subclade to which a given isolate is assigned are constantly changing and will continue to change, which makes comparison of results and findings across different studies difficult. To address this problem, we have included all known F. tularensis subsp. holarctica SNP-based phylogenetic groups within our phylogenetic trees (Figure 1, panel A; Figure 2, panel B), including those discovered by other researchers. In addition, for the isolates analyzed in this study (online Appendix Table), where applicable, we have listed the phylogenetic groups to which they were assigned in previous studies.

Acknowledgments

We thank Talima Pearson for helpful discussions and Megan Shuey for technical assistance with whole-genome sequencing.

This work was supported in part by the US Department of Homeland Security Science and Technology Directorate through awards HSHQDC-10-C-00139 and 2010-ST-108-000015.

Dr Gyuranecz is a postdoctoral fellow at the Veterinary Medical Research Institute, Hungarian Academy of Sciences, Budapest, Hungary. His primary research interest is zoonotic wildlife diseases.

References

(1.) Dennis DT, Inglesby TV, Henderson DA, Bartlett JG, Ascher MS, Eitzen E, et al. Tularemia as a biological weapon: medical and public health management. JAMA. 2001;285:2763-73. http://dx.doi. org/10.1001/jama.285.21.2763

(2.) Rotz LD, Khan AS, Lillibridge SR, Ostroff SM, Hughes JM. Public health assessment of potential biological terrorism agents. Emerg Infect Dis. 2002;8:225-30. http://dx.doi.org/10.3201/eid0802.010164

(3.) Keim P, Johansson A, Wagner DM. Molecular epidemiology, evolution, and ecology of Francisella. Ann N Y Acad Sci. 2007;1105:3066. http://dx.doi.org/10.1196/annals.1409.011

(4.) Keim PS, Wagner DM. Humans and evolutionary and ecological forces shaped the phylogeography of recently emerged diseases. Nat Rev Microbiol. 2009;7:813-21. http://dx.doi.org/10.1038/nrmi cro2219

(5.) Vogler AJ, Birdsell D, Price LB, Bowers JR, Beckstrom-Sternberg SM, Auerbach RK, et al. Phylogeography of Francisella tularensis: global expansion of a highly fit clone. J Bacteriol. 2009;191:2474-84. http://dx.doi.org/10.1128/JB.01786-08

(6.) Chanturia G, Birdsell DN, Kekelidze M, Zhgenti E, Babuadze G, Tsertsvadze N, et al. Phylogeography of Francisella tularensis subspecies holarctica from the country of Georgia. BMC Microbiol. 2011;11:139. http://dx.doi.org/10.1186/1471-2180-11-139

(7.) Pilo P, Johansson A, Frey J. Identification of Francisella tularensis cluster in central and western Europe. Emerg Infect Dis.2009;15:2049-51. http://dx.doi.org/10.3201/eid1512.080805

(8.) Svensson K, Granberg M, Karlsson L, Neubauerova V, Forsman M, Johansson A. A real-time PCR array for hierarchical identification of Francisella isolates. PLoS ONE. 2009;4:e8360. http://dx.doi. org/10.1371/journal.pone.0008360

(9.) Vogler AJ, Birdsell DN, Lee J, Vaissaire J, Doujet CL, Lapalus M, et al. Phylogeography of Francisella tularensis ssp. holarctica in France. Lett Appl Microbiol. 2011;52:177-80. http://dx.doi. org/10.1111/j.1472-765X.2010.02977.x

Miklos Gyuranecz, [1] Dawn N. Birdsell, [1] Wolf Splettstoesser, Erik Seibold, Stephen M. Beckstrom-Sternberg, Laszlo Makrai, Laszlo Fodor, Massimo Fabbi, Nadia Vicari, Anders Johansson, Joseph D. Busch, Amy J. Vogler, Paul Keim, and David M. Wagner

Author affiliations: Hungarian Academy of Sciences, Budapest, Hungary (M. Gyuranecz); Northern Arizona University, Flagstaff, Arizona, USA (D.N. Birdsell, J.D. Busch, A.J. Vogler, P. Keim, D.M. Wagner); Bundeswehr Institute of Microbiology, Munich, Germany (W. Splettstoesser, E. Seibold); Translational Genomics Research Institute, Phoenix, Arizona, USA (S.M. Beckstrom-Sternberg, P. Keim); Szent Istvan University, Budapest (L. Makrai, L. Fodor); Istituto Zooprofilattico Sperimentale della Lombradia e dell'Emilia Romagna, Pavia, Italy (M. Fabbi, N. Vicari); and Umea University, Umea, Sweden (A. Johansson)

DOI: http://dx.doi.ora/10.3201/eid1802.111305

[1] These authors contributed equally to this article.

Address for correspondence: David M. Wagner, PO Box 4073, Center for Microbial Genetics and Genomics, Northern Arizona University, Flagstaff AZ, 86011-4073, USA; email: dave.wagner@nau.edu
Table. Melt-MAMA primers targeting canonical SNPs for 6 new
phylogenetic branches in a study of Francisella tularensis subsp.
holarctica, Europe *

              SCHU            SNP state,
          ([dagger]) S4       D/A([double
SNP         position          dagger])

B.33         78,382              T/C

B.34         766,614             A/G

B.35         239,479             A/C

B.36        1,599,292            A/C

B.37         318,602             T/C

B.38         166,885             C/T

SNP      Primers, 5' [right arrow] 3' ([section])

B.33     A: ATTGCTACTTCTATTTACGCCAACAG
         D: GGGGCGGGGCGGGGCATTGCTACTTCTATTTACGCCAAGAA
         C: TGTGAACAACCAAGTTGGCTT
B.34     A: GTAGCGAGCATTATTTGCTGGTTC
         D: GGGGCGGGGCGGGGCTAGCGAGCATTATTTGCTGGGTT
         C: ATAAAACTATAAATTTACATAAAATGAAAACTTCTC
B.35     A: GCCTTAATCTAGTATTTTCGCTTATCTCC
         D: GGGGCGGGGCGGGGCGCCTTAATCTAGTATTTTCGCTTATCACA
         C: CGGGCTCTAAAATAAGATTTAAGTTAGTAAGT
B.36     A: TATTATAGTTTCTAAAAACAGTCTAATTAATTTTG
         D: GGGGCGGGGCGGGGCTATTATAGTTTCTAAAAACAGTCTAATTAATTGTT
         C:GTTCGACCATGACTACAGTGTTG
B.37     A: AACATTTTAGGAACTCTACGATGATAAACTTAAC
         D: GGGGCGGGGCGGGGCCATTTTAGGAACTCTACGATGATAAACTTGAT
         C: GAAATATCTCAATGAAATCTAATTTAACTAAAATCAC
B.38     A: ATGCCATCAGCCATTTACTACTCACA
         D: GGGGCGGGGCGGGGCCCATCAGCCATTTACTACTCCCG
         C: CTTCCCTGATTTTCTAAGTTCTGCTTG

          Con, [micro]M      [T.sub.m],
SNP       ([paragraph])      [degrees]C

B.33          0.20              74.3
              0.20              79.0
              0.20
B.34          0.40              69.2
              0.20              78.6
              0.20
B.35          0.40              70.3
              0.20              75.5
              0.20
B.36          0.60              69.0
              0.20              73.9
              0.20
B.37          0.20              69.7
              0.20              75.9
              0.20
B.38          0.20              73.7
              0.20              80.1
              0.20

* Melt-MAMA, melt-mismatch amplification mutation assay; SNP, single
nucleotide polymorphism; con, concentration; [T.sub.m], melting temperature
for ancestral and derived Melt-MAMA amplification products.

([dagger]) SCHU strain GenBank accession no. NC 006570.

([double dagger]) SNP states are presented according to their
orientation in the SCHU S4 reference genome (AJ749949.2): D, derived
SNP state; A, ancestral SNP state.

(section]) D, derived allele primer; A, ancestral allele primer; C,
common primer; primer tails and antepenultimate mismatch bases are
in lower case.

([paragraph]) Final concentration of each primer in Melt-MAMA
genotyping assays.
Gale Copyright: Copyright 2012 Gale, Cengage Learning. All rights reserved.