Molecular epidemiology of Coxiella burnetii from ruminants in Q fever outbreak, the Netherlands.
Subject: Zoonoses (Genetic aspects)
Epidemiology
Goats
Authors: Roest, Hendrik I.J.
Ruuls, Robin C.
Tilburg, Jeroen J.H.C.
Nabuurs-Franssen, Marrigje H.
Klaassen, Corne H.W.
Vellema, Piet
van den Brom, Rene
Dercksen, Daan
Wouda, Willem
Spierenburg, Marcel A.H.
van der Spek, Arco N.
Buijs, Rob
de Boer, Albert G.
Willemsen, Peter Th.J.
van Zijderveld, Fred G.
Pub Date: 04/01/2011
Publication: Name: Emerging Infectious Diseases Publisher: U.S. National Center for Infectious Diseases Audience: Academic; Professional Format: Magazine/Journal Subject: Health Copyright: COPYRIGHT 2011 U.S. National Center for Infectious Diseases ISSN: 1080-6040
Issue: Date: April, 2011 Source Volume: 17 Source Issue: 4
Product: Product Code: 0214400 Goats NAICS Code: 11242 Goat Farming SIC Code: 0214 Sheep and goats
Geographic: Geographic Scope: Netherlands Geographic Code: 4EUNE Netherlands
Accession Number: 254403836
Full Text: Qfever is a zoonosis caused by Coxiella burnetii, an intracellular gram-negative bacterium that is prevalent throughout the world (1). Domestic ruminants are considered the main reservoir for Q fever in humans (2). However, other animal species, including pet animals, birds, and several species of arthropods, can be infected by C. burnetii and cause human cases of Q fever (2-5). The main clinical manifestations of Q fever in goats and sheep are abortion and stillbirth. In cattle, Q fever has been associated with sporadic abortion, subfertility, and metritis (4,6). With an abortion, up to 1 billion C. burnetii per gram of placenta can be excreted (7). Most animal species that carry C. burnetii show no symptoms (4). Transmission to humans occurs mainly through inhalation of contaminated aerosols (4,5,8-10).

Recently, 2 DNA-based methods for typing C. burnetii were reported (11-13). Multispacer sequence typing is based on DNA sequence variations in 10 short intergenic regions and can be performed on isolated C. burnetii strains or directly on extracted DNA from clinical samples (12,14,15). Multilocus variable-number tandem-repeat analyses (MLVA) is based on variation in repeat number in tandemly repeated DNA elements on multiple loci in the genome of C. burnetii and might be more discriminatory than multispacer sequence typing (13,15). MLVA also can be performed on C. burnetii strains (11,15) or directly on DNA extracted from clinical samples (16). A total of 17 different minisatellite and microsatellite repeat markers have been described (11).

Starting in 2007, the Netherlands has been confronted with one of the largest Q fever outbreaks in the world, involving 3,921 human cases in 4 successive years. On 28 dairy goat farms and 2 dairy sheep farms, abortion storms (with abortion rates up to 80%) caused by Q fever were diagnosed during 2005-2009. These small ruminants are considered the source of the human Q fever outbreak in the Netherlands (17). The connection between Q fever abortion storms in small ruminants and human Q fever cases is based primarily on epidemiologic investigations (18-21). A limited investigation by genotyping with MLVA recently showed that farms and humans in the Netherlands are infected by multiple different, yet closely related, genotypes of C. burnetii (16).

Although dairy goats and dairy sheep appear to be the source of the human Q fever outbreak in the Netherlands, no information is available about the genetic background of C. burnetii in these populations. This knowledge is essential for gaining insight into the molecular epidemiology of the organism and the origin of the outbreak, as well as for outbreak management purposes.

Our objective was to show the genetic background of C. burnetii in domestic ruminants responsible for the human Q fever outbreak. This information is necessary to evaluate the epidemiologic link between the source and human cases and to compare the outbreak genotypes with internationally known genotypes. During 2008-2010, a total of 125 C. burnetii-positive samples from 14 dairy goat farms, 1 dairy cattle farm, and 2 sheep farms were typed by MLVA. In addition, we show the geographic distribution of these C. burnetii genotypes across the Netherlands and compare the genotypes with what is internationally known.

Materials and Methods

Animal Samples

Our study comprised 14 dairy goat farms (farms A-E, H, J, M, N, O, P, Q, AE, and AF), 1 dairy cattle farm (farm R), and 2 sheep farms (1 dairy sheep farm Y and 1 sheep farm Z) sampled during the Q fever outbreak in the Netherlands (Table 1; Figure 1). On 12 of the 14 dairy goat farms, multiple abortions had occurred. On 2 dairy goat farms (farms J and M) and on the dairy sheep farm (farm Y), no abortions had occurred. On 1 dairy cattle farm and on the sheep farm (farm Z), C. burnetii was detected in a placenta after abortion. One goat farm (farm AG) sampled in 2001 was included with an archived histologic section of paraffin-embedded placenta from an abortion outbreak caused by C. burnetii infection.

[FIGURE 1 OMITTED]

Vaginal swabs and milk samples from dairy goats and dairy sheep were sent to the national reference laboratory for notifiable animal diseases (the Central Veterinary Institute, part of Wageningen UR) by the Dutch Food and Consumer Product Safety Authority in accordance with the regulation in place at that time. These samples were submitted for confirmation testing of farms with clinically suspected Q fever (farms A-D, N, O, P, and Q), for tracing the source of human Q fever cases (because of proximity to human case-patients, farms H, J, and M) or for bulk tank milk monitoring (farm Y). Samples of immunohistochemically confirmed Q fever-positive goat and sheep placentas (farms N, AE, AF, and Z) and fetal tissue (farm E) were provided by the Animal Health Service, including 1 archived histologic section of paraffin-embedded placenta from a C. burnetii abortion outbreak in a goat farm in 2001 (farm AG), which was diagnosed retrospectively (22). The sampled dairy goat farms represent 60% of the farms with known abortion problems during 2007-2009.

Testing of Samples before MLVA Typing

DNA was extracted from vaginal swabs and milk by using Chelex resin (InstaGene; Bio-Rad, Hercules, CA, USA). A vaginal swab tip or 200 [micro]L of milk was added to 400 [micro]L of Chelex suspension and incubated and shaken for 30 min at 56[degrees]C, followed by an incubation step for 8 min at 100[degrees]C. The clarified supernatant was used for PCR and MLVA. DNA from placentas was extracted by using a DNA tissue kit (DNeasy Blood and Tissue Kit; QIAGEN, Hilden, Germany). DNA from the paraffin-embedded placenta was extracted by using MagneSil Genomic Fixed Tissue System (Promega, Madison, WI, USA).

All samples were tested by an in-house real-time PCR directed toward the C. burnetii-specific IS1111a element (23). An inhibition control was constructed by using the primes of the IS1111a element (Table 2). PCR was performed on a 7500 Fast Real Time PCR system (Applied Biosystems, Foster City, CA, USA) by using 400 nmol/L of primers and 200 nmol/L of probes in 7 [micro]L PerfeCTa Multiplex qPCR Supermix, uracil-N-glycosylase (2x) (New England Biolabs, Ipswich, MA, USA] with Low Rox dye (Quanta BioSciences, Gaithersburg, MD, USA), 1 [micro]L of inhibition control, 5 [micro]L of sample, and 7 [micro]L of water. An initial uracil DNA glycosylase (UDG) incubation for 5 min at 45[degrees]C and denaturation/activation for 60 s at 95[degrees]C was followed by 40 cycles of denaturation for 10 s at 95[degrees]C, annealing for 30 s at 60[degrees]C. Results were generated with 7500 Fast System Software (Applied Biosystems).

MLVA Typing

MLVA typing was performed by using a selection of 10 of the 17 loci described by Arricau-Bouvery et al. (11) according to the Multiple Loci VNTR Analysis databases for genotyping (http://minisatellites.u-psud.fr/MLVAnet/querypub1.php), except that Ms12 was omitted because of poor performance, and Ms24 was added (Table 2). New primers were designed for Ms27 and Ms28 to improve performance. The annotation of Ms30, Ms31, and Ms36 was updated (P. Le Fleche, pers. comm.).

The PCR amplification was performed by using an Applied Biosystems 9700 thermocycler in a total volume of 25 [micro]L containing 1x reaction buffer, 1 U True Start Taq DNA polymerase (Fermentas, Glen Burnie, MD, USA), 2 mmol/L Mg[Cl.sub.2], O.2 mmol/L of each nucleotide (dATP, dGTP, dCTP, dUTP), O.5 [micro]mol/L of each primer, O.5 U UDG (New England Biolabs), and 2-5 [micro]L template. An initial UDG incubation for 5 min at 37[degrees]C and denaturation/ activation for 2 min at 95[degrees]C was followed by 40 cycles of denaturation for 30 s at 95[degrees]C, annealing for 30 s at 60/65[degrees]C, elongation for 30 s at 72[degrees]C, followed by a final extension step for 5 min at 72[degrees]C. After the amplification, 0.5 U UDG inhibitor (New England Biolabs) was added to the PCRs to prevent further UDG activity. Up to 4 different PCR products with different fluorescent dyes were diluted, depending on the PCR efficiency, and pooled. From these pooled PCR products, 4 [micro]L was mixed with 15 [micro]L of Hi-Di formamide (Applied Biosystems) and O.5 [micro]L of GeneScan 600 LIZ Size Standard (Applied Biosystems). After denaturation for 3 min at 96[degrees]C the samples were cooled on ice. The PCR products were separated on a 3130 Genetic Analyzer (Applied Biosystems) with a 36-cm array by using POP7 polymer.

The fragments were sized by using GeneMapper version 4.0 software (Applied Biosystems). The accuracy of the sizing obtained by capillary electrophoresis was determined by comparing sequencing data from the reference strain with the obtained fragment size from the capillary electrophoresis and corrected if necessary. The number of repeats for each locus was determined on the basis of the published and corrected annotation of the various loci (Table 2). Non-whole repeat numbers were rounded off mathematically. Reproducibility was checked with positive controls.

Data Analysis

The reference strain Nine Mile was used as reference (11). Analyses were performed, including only genotypes of C. burnetii containing [less than or equal to]2 loci with missing values. Numerical typing data were imported into BioNumerics v 6.1 (Applied Maths, Sint-Martens-Latem, Belgium) and analyzed with the multistate categorical similarity coefficient by using unweighted pair group method with arithmetic mean clustering. Missing values were imported as question marks. The genotypic diversity of the population under study was calculated by using the adapted Simpson index of diversity (Hunter-Gaston diversity index [HGDI]) (11,24).

Found MLVA patterns based on the number of repeats per locus were called MLVA types and identified as CbNLxx. We compared MLVA types with MLVA types in the publicly accessible Multiple Loci VNTR Analysis databases for genotyping: Coxiella2007 and Coxiella2009_Netherlands (access date 2001 Jan 11). The Nine Mile strain was used as reference.

Results

The study comprised 122 samples from 15 dairy goat farms, 2 samples from 1 dairy sheep farm, and 1 sample each from 1 sheep farm and 1 dairy cattle farm were included in this study (Table 1). Of the farms sampled during the outbreak, 13 were situated in the southern part of the Netherlands; 3 dairy goat farms (farms M, N, and AE) and 1 dairy sheep farm (farm Y) were located outside this area (Figure 1). From the 238 Q fever PCR-positive samples from the farms in this study, 125 (53%) yielded a genotype with [less than or equal to]2 missing values: 52 with a complete genotype, 48 with 1 missing value, and 25 with 2 missing values. 113 (47%) PCR-positive samples represented partial genotypes with 3-10 missing values. From the paraffin-embedded placenta (farm AG), only a partial genotype could be shown, with 6 repeats on Ms03 and 10 repeats on Ms34.

We distinguished 13 genotypes in the 125 samples (CbNL01-CbNL13; Table 1; Figures 1, 2). All C. burnetii genotypes could be associated with abortion, except for 2 (CbNL10, farm M and Y; and CbNL08, farm J; Figure 1). The relationship between the genotypes in all samples is shown in Figure 2, including the genotype of the reference strain Nine Mile and the reference genotype of the reference strain Nine Mile from Arricau-Bouvery et al. (11), which were identical.

The 13 genotypes are separated in 2 clusters (Figure 2). One cluster containing a genotype represented by 111 (90%) of the samples (CbNL01); 1 genotype (CbNL10) represented by 3 samples (1 from a dairy goat farm and 2 from a dairy sheep farm); and 10 genotypes (CbNL02-CbNL09 and CbNL11) represented by 1 sample, all from dairy goat farms. The second cluster was distinctly separated from the other cluster, representing 2 genotypes in 1 dairy goat sample (CbNL12), in 1 dairy cattle sample (CbNL13) and the paraffin-embedded placenta. In samples from dairy goat farms with abortion problems, the same genotype (CbNL01) was present in 110 (91%) of 121 samples. One sheep sample also showed this genotype (farm Z). The geographic distribution of the genotypes according to the location of the originating farm is given in Figure 1. The relationship between the genotypes found in this study and the internationally known genotypes are presented in the phylogenetic trees in Figure 3 on the basis of 4 loci and in Figure 4 on the basis of 9 loci.

Discussion

We performed MLVA typing of C. burnetii based on 10 loci on a large number of Q fever-positive samples to show the genetic background of C. burnetii in the domestic ruminants associated with the Q fever outbreak in humans in the Netherlands. In 125 (53%) of 237 samples, an adequate genotype for C. burnetii was generated. Previously, MLVA typing was performed on C. burnetii strains after primary isolation and cultivation (11,13,15) or, in the Netherlands, on only 11 clinical samples from humans, sheep, and goats with a selected number of 3 loci (16).

[FIGURE 2 OMITTED]

The main drawback of typing on clinical samples is the variable quality and amount of DNA. These drawbacks influence the typability of samples, resulting in partial genotypes; whether the missing values are caused by insufficient DNA concentrations and quality or by an absence of loci is unclear. If loci are absent, partial genotypes also are expected to be found in samples with high DNA loads. Such is not the case in our study. Typing of placenta material that contains high quantities of C. burnetii, as well as vaginal swabs with PCR cycle threshold ([C.sub.t]) values <32, yielded complete genotypes. In samples with [C.sub.t] values of 32-34, only partial genotypes were obtained. Samples with a [C.sub.t] value >34 were poorly typable.

Arricau-Bouvery et al. (11) calculated diversity indices for the 17 loci used in the MLVA, which varied from O.28 for locus Ms22 to O.86 for locus Ms34. The HGDI for the combined panels 1 and 2 of the MLVA typing method for C. burnetii can be calculated on O.99 and for panel 2 on O.92. These HGDIs are in the upper part of the O.438-0.997 range reported by Hunter and Gaston (24) for typing methods for various bacteria and yeasts.

The high diversity indices for the MLVA of C. burnetii indicate a high discriminating power, and this capability makes MLVA typing suitable for distinguishing C. burnetii isolates. With this highly discriminatory typing method, we found that 1 genotype of C. burnetii predominated on all dairy goat farms in the southern part of the Netherlands. On 12 of 14 dairy goat farms, this genotype was found in 91% of samples, varying per farm from 33% (farm E) to 100% (farms B, C, N-Q, Table 1, Figures 1 and 2). Although the sample size was small compared with the number of animals on the farm (Table 1), these data show that 1 genotype was far more common than other genotypes found on these farms. The 9 other genotypes occurred once, each representing only O.8% of all found genotypes on dairy goat farms. The most predominant genotype was found on all 11 dairy goat farms in the southern Netherlands and on a farm in the eastern part of the country (farm N). This finding strongly suggests a clonal spread of C. burnetii with this predominant genotype over the dairy goat farms in the southeastern part of the Netherlands.

The clonal spread of 1 genotype of C. burnetii could be explained by 2 phenomena. First, the dairy goat industry in the Netherlands sharply increased from almost 100,000 dairy goats in 2000 to >230,000 dairy goats on [approximately equal to]350 farms in 2009 (17). Most of these goats were bred in the Netherlands, which probably resulted in a microbial relationship between many of the dairy goat herds. In this theory, the C. burnetii strain with the most predominant genotype was present in the Netherlands for a long period before the abortion problems in dairy goats started in 2005. This theory is not supported by the results of the typing of the paraffin-embedded placenta from an aborted dairy goat who in 2001. The typing result differs on 2 loci from the most predominant genotype found in this study. Second, clonal spread could have been facilitated by emergence of a genotype of C. burnetii causing abortion in dairy goats that could then spread successfully over the dense goat population in the southeastern part of the country. Whether this genotype is more virulent is subject to research.

[FIGURE 3 OMITTED]

On the basis of comparison of MLVA types on 4 loci (Figure 3), CbNL01-06 could not be distinguished and were similar to the genotype of a person in the Netherlands (QPK2) and 2 genotypes from persons in France (Cb#88, Cb#97). The sample from a person in the Netherlands is derived from patient 2 reported by Klaassen et al. (16). Patient 2 is the farmer of farm A, where genotype CbNL01 predominated, as well as CbNL05 (Table 1). This shows a genetic link between the C. burnetii DNA from the farmer and his abortive goats, which suggests that the farmer was infected by his own goats. However, this link is based on only 4 loci on 1 human sample. To further confirm the link between dairy goats and humans, more samples need to be typed with more MLVA loci to increase the discriminatory power.

The human sample with ID QKP6 is the same sample as that from patient 4 reported by Klaassen et al. (16) and is most closely related to CbNL07. Human sample QKP1 is the same as that of patient 1. Patient 5 fits in the genotype cluster in the Netherlands, as does patient 2. The sheep reported by Klaassen et al. did not abort, and their samples show a difference of 1 repeat on Ms34 compared with CbNL01. On the basis of the comparison of MLVA types on 9 loci (Figure 4), all genotypes in this study can be distinguished. The most predominant genotype CbNL01 clusters with other genotypes (CbNL02-CbNL09,

CbNL11) and with 1 human sample (Cb#97) from France. CbNL01 differed from this human isolate on 2 loci (Ms30 and 36), which shows that the most predominant genotype in the Netherlands is unique. Whether this finding can be attributed to the small number of strains and clinical samples typed or is really a unique genotype is not yet clear. The closest relation to an isolate from France might give a clue about the origin of the genotype from the Netherlands.

[FIGURE 4 OMITTED]

The human Q fever outbreak in the Netherlands started in the southern part of the country and resulted in >3,500 human cases during 2007-2010. Dairy goats and dairy sheep are considered to be the source of this outbreak, primarily on the basis of epidemiologic findings (10,17,20,21,25,26). In our study, samples were typed from farms suspected of being the source of the human Q fever outbreak. Results show that 1 genotype of C. burnetii predominated in the dairy goats and sheep in the human Q fever outbreak area in the southern part of the Netherlands, and this genotype also was present in a human case-patient in the Netherlands. This C. burnetii genotype is expected to have played a key role in the Q fever outbreak in small ruminants in the Netherlands and was also transmitted widely to humans, causing Q fever in the human population. If this hypothesis holds true, C. burnetii with the same genotype as in dairy goats should be found in most samples from human Q fever patients. To this end, a study was performed to show the genetic background of human C. burnetii isolates in the Netherlands by using a concordant MLVA typing method (J.J.H.C. Tilburg et al., unpub. data). Furthermore, the uniqueness of the predominant genotype of C. burnetii for the Netherlands can be part of the explanation why the magnitude of the Q fever outbreak in the Netherlands has never been seen elsewhere.

Acknowledgments

We thank Gert Jan Boender and Fred van Welie for preparing the graphs. We also thank N. Groot Niebelink for providing the Q fever PCR-positive placenta from an abortive cow (farm R) and D. Frangoulidis for providing the C. burnetii reference strain Nine Mile RSA 493.

This study was supported by the Dutch Ministry of Agriculture, Nature and Food Quality.

Dr Roest is a veterinarian at the Central Veterinary Institute, part of Wageningen UR. He is project leader for the Q fever in goats project, was active in the management of the Q fever outbreak in the Netherlands, and has a special interest in zoonotic bacterial diseases.

DOI: 10.3201/eid1704.101562

References

(1.) Raoult D, Marrie TJ, Mege JL. Natural history and pathophysiology of Q fever. Lancet Infect Dis. 2005;5:219-26. DOI: 10.1016/S14733099(05)70052-9

(2.) Woldehiwet Z. Q fever (coxiellosis): epidemiology and pathogenesis. Res Vet Sci. 2004;77:93-100. DOI: 10.1016/j.rvsc.2003.09.001

(3.) Babudieri B, Moscovici C. Experimental and natural infection of birds by Coxiella burneti. Nature. 1952;169:195-6. DOI: 10.1038/169195a0

(4.) Arricau-Bouvery N, Rodolakis A. Is Q fever an emerging or reemerging zoonosis? Vet Res. 2005;36:327-49. DOI: 10.1051/vetres:2005010

(5.) Angelakis E, Raoult D. Q fever. Vet Microbiol. 2010;140:297-309. DOI: 10.1016/j.vetmic.2009.07.016

(6.) Muskens J, Mars MH, Franken P. Q fever: an overview [in Dutch]. Tijdschr Diergeneeskd. 2007;132:912-7.

(7.) Arricau Bouvery N, Souriau A, Lechopier P, Rodolakis A. Experimental Coxiella burnetii infection in pregnant goats: excretion routes. Vet Res. 2003;34:423-33. DOI: 10.1051/vetres:2003017

(8.) Marrie TJ. Q fever. Volume I: the disease. Boca Raton (FL): CRC Press; 1990.

(9.) Maurin M, Raoult D. Q fever. Clin Microbiol Rev. 1999;12:518-53.

(10.) Schimmer B, Dijkstra F, Vellema P, Schneeberger PM, Hackert V, ter Schegget R, et al. Sustained intensive transmission of Q fever in the south of the Netherlands, 2009. Euro Surveill. 2009;14: pii: 19210.

(11.) Arricau-Bouvery N, Hauck Y, Bejaoui A, Frangoulidis D, Bodier CC, Souriau A, et al. Molecular characterization of Coxiella burnetii isolates by infrequent restriction site-PCR and MLVA typing. BMC Microbiol. 2006;6:38. DOI: 10.1186/1471-2180-6-38

(12.) Glazunova O, Roux V, Freylikman O, Sekeyova Z, Fournous G, Tyczka J, et al. Coxiella burnetii genotyping. Emerg Infect Dis. 2005;11:1211-7.

(13.) Svraka S, Toman R, Skultety L, Slaba K, Homan WL. Establishment of a genotyping scheme for Coxiella burnetii. FEMS Microbiol Lett. 2006;254:268-74. DOI: 10.1111/j.1574-6968.2005.00036.x

(14.) Mediannikov O, Fenollar F, Socolovschi C, Diatta G, Bassene H, Molez JF, et al. Coxiella burnetii in humans and ticks in rural Senegal. PLoS Negl Trop Dis. 2010;4:e654. DOI: 10.1371/journal.pntd.0000654

(15.) Chmielewski T, Sidi-Boumedine K, Duquesne V, Podsiadly E, Thiery R, Tylewska-Wierzbanowska S. Molecular epidemiology of Q fever in Poland. Pol J Microbiol. 2009;58:9-13.

(16.) Klaassen CH, Nabuurs-Franssen MH, Tilburg JJ, Hamans MA, Horrevorts AM. Multigenotype Q fever outbreak, the Netherlands. Emerg Infect Dis. 2009;15:613-4. DOI: 10.3201/eid1504.081612

(17.) Roest HI, Tilburg JJ, van der Hoek W, Vellema P, van Zijderveld FG, Klaassen CH, et al. The Q fever epidemic in the Netherlands: history, onset, response and reflection. Epidemiol Infect. 2011;139:1-12. DOI: 10.1017/S0950268810002268

(18.) Van Steenbergen JE, Morroy G, Groot CA, Ruikes FG, Marcelis JH, Speelman P. An outbreak of Q fever in the Netherlands-possible link to goats [in Dutch]. Ned Tijdschr Geneeskd. 2007;151:1998-2003.

(19.) Koene RP, Schimmer B, Rensen H, Biesheuvel M, de Bruin A, Lohuis A, et al. A Q fever outbreak in a psychiatric care institution in the Netherlands. Epidemiol Infect. 2011;139:13-8.

(20.) Karagiannis I, Schimmer B, Van Lier A, Timen A, Schneeberger P, Van Rotterdam B, et al. Investigation of a Q fever outbreak in a rural area of the Netherlands. Epidemiol Infect. 2009;137:1283-94. DOI: 10.1017/S0950268808001908

(21.) Karagiannis I, Morroy G, Rietveld A, Horrevorts AM, Hamans M, Francken P, et al. Q fever outbreak in the Netherlands: a preliminary report. Euro Surveill. 2007;12:E070809.2.

(22.) Wouda W, Dercksen DP. Abortion and stillbirth among dairy goats as a consequence of Coxiella burnetii [in Dutch]. Tijdschr Dierge neeskd. 2007;132:908-11.

(23.) Klee SR, Tyczka J, Ellerbrok H, Franz T, Linke S, Baljer G, et al. Highly sensitive real-time PCR for specific detection and quantification of Coxiella burnetii. BMC Microbiol. 2006;6:2. DOI: 10.1186/1471-2180-6-2

(24.) Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems: an application of Simpson's index of diversity. J Clin Microbiol. 1988;26:2465-6.

(25.) Schimmer B, Morroy G, Dijkstra F, Schneeberger PM, Weers-Pothoff G, Timen A, et al. Large ongoing Q fever outbreak in the south of the Netherlands, 2008. Euro Surveill. 2008;13:pii:18939.

(26.) van der Hoek W, Dijkstra F, Schimmer B, Schneeberger PM, Vellema P, Wijkmans C, et al. Q fever in the Netherlands: an update on the epidemiology and control measures. Euro Surveill. 2010;15:pii:19520.

Address for correspondence: Hendrik I.J. Roest, Central Veterinary Institute of Wageningen UR, Edelhertweg 15, 8219 PH Lelystad, the Netherlands; email: hendrikjan.roest@wur.nl

All material published in Emerging Infectious Diseases is in the public domain and may be used and reprinted without special permission; proper citation, however, is required.

Hendrik I.J. Roest, Robin C. Ruuls, Jeroen J.H.C. Tilburg, Marrigje H. Nabuurs-Franssen, Corne H.W. Klaassen, Piet Vellema, Rene van den Brom, Daan Dercksen, Willem Wouda, Marcel A.H. Spierenburg, Arco N. van der Spek, Rob Buijs, Albert G. de Boer, Peter Th.J. Willemsen, and Fred G. van Zijderveld

Author affiliations: Central Veterinary Institute, part of Wageningen UR, Lelystad, the Netherlands (H.I.J. Roest, R.C. Ruuls, R. Buijs, A.G. de Boer, P.Th.J. Willemsen, F.G. van Zijderveld); Canisius Wilhelmina Hospital, Nijmegen, the Netherlands (J.J.H.C. Tilburg, M.H. Nabuurs-Franssen, C.H.W. Klaassen); Radboud University Medical Center, Nijmegen (M.H. Nabuurs-Franssen); Animal Health Service, Deventer, the Netherlands (P. Vellema, R. van den Brom, D. Dercksen, W. Wouda); and Food and Consumer Product Safety Authority, The Hague, the Netherlands (M.A.H. Spierenburg, A.N. van der Spek)
Table 1. Overview of Coxiella burnetii genotyping results for farms
sampled during human Q fever outbreak, the Netherlands, 2007-2010 *

                           MLVA typing results

                                     No.
Farm ID   Sample type      MLVA ID   samples    Animal species

A         Vaginal swabs    CbNL01       7       Dairy goats
                           CbNL05       1
                           CbNL07       1
B         Vaginal swabs    CbNL01       5       Dairy goats
C         Vaginal swabs    CbNL01       20      Dairy goats
D         Vaginal swabs    CbNL01       6       Dairy goats
                           CbNL04       1
E         Fetal tissue     CbNL01       1       Dairy goats
                           CbNL09       1
                           CbNL11       1
H         Vaginal swabs    CbNL01       7       Dairy goats
                           CbNL02       1
J         Vaginal swabs    CbNL01       2       Dairy goats
                           CbNL08       1
M         Vaginal swabs    CbNL10       1       Dairy goats
N         Vaginal swabs    CbNL01       20      Dairy goats
          Placenta         CbNL01       1
O         Vaginal swabs    CbNL01       14      Dairy goats
                           CbNL03       1
                           CbNL06       1
          Milk             CbNL01       1
P         Vaginal swabs    CbNL01       6       Dairy goats
Q         Vaginal swabs    CbNL01       19      Dairy goats
AE        Placenta         CbNL12       1       Dairy goats
AF        Placenta         CbNL01       1       Dairy goats
AG        Paraffin-                     1       Dairy goats
          embedded
          placenta
R         Placenta         CbNL13       1       Dairy cattle
Y         Vaginal swabs    CbNL10       1       Dairy sheep
          Bulk tank milk   CbNL10       1
          sample
Z         Placenta         CbNL01       1       Sheep

                           MLVA typing results

                                     No.        Approximate
Farm ID   Sample type      MLVA ID   samples    herd size

A         Vaginal swabs    CbNL01       7       617
                           CbNL05       1
                           CbNL07       1
B         Vaginal swabs    CbNL01       5       598
C         Vaginal swabs    CbNL01       20      546
D         Vaginal swabs    CbNL01       6       1,498
                           CbNL04       1
E         Fetal tissue     CbNL01       1       1,568
                           CbNL09       1
                           CbNL11       1
H         Vaginal swabs    CbNL01       7       606
                           CbNL02       1
J         Vaginal swabs    CbNL01       2       459
                           CbNL08       1
M         Vaginal swabs    CbNL10       1       769
N         Vaginal swabs    CbNL01       20      1,187
          Placenta         CbNL01       1
O         Vaginal swabs    CbNL01       14      83
                           CbNL03       1
                           CbNL06       1
          Milk             CbNL01       1
P         Vaginal swabs    CbNL01       6       548
Q         Vaginal swabs    CbNL01       19      340
AE        Placenta         CbNL12       1       500
AF        Placenta         CbNL01       1       2,000
AG        Paraffin-                     1       590
          embedded
          placenta
R         Placenta         CbNL13       1       70
Y         Vaginal swabs    CbNL10       1       184
          Bulk tank milk   CbNL10       1
          sample
Z         Placenta         CbNL01       1       2

                           MLVA typing results

                                     No.        Year of
Farm ID   Sample type      MLVA ID   samples    sampling

A         Vaginal swabs    CbNL01       7       2008
                           CbNL05       1
                           CbNL07       1
B         Vaginal swabs    CbNL01       5       2008
C         Vaginal swabs    CbNL01       20      2008
D         Vaginal swabs    CbNL01       6       2008
                           CbNL04       1
E         Fetal tissue     CbNL01       1       2008
                           CbNL09       1
                           CbNL11       1
H         Vaginal swabs    CbNL01       7       2008
                           CbNL02       1
J         Vaginal swabs    CbNL01       2       2008
                           CbNL08       1
M         Vaginal swabs    CbNL10       1       2008
N         Vaginal swabs    CbNL01       20      2009
          Placenta         CbNL01       1
O         Vaginal swabs    CbNL01       14      2009
                           CbNL03       1
                           CbNL06       1
          Milk             CbNL01       1
P         Vaginal swabs    CbNL01       6       2009
Q         Vaginal swabs    CbNL01       19      2009
AE        Placenta         CbNL12       1       2007
AF        Placenta         CbNL01       1       2007
AG        Paraffin-                     1       2001
          embedded
          placenta
R         Placenta         CbNL13       1       2007
Y         Vaginal swabs    CbNL10       1       2010
          Bulk tank milk   CbNL10       1
          sample
Z         Placenta         CbNL01       1       2009

                           MLVA typing results

                                                Approximate
                                                abortions
                                     No.        in year of
Farm ID   Sample type      MLVA ID   samples    sampling, %

A         Vaginal swabs    CbNL01       7       25
                           CbNL05       1
                           CbNL07       1
B         Vaginal swabs    CbNL01       5       20
C         Vaginal swabs    CbNL01       20      25
D         Vaginal swabs    CbNL01       6       19
                           CbNL04       1
E         Fetal tissue     CbNL01       1       8 (2007)
                           CbNL09       1
                           CbNL11       1
H         Vaginal swabs    CbNL01       7       80
                           CbNL02       1
J         Vaginal swabs    CbNL01       2       None
                           CbNL08       1
M         Vaginal swabs    CbNL10       1       None
N         Vaginal swabs    CbNL01       20      25
          Placenta         CbNL01       1
O         Vaginal swabs    CbNL01       14      7
                           CbNL03       1
                           CbNL06       1
          Milk             CbNL01       1
P         Vaginal swabs    CbNL01       6       10
Q         Vaginal swabs    CbNL01       19      10
AE        Placenta         CbNL12       1       >5
AF        Placenta         CbNL01       1       >5
AG        Paraffin-                     1       >5
          embedded
          placenta
R         Placenta         CbNL13       1       <5
Y         Vaginal swabs    CbNL10       1       None
          Bulk tank milk   CbNL10       1
          sample
Z         Placenta         CbNL01       1       50

                           MLVA typing results

                                                No.
                                     No.        samples
Farm ID   Sample type      MLVA ID   samples    tested

A         Vaginal swabs    CbNL01       7       20
                           CbNL05       1
                           CbNL07       1
B         Vaginal swabs    CbNL01       5       20
C         Vaginal swabs    CbNL01       20      20
D         Vaginal swabs    CbNL01       6       39
                           CbNL04       1
E         Fetal tissue     CbNL01       1       3
                           CbNL09       1
                           CbNL11       1
H         Vaginal swabs    CbNL01       7       13
                           CbNL02       1
J         Vaginal swabs    CbNL01       2       3
                           CbNL08       1
M         Vaginal swabs    CbNL10       1       2
N         Vaginal swabs    CbNL01       20      20
          Placenta         CbNL01       1       1
O         Vaginal swabs    CbNL01       14      40
                           CbNL03       1
                           CbNL06       1
          Milk             CbNL01       1       1
P         Vaginal swabs    CbNL01       6       20
Q         Vaginal swabs    CbNL01       19      25
AE        Placenta         CbNL12       1       1
AF        Placenta         CbNL01       1       1
AG        Paraffin-                     1       11
          embedded
          placenta
R         Placenta         CbNL13       1       1
Y         Vaginal swabs    CbNL10       1       5
          Bulk tank milk   CbNL10       1       1
          sample
Z         Placenta         CbNL01       1       1

                           MLVA typing results

                                                No. samples
                                     No.        included in
Farm ID   Sample type      MLVA ID   samples    study

A         Vaginal swabs    CbNL01       7       9
                           CbNL05       1
                           CbNL07       1
B         Vaginal swabs    CbNL01       5       5
C         Vaginal swabs    CbNL01       20      20
D         Vaginal swabs    CbNL01       6       7
                           CbNL04       1
E         Fetal tissue     CbNL01       1       3
                           CbNL09       1
                           CbNL11       1
H         Vaginal swabs    CbNL01       7       8
                           CbNL02       1
J         Vaginal swabs    CbNL01       2       3
                           CbNL08       1
M         Vaginal swabs    CbNL10       1       1
N         Vaginal swabs    CbNL01       20      20
          Placenta         CbNL01       1       1
O         Vaginal swabs    CbNL01       14      16
                           CbNL03       1
                           CbNL06       1
          Milk             CbNL01       1       1
P         Vaginal swabs    CbNL01       6       6
Q         Vaginal swabs    CbNL01       19      19
AE        Placenta         CbNL12       1       1
AF        Placenta         CbNL01       1       1
AG        Paraffin-                     1
          embedded
          placenta
R         Placenta         CbNL13       1       1
Y         Vaginal swabs    CbNL10       1       1
          Bulk tank milk   CbNL10       1       1
          sample
Z         Placenta         CbNL01       1       1

* ID, identification; MLVA, multilocus variable-number
tandem-repeat analysis.

Table 2. Primers and probes used in the PCR for detecting Coxiella
burnetii in clinical samples and loci and primers for MLVA of C.
burnetii, the Netherlands, 2007-2010 *

Identification                Temp, [degrees]C

Primers IS1111a                       60
Probe IS1111a                         60
Probe inhibition control              60
Cbu0448_ms03_12bp_7U_229bp            60
Cbu1963_ms21_ 12bp_6U_210bp           60
Cbu1980_ms22_ 11bp_6U_246bp           60
Cbu0259_ms24_7bp_27U_344bp            65
Cbu0838_ms27_6bp_4U_320bp             65
  ([dagger])
Cbu0839_ms28_6bp_6U_480bp             60
  ([dagger])
Cbu1351_ms30_ 18bp_6U_306bp           60
  ([double dagger])
Cbu1418_ms31_7bp_5U_285bp             60
  ([double dagger])
Cbu1471_ms34_6bp_5U_210bp             60
Cbu1941_ms36_9bp_4U_477bp         65
  ([dagger])
                              Primer sequence for MLVA,
                              with label indicated, 5'
                              [right arrow] 3'

Identification                Forward

Primers IS1111a               CATCACATTGCCGCGTTTAC
Probe IS1111a                 AATCCCCAACAACACCTCCTTATTCCCAC
Probe inhibition control      ACATAATCTCTCCGACCCCACACTTCCATAC
Cbu0448_ms03_12bp_7U_229bp    6-FAM-TTGTCGATAAATCGGGAAACTT
Cbu1963_ms21_ 12bp_6U_210bp   NED-AGCATCTGCCTTCTCAAGTTTC
Cbu1980_ms22_ 11bp_6U_246bp   PET-GGGGTTTGAACATAGCAATACC
Cbu0259_ms24_7bp_27U_344bp    VIC-ATGAAGAAAGGATGGAGGGACT
Cbu0838_ms27_6bp_4U_320bp     6-FAM-GGGTCAGGTGGCGGGTGTG
  ([dagger])
Cbu0839_ms28_6bp_6U_480bp     VIC-TAGAAACCGATAATCCCCTTGACA
  ([dagger])
Cbu1351_ms30_ 18bp_6U_306bp   NED-ATTTCCTCGACATCAACGTCTT
  ([double dagger])
Cbu1418_ms31_7bp_5U_285bp     PET-GGGCATCTAATCGAGATAATGG
  ([double dagger])
Cbu1471_ms34_6bp_5U_210bp     6-FAM-TGACTATCAGCGACTCGAAGAA
Cbu1941_ms36_9bp_4U_477bp     VIC-GAAACCAGTCTTCCCTCAACAG
  ([dagger])

                              Primer sequence for MLVA,
                              with label indicated, 5'
                              [right arrow] 3'

Identification                Reverse

Primers IS1111a               GGTTGGTCCCTCGACAACAT
Probe IS1111a
Probe inhibition control
Cbu0448_ms03_12bp_7U_229bp    CACTGGGAAAAGGAGAAAAAGA
Cbu1963_ms21_ 12bp_6U_210bp   TGGGAGGTAGAAGAAAAGATGG
Cbu1980_ms22_ 11bp_6U_246bp   CAATATCTCTTTCTCCCGCATT
Cbu0259_ms24_7bp_27U_344bp    GATAGCCTGGACAGAGGACAGT
Cbu0838_ms27_6bp_4U_320bp     TTCTCGCAAACGTCGCACTAACTC
  ([dagger])
Cbu0839_ms28_6bp_6U_480bp     ATTCCGCCGCCATTGAG
  ([dagger])
Cbu1351_ms30_ 18bp_6U_306bp   AGTCGATTTGGAAACGGATAAA
  ([double dagger])
Cbu1418_ms31_7bp_5U_285bp     TTTGAGAAAATTTTGGGTGCTT
  ([double dagger])
Cbu1471_ms34_6bp_5U_210bp     TCGTGCGTTAGTGTGCTTATCT
Cbu1941_ms36_9bp_4U_477bp     ATAACCGTCATCGTCACCTTCT
  ([dagger])

* MLVA, multilocus variable-number tandem-repeat analyses; temp,
annealing temperature.

([dagger]) Different primer set from the proposed set by
Arricau-Bouvery et al. (11).

([double dagger]) Updated after personal communication with Le
Fleche, Universite Paris-Sud, Orsay Cedex, France.
Gale Copyright: Copyright 2011 Gale, Cengage Learning. All rights reserved.