|
Molecular evidence for parthenogenesis in the Sierra
garter snake, Thamnophis couchii (colubridae).
|
|
|
|
|
| Abstract: |
We used microsatellite analysis to investigate possible
reproduction by parthenogenesis in the bisexual Sierra garter snake,
Thamnophis couchii. The genotypes of four microsatellite loci were
determined for each of four individuals, including three T. couchii, two
of which were a female and her offspring, and T. ordinoides. The female
T. couchii and her offspring were homozygous and identical for all four
microsatellite loci; however, Ts3 and Ts4 are the only loci that
supported reproduction by parthenogenesis as Ts1 and Ts2 were
uninformative. These data along with absence of a unique paternal allele
and known absence of an opportunity to mate prior to and during
captivity is consistent with reproduction by parthenogenesis. Utilizamos el analisis de microsatelites para investigar la posible reproduction por partenogenesis de la culebra-listonada bisexual, Thamnophis couchii. Fueron determinados los genotipos de cuatro loci de microsatelites para cada uno de cuatro individuos, incluyendo tres T. couchii, dos de los cuales fueron una hembra y su crla, y T. ordinoides.La T. couchii hembra y su cria fueron homozigoticos e identicos para los cuatro loci de microsatelites; sin embargo, Ts3 y Ts4 son los unicos loci que apoyaron la reproduction por partenogenesis puesto que Ts1 y Ts2 no rindieron ninguna information. Estos datos junto con la falta de un alelo paternal unico y la conocida falta de oportunidad para aparear antes de y durante el cautiverio son consistentes con la reproduction por partenogenesis. |
|
|
|
| Article Type: | Report |
| Subject: |
Snakes
(Genetic aspects) Parthenogenesis (Observations) |
| Authors: |
Germano, David J. Smith, Paul T. |
| Pub Date: | 06/01/2010 |
| Publication: | Name: Southwestern Naturalist Publisher: Southwestern Association of Naturalists Audience: Academic Format: Magazine/Journal Subject: Biological sciences Copyright: COPYRIGHT 2010 Southwestern Association of Naturalists ISSN: 0038-4909 |
| Issue: | Date: June, 2010 Source Volume: 55 Source Issue: 2 |
| Geographic: | Geographic Scope: United States Geographic Code: 1USA United States |
| Accession Number: | 230959111 |
| Full Text: |
Most vertebrates reproduce sexually, although this is not always
the case. Some reptiles are obligatory parthenogens (reproducing
gynogenetically), including the Brahminy blind snake (Ramphotyphlops
brahminus) and a variety of lizards in the families Teiidae, Lacertidae,
Xantusiidae, Gekkonidae, Agamidae, and Chameleonidae (Vrijenhoek et al.,
1989; Wright, 1993). Other parthenogenetic vertebrates occur among
fishes in the families Poecilidae, Atherinidae, Cottidae, and
Cyprinidae, and amphibians in the families Ambystomatidae and Ranidae
(Vrijenhoek et al., 1989), but sperm from males of syntopic bisexual
species are required to fuse with eggs from hybridogenetic females
(Wright, 1993). There also are a number of examples of normally bisexual
species that occasionally produce parthenogenetically. This facultative
parthenogenesis (spontaneous development of zygotes from unfertilized
eggs) is known from 10 orders of insects (Simon et al., 2003), and
occurs occasionally in vertebrates. Facultative parthenogenetic
reproduction in vertebrates has been presumed to have occurred in the
common water snake Nerodia sipedon (Skalka and Vozenilek, 1986), the
Javan wart snake Acrochordus javanicus (Magnusson, 1979), the file snake
A. arafurae (Dubach et al., 1997), the wandering garter snake Thamnophis
elegans, the checkered garter snake T. marcianus, the timber rattlesnake
Crotalus horridus, the Aruba Island rattlesnake C. unicolor (Schuett et
al., 1997), the Burmese python Python molurus (Groot et al., 2003), the
yellow-spotted monitor Varanus panoptes (Lenk et al., 2005), and the
Komodo dragon Varanus komodoensis (Watts et al., 2006) based on
isolation of females from males, analysis of genetic data, or both. The bisexual Sierra garter snake (Thamnophis couchii) occurs in the Sierra Nevada and Tehachapi Mountains of California extending eastward into western Nevada (Rossman et al., 1996). It is highly aquatic and occurs along streams, rivers, ponds in meadows, and small lakes (Rossman et al., 1996). Thamnophis couchii is viviparous and produces 7-38 young in summer (Bartlett and Tennant, 2000). Here we report apparent parthenogenesis in this usually bisexual snake. A neonate was produced by a captive female T. couchii that had never been kept with a male. We used microsatellite analysis to determine the genetic relationship of the offspring to its mother. We collected tissues from four individual Thamnophis. Two samples were obtained in 2006 from an adult female T. couchii and her offspring, both of which were housed in an indoor reptile facility at the California Living Museum, Bakersfield, Kern County, California. The female had been in captivity since 20 September 2000 when she was put on display with another female T. couchii. She weighed 38.3 g in February 2001. She produced her first clutch of young (not counted) 5 July 2005 when she weighed 181 g post laying, but young were still-born. She produced a second clutch (not counted) 20 April 2006 (adult weight was 211 g) and one neonate was born alive. This female never was housed with a male garter snake and was a juvenile when she was brought into captivity. An additional female T. couchii (also a captive from the California Living Museum, tissue taken May 2008) was included as a within-species outgroup. The fourth sample was obtained from an adult male northwestern garter snake (T. ordinoides) that was a captive, and served as an unrelated outgroup. Tissues consisted of tail clippings that were placed in 95% ethanol. DNA was extracted from each of the four samples using the DNAeasy Tissue Kit (Qiagen, Inc., Valencia, California). Voucher specimens and surplus genomic extracts were stored at - 70 [degrees]C in the laboratory of PTS. PCR-primer sequences developed specifically to investigate paternity in T. sirtalis (Ts1, Ts2, Ts3 and Ts4; Table 1) by McCracken et al. (1999) were synthesized and labeled with Fam6 or Hex (Integrated DNA Technologies, Coralville, Iowa) for fragment analysis. PCR-amplification conditions were described by McCracken et al. (1999) and consisted of 2 min at 95 [degrees]C, followed by 27 cycles of 1 min at 95 [degrees]C and 1 min at 56 [degrees]C (Ts1 and Ts4), 54 [degrees]C (Ts2), or 57 [degrees]C (Ts3), and 1 min at 72 [degrees]C on a T-Gradient thermocycler (Biometra, Labrepco Inc., Horsham, Pennsylvania). The PCR products were submitted to the University of Florida Interdisciplinary Center for Biotechnology Research Genetic Analysis Laboratory for processing on a MegaBACE 1000 (Amersham Biosciences, Piscataway, New Jersey; Ts3) or ABI 3730 (Applied Biosystems, Foster City, California; Ts1, Ts2, and Ts4) and were analyzed using GeneMarker (Version 1.50, Soft Genetics, State College, Pennsylvania). Locus Ts1 was not informative as the female T. couchii, her offspring, and T. ordinoides were homozygous for the same-sized allele (190/190), but the outgroup T. couchii was homozygous for a different-sized allele (123/123; Table 1). Similarly, Ts2 was not informative as this locus was invariant among the three T. couchii, but was genetically different from the heterozygote T. ordinoides (Table 1). The female and offspring T. couchii were homozygous and invariant for locus Ts3, but were different from both outgroups. The outgroup T. couchii was heterozygous for Ts3 with both alleles being different in size compared to the female and offspring (Table 1). Finally, all four individuals were homozygous for locus Ts4 with the female and her offspring being identical, but different from both outgroups. Because the outgroup T. couchii was homozygous for a different allele compared to the female and her offspring, Ts4 has potential for heterozygosity within this species. We thank L. Klingenberg of the California Living Museum for alerting us to this information and providing us with access to the three T. couchii. We also thank J. Reyna for translating our English abstract into Spanish. The University of Florida Interdisciplinary Center for Biotechnology Research Genetic Analysis Laboratory conducted the analysis of microsatellite fragments. Submitted 25 June 2008. Accepted 1 June 2009. Literature Cited Bartlett, R. D., and A. Tennant. 2000. Snakes of North America: western region. Gulf Publishing Company, Houston, Texas. Dubach, J., A. Sajewicz, and R. Pawley. 1997. Production of offspring in the absence of males: evidence for facultative parthenogenesis in bisexual snakes. Herpetological Natural History 5:11-18. Groot, T. V. M., E. Bruins, and J. A. J. Breeuwer. 2003. Molecular genetic evidence for parthenogenesis in the Burmese python, Python molurus bivittatus. Heredity 90:130-135. Lenk, P., B. Eidenmueller, H. Staudter, R. Wicker, and M. Wink. 2005. A parthenogenetic Varanus. Amphibia-Reptilia 26:507-514. Magnusson, W. E. 1979. Production of an embryo by an Acrochordus javanicus isolated for seven years. Copeia 1979:744-745. McCracken, G. F., G. M. Burghardt, and S. E. Houts. 1999. Microsatellite markers and multiple paternity in the garter snake Thamnophis sirtalis. Molecular Ecology 8:1475-1479. Queller, D. C., J. E. Strassmann, and C. R. Hughes. 1993. Microsatellites and kinship. Trends in Ecology and Evolution 8:285-288. Rossman, D. A., N. B. Ford, and R. A. Seigel. 1996. The garter snakes: evolution and ecology. university of Oklahoma Press, Norman. Schuett, G. W., P. J. Fernandez, W. F. Gergits, N. J. Casna, D. Chiszar, H. M. Smith, J. B. Mitton, S. P. Mackessy, R. A. Odum, and M. J. Demlong. 1997. Production of offspring in the absence of males: evidence for facultative parthenogenesis in bisexual snakes. Herpetological Natural History 5:1-10. Simon, J.-C., F. Delmonte, C. Rispe, and T. Crease. 2003. Phylogenetic relationships between parthenogens and their sexual relatives: the possible routes to parthenogenesis in animals. Biological Journal of the Linnean Society 79:151-163. Skalka, P., and P. Vozenilek. 1986. Case of parthenogenesis in water snake, Nerodia sipedon. Fauna Bohemiae Septentrionalis 11:81-82. Trenton, W. J. G., P. B. Pearman, P. T. Gregory, S. G. Tomio, S. G. Wischniowski, and D. J. Hosken. 2004. Microsatellite markers developed from Thamnophis elegans and Thamnophis sirtalis and their utility in three species of garter snakes. Molecular Ecology 4: 369-371. Vrijenhoek, R. C., R. M. Dawley, C. J. Cole, and J. P. Bogart. 1989. A list of the known unisexual vertebrates. Pages 19-23 in Evolution and ecology of unisexual vertebrates (R. M. Dawley and J. P. Bogart, editors). New York State Museum, Albany, Bulletin 466:1-302. Watts, P. C., K. R. Buley, S. Sanderson, W. Boardman, C. Ciofi, and R. Gibson. 2006. Parthenogenesis in Komodo dragons. Nature 444:1020-1021. Wright, J. W. 1993. Evolution of the lizards of the genus Cnemidophorus. Pages 27-81 in Biology of whiptail lizards (genus Cnemidophorus) (J. W. Wright and L. J. Vitt, editors). Oklahoma Museum of Natural History, Norman. Associate Editor was William I. Lutterschmidt. David J. Germano * and Paul T. Smith Department of Biology, California State University, Bakersfield, CA 93311 * Correspondent: dgermano@csub.edu TABLE 1--Primers and results of microsatellite-fragment analysis
for four loci in each of four individual garter snakes
(Thamnophis), including a female T. couchii and her offspring.
Genotype/size of fragment (bp)
T. couchii T. couchii
Locus Primers (5'-3') (a) (female) (offspring)
Ts1 CGGCATAAATCTTATCTAGC 190/190 190/190
ACTTTTTCAGGCTGATGTTC
Ts2 GGCTAGCCCCTGTGTCCTT 150/150 150/150
CACAACTCCAAATATTGAAGATT
Ts3 CAACTGGCSGCTGTGATACAA 126/126 126/126
GTGTTAATGTGTTGGACAGGGC
Ts4 ACTGAACAAGTTGGGTGTAG 149/149 149/149
GCAAGAAGATGGCTATCTTG
Genotype/size of fragment (bp)
T. couchii T. ordinoides
Locus (outgroup) (outgroup)
Ts1 123/123 190/190
Ts2 150/150 151/175
Ts3 118/121 110/110
Ts4 148/148 152/152
(a) Primers are from McCracken et al. (1999). |
| Gale Copyright: | Copyright 2010 Gale, Cengage Learning. All rights reserved. |