|
Molecular cloning, tissue distribution and expression
of porcine [y.sup.+]L amino acid transporter-1.
|
|
|
|
|
| Abstract: | In this study, we cloned, sequenced and characterized porcine y+L Amino Acid Transporter-1 (y+LAT1). By screening a translated EST database with the protein sequence of the human [y.sup.+]LAT1 and by using rapid amplification of cDNA ends (RACE), the full-length cDNA encoding porcine [y.sup.+]LAT1 was isolated from porcine intestine RNA. It was 2,111 bp long, encoding a 511 amino acid trans-membrane glycoprotein composed of 12 transmembrane domains. The predicted amino acid sequence was found to be 91%, 90%, 87% and 87% identical to those of cattle, human, mouse and rat [y.sup.+]LAT1 respectively. Real-time RT-PCR results indicated that the small intestine had the highest [y.sup.+]LAT1 mRNA abundance and the lung had the lowest [y.sup.+]LAT1 mRNA abundance. Baby hamster kidney (BHK) cells transfected with green fluorescent protein (GFP) tagged porcine [y.sup.+]LAT1 cDNA indicated that the cellular localization of the gene product in BHK was on the plasma membrane. (Key Words : Cloning, Pig, Amino Acid Transporter, [y.sup.+]LAT1, SLC7A7) |
|
|
|
| Article Type: | Report |
| Subject: |
Cellular control mechanisms
(Methods) Carrier proteins (Research) Amino acid metabolism (Research) Antisense DNA (Research) Swine (Genetic aspects) |
| Authors: |
Zhi, Ai-min Zhou, Xiang-yan Zuo, Jian-jun Zou, Shi-geng Huang, Zhi-yi Wang, Xiao-lan Tao, Lin Feng, Ding-yuan |
| Pub Date: | 02/01/2010 |
| Publication: | Name: Asian - Australasian Journal of Animal Sciences Publisher: Asian - Australasian Association of Animal Production Societies Audience: Academic Format: Magazine/Journal Subject: Agricultural industry; Biological sciences Copyright: COPYRIGHT 2010 Asian - Australasian Association of Animal Production Societies ISSN: 1011-2367 |
| Issue: | Date: Feb, 2010 Source Volume: 23 Source Issue: 2 |
| Topic: | Event Code: 310 Science & research |
| Product: | Product Code: 0213000 Hogs NAICS Code: 11221 Hog and Pig Farming SIC Code: 0213 Hogs |
| Geographic: | Geographic Scope: China Geographic Code: 9CHIN China |
| Accession Number: | 218449464 |
| Full Text: |
INTRODUCTION Five transport systems that mediate the uptake of cationic amino acids (CAA) are known: the [Na.sup.+] dependent system [B.sup.0,+], [Na.sup.+] independent system [b.sup.+], system [y.sup.+], system [y.sup.+]L and system [b.sup.0,+]. cDNAs encoding the [B.sup.0], + AT and CAT-2 of pigs have been reported by our groups (Zhi Ai-min et al., 2008; Zou Shi-geng et al., 2009). The SLC7A7 (HGMW-approved gene symbol SLC7A7, solute carrier family 7, member 7) gene encodes [y.sup.+]LAT1 ([y.sup.+]L amino acid transporter-1) and interacts with 4F2hc (4F2 heavy chain), responsible for the system [y.sup.+]L amino acid transport activity at the membrane (Torrents et al., 1999). System [y.sup.+]L is an antiporter, which exchanges cationic amino acids for large neutral amino acids, cotransported with [Na.sup.+], and plays a very important role in basic cellular functions such as cell volume regulation, the synthesis of glutathione (GSH), provision of amino acids for protein synthesis, and energy metabolism (Torrents et al., 1999). System [y.sup.+]L consists of two subunits, a polytopic membrane protein (light chain, SLC7 family) and an associated type II membrane protein (heavy chain, SLC3 family) subunit (Dall'Asta et al., 2000; Verrey et al., 2000; Chillaron et al., 2001). The heavy chain rBAT (i.e., related to [b.sup.0,+] amino acid transport) associates with the light chain [b.sup.0,+], + AT ([b.sup.0,+] amino acid transporter) to form the amino acid transport system [b.sup.0,+] isoforms (Verrey et al., 1999), whereas the homologous heavy chain 4F2hc (heavy chain of the surface antigen 4F2) interacts with several light chains (LSHATs; SLC7 family members) to form system L isoforms (with LAT1 and LAT2) (Gottesdiener et al., 1988), system [y.sup.+]L isoforms (with [y.sup.+]LAT1 and [y.sup.+]LAT2) (Pfeiffer et al., 1999), system [x.sub.c.sup.-] isoforms (with xCT) (Bassi et al., 2001), or system asc isoforms (with asc1), and two (asc2 and AGT-1) seem to interact with as yet unknown heavy subunits (Verrey et al., 2004). System [y.sup.+]L was first functionally described in erythrocytes (Deves et al., 1992). Further investigation revealed its presence in placenta (Novak et al., 1997), platelets (Mendes Ribeiro et al., 1999), skin fibroblasts (Dall'Asta et al., 2000), hepatocytes (Pineda et al., 1999), small intestine and kidney. The light subunit ([y.sup.+]LAT1) has 12 transmembrane domains with the N[H.sub.2] and COOH termini located intracellularly (Mastroberardino et al., 1998; Sato et al., 1999) and is linked by a single disulfide bond at Cys109 of 4F2hc (Palacin et al., 1998; Chillaron et al., 2001). Functionally, [y.sup.+]LAT1 obeys an obligatory exchange mechanism, transporting dibasic amino acids in the absence of [Na.sup.+] and neutral amino acids in the presence of [Na.sup.+] (Pfeiffer et al., 1999). It seems that [y.sup.+]LAT1 preferentially mediates the efflux of arginine, which may be important in the kidney, where arginine is produced from citrulline and released into the blood to supply the rest of the body (Broer et al., 2000). In contrast with intensive studies on the structure and function of human and mouse [y.sup.+]LAT1, there have been few studies on other animals, including pigs. Therefore, the goal of the present study was to clone the [y.sup.+]LAT1 gene of pigs and characterize it. Identification of porcine [y.sup.+]LAT1 will aid in understanding cationic amino acid metabolism and may help in discovering new functions of SLC7A7 in porcine nutrition and physiology. MATERIALS AND METHODS BHK were maintained in Dulbecco's modified Eagle's minimal essential medium (Gebico) supplemented with 10% fetal bovine serum and antibiotics (100 [micro]/ml penicillin, 100 [micro]g/ml streptomycin, 20 [micro]g/ml gentamicin, and 2 [micro]g/ml Fungizone). Tissue sample collection Six 60-day-old, crossbred pigs were purchased from a commercial farm. They were euthanized with an overdose injection of 10% sodium pentobarbital before sampling. The heart, liver, lung, kidney, brain, muscle, and intestines were separated. The isolated tissue samples were immediately put into liquid nitrogen for deep-freezing after flushing with ice-cold saline (154 mM NaCl, 0.1 mM PMSF, pH 7.4). Then, each tube, which contained approximately 10 g of tissue, was tightly capped and stored at -80[degrees]C. RNA extraction and cDNA synthesis Total tissue (intestines) RNA was isolated from 100 mg of intestine using TRIZOL reagent (Invitrogen, Carlsbad, CA, USA) and digested by DNase ? according to the manufacturer's protocol (TAKARA, Dalian, China). The concentration of RNA solution was determined spectrophotometrically and the quality was verified by visualization of 2:1 intensity ratio of 28S vs. 18S rRNA bands over UV light after electrophoresis through a 1% ethidium bromide stain agarose gel. The RNA had an OD260:OD280 ratio between 1.8-2.0. Synthesis of the first strand cDNA was performed with oligo (dt) 20 and Superscript II reverse transcriptase (Invitrogen). Cloning strategy A translated Expressed Sequence Tag (EST) was screened from the translated Expressed Sequence Tags database (which is composed of sequences from species other than humans or mice) at the National Center for Biotechnological Information (NCBI) using the human SLC7A7 protein sequence. This identified one EST sequence (GenBank accession no: DB794205) that showed high homology to the human SLC7A7. PCR primers (ZA1, ZA2) were designed based on this sequence. PCR was performed as described below: 94[degrees]C for 5 min, followed by 35 cycles of amplification (94[degrees]C for 30 s, 68[degrees]C for 30 s, 72[degrees]C for 40 s). After the PCR product was sequenced and homologically compared to certify that it was porcine SLC7A7 on the basis of sequence, porcine SLC7A7 gene-specific primers were synthesized and 3'/5' RACE were carried out according to the manufacturer's instructions (BD Biosciences Clontech). Briefly, the first strand cDNA was generated from 1 [micro]g total RNA using 3' RACE CDS primer (3' CDS) and 5'-CDS/SMART II (Clontech) for 3' RACE and 5' RACE, respectively. For 3' RACE, the amplification reaction was performed by first touch down PCR for 40 cycles (94[degrees]C for 5 min, 94[degrees]C for 30 s, 70[degrees]C, 65[degrees]C, 61[degrees]C for 30 s respectively, and 72[degrees]C for 10 min) using the GSP2 and the UPM (universal primer mix). After the first PCR, the second (nest) PCR was performed under similar conditions using nest primer NGSP2 and the NUP (nest universal primer). For 5' RACE, a similar amplification reaction but with a 3-min elongation time was carried out using the forward primer (UPM and NUP) and reverse primer GSP1 and NGSP1. The obtained fragment was subsequently cloned and sequenced. Based on the newly obtained sequence for the full-length cDNA, a pair of PCR primers, forward primer ZY1 and reverse primer ZY2, were designed to amplify the sequence covering the ORF (open reading frame) of porcine SLC7A7. All primers except the primers provided by Clontech RACE kit are shown in Table 1. Sequence and structural analysis The RACE products were gel-purified and cloned into the pGMT vector (Invitrogen). After transformation into Escherichia coli, the plasmid purifications from the overnight-grown colonies were done and the cloned cDNA was sequenced. Nucleotide and amino acid sequence alignment was analyzed with the DNAMAN software package. Homology searches were performed using BLAST and FASTA at the National Center for Biotechnological Information (NCBI) and DNA Data Bank of Japan (DDBJ). Detection of porcine SLC7A7 tissue distribution by Zhi et al. (2010) Asian-Aust. J. Anim. Sci. 23(2):272-278 Real-time RT-PCR analysis Real-time PCR was performed using one-step SYBR Green PCR Mix (Takara, Dalian, China), containing Mg[Cl.sub.2], dNTP, and Hotstar Taq polymerase. Two microlitres of cDNA template was added to a total volume of 25 [micro]l containing 12.5 [micro]l SYBR Green mix, 0.25 [micro]l RT mix and 1 [micro]M each of forward and reverse primers shown in Table 1. Primers for 18S were designed with Primer 5 based on porcine sequence (Accession No. AY390526). The following protocol was used: i) denaturation program (15 min at 95[degrees]C); ii) amplification and quantification program, repeated 40 cycles (15 s at 95[degrees]C, 15 s at 58[degrees]C, 15 s at 72[degrees]C); iii) melting curve program (60-99[degrees]C with heating rate of 0.1[degrees]C s-1 and fluorescence measurement). An abundantly expressed gene, 18S, was used as the internal control to normalize the amount of starting RNA used for RT-PCR for all samples. Amplification and melt curve analysis were performed in an ABI 7500 (Applied BioSystems). Melt curve analysis was conducted to confirm the specificity of each product, and the size of products was verified on ethidium bromide-stained 2% agarose gels in Tris acetate-EDTA buffer. The identity of each product was confirmed by dideoxy-mediated chain termination sequencing at Takara Biotechnology, Inc. The relative expression ratio (R) of mRNA was calculated by [2-.sup.[DELTA]Ct] (Livak and Schmittgen, 2001). Real-time PCR efficiencies were acquired by amplification of dilution series of RNA according to the equation 10 (-1/slope) and were consistent between target mRNA and 18S. Negative controls were performed in which water was substituted for RNA. Transient expression of porcine SLC7A7 in BHK cells For subcellular localization studies, the plasmid encoding the porcine [y.sup.+]LAT1-GFP fusion protein was constructed as described below. Briefly, a porcine SLC7A7 cDNA containing the full-length CDS of porcine SLC7A7 was obtained using the following PCR primers (ZM1, ZM2) shown in Table 1. The reaction conditions of PCR were 94[degrees]C for 5 min, followed by 35 cycles of amplification (94[degrees]C for 30 s, 63[degrees]C for 30 s, 72[degrees]C for 2 min). After HindIII/EcoRI digestion and gel purification, the PCR product was inserted in the HindIII/EcoRI sites of pEGFPN1. The resulting plasmid was termed [py.sup.+]LAT1-EGFP. After transformation and amplification in E. coli, plasmids purified from the E. coli colonies using a TIANpure Mini plasmid kit (TianGen, Beijing, China) were sequenced. The clone without mutations by PCR was further amplified in E. coli and then transfected into the BHK cells using Lipfectin 2000 (Invitrogen) following the manufacturer's protocol for the expressional localization of porcine [y.sup.+]LAT1 by inverted fluorescent microscopy. RESULTS AND DISCUSSION We searched the translated EST database (which is composed of sequences from species other than humans or mice) with the human [y.sup.+]LAT1 protein sequence at the National Center for Biotechnological Information (NCBI) and found a length of 771-bp EST (Accession no. DB794205) with high homology to [y.sup.+]LAT1. Using a RACE approach, the full-length cDNA clone was obtained. Based on this sequence, four gene-specific primers were synthesized and 3'/5' rapid amplifications of cDNA ends (RACE) were performed. 3' RACE (~1 kb) and 5' RACE (~0.5 kb) products were cloned into the pGMT vector and sequenced. Finally, a total of 2,111-bp long cDNA was assembled from the overlapping 3' (1,002 bp), EST and 5' RACE (498 bp). Sequence analysis of the porcine SLC7A7 cDNA revealed i) an ORF of 1,536 bp that would encode a protein of 510 amino acid residues, ii) 134 bp of 5' untranslated region (UTR), and iii) 441 bp of 3' UTR with a consensus AATAAA polyadenylation signal at 15-20 nt upstream of a poly(A) stretch. BLASTn or BLASTp analysis demonstrated that the porcine sequence shared a high degree of sequence identity, both in the nucleotide sequences, especially in coding sequence (CDS) regions (91, 90, 87 and 87%), and in the deduced amino acid sequences (93.2, 92.4, 88.5 and 88.9%), with those of cattle (Accession no. NM_001075151), human (Accession no. NM_003982), mouse (Accession no. NM_011405), and rat (Accession no. NM_031341) SLC7A7, respectively. The nucleotide sequence alignments among pig, human and mouse are shown in Figure 1. Furthermore, unlike rat and mouse [y.sup.+]LAT1 which are shorter or longer than cattle and human [y.sup.+]LAT1 by 3 amino acids, the porcine [y.sup.+]LAT1 was of the same length as those of cattle and human. Alignment of amino acid sequence is shown in Figure 2. Hydrophobicity prediction (Hofmann and Stoffel, 1993) suggested 12 putative membrane-spanning domains within porcine [y.sup.+]LAT1, similar to other mammalian [y.sup.+]LATs and consistent with the results of homologous comparison. Analysis of the amino acid sequence by ScanProsite (Gasteiger et al., 2003) revealed several consensus sites for post-translational modification (Figure 2). There was one glycosylation site on the fourth putative extracellular loop. Two consensus sites for protein kinase C phosphorylation were located at 58-60 and 96-96. The two sites were also present in the amino acid transporter of human [y.sup.+]LAT1. [FIGURE 1 OMITTED] [FIGURE 2 OMITTED] In order to examine the tissue distribution of the [y.sup.+]LAT1 and ascertain whether pig [y.sup.+]LAT1 was expressed in tissues other than intestine, Real-time PCR results were performed on mRNA from various tissues. The tissue distribution of [y.sup.+]LAT1 mRNA at day 60 is presented in Figure 3. The small intestine had the highest [y.sup.+]LAT1 mRNA abundance, while the lung had the lowest (p<0.05). However, undetectable levels of [y.sup.+]LAT1 mRNA expression were observed in the brain, muscle and liver. The number of transcripts that SLC7A7 genes could express seems to depend on species. For example, a Northern blot showed that high amounts of mouse [y.sup.+]LAT1 RNA are expressed in the kidney and intestine. Lower amounts of mouse [y.sup.+]LAT1 RNA appear to be expressed in the other tissues tested (Pfeiffer et al., 1999). [FIGURE 3 OMITTED] Having verified that the cloned cDNA behaved functionally like porcine SLC7A7, we next sought to identify the cellular localization of the gene product in BHK cells using green fluorescent protein (GFP) tagging. The expressed porcine [y.sup.+]LAT1-GFP localized to the plasma membrane at 36 h after transfection. Peak expression time was at 60 h, as shown in Figure 4. We detected the signal using inverted fluorescent microscopy 48 h after the transfection. The mutation of SLC7A7 can cause the occurrence of LPI (Lysinuric Protein Intolerance) and affect the trafficking of [y.sup.+]LAT1 to the plasma membrane in mammalian cells (Borsani et al., 1999; Toivonenb et al., 2002). The right orientation of GFP tagged [y.sup.+]LAT1 protein in the plasma membrane of BHK cells indicated that the product of cloned cDNA had bioactivity. [FIGURE 4 OMITTED] In conclusion, we have cloned a cationic amino acid transporter [y.sup.+]LAT1 from the pig. This cationic amino acid transporter showed significant homology with human and murine [y.sup.+]LAT1. BHK cell expression showed that the transporter was located in the cell membrane. Therefore, we consider it to represent the porcine homologue of human [y.sup.+]LAT1 (SLC7A7). Future studies will identify which cationic amino acid is transported by [y.sup.+]LAT1 as well as its function in porcine nutrition and physiology. ACKNOWLEDGMENTS This work was supported by special funds from the Major State Basic Research Program of China (973 Program) (No. 2004CB117501) and the Joint Funds of NSFC-Guangdong of China (No.u0731004). We also wish to acknowledge Dr. Jian-wei Dai (JiLin University, Jilin, P. R. China) for the kind gift of pEGFP-N1 plasmid. REFERENCES Bassi, M., E. Gasol, M. Manzoni, M. Pineda, M. Riboni, R. Martin, A. Zorzano, G. Borsani and M. Palacin. 2001. Identification and characterisation of human xCT that coexpresses, with 4F2 heavy chain, the amino acid transport activity system xc-. Pflugers Arch.: European Journal of Physiology 442:286-296. Borsani, G., M. T. Bassi, M. P. Sperandeo, A. D. Grandi, A. Buoninconti, M. Riboni, M. Manzoni, B. Incerti, A. Pepe, G. Andria, A. Ballabio and G. Sebastio. 1999. SLC7A7, encoding a putative permease-related protein, is mutated in patients with lysinuric protein intolerance. Nat. Genet. 21:297-301. Broer, A., C. A. Wagner, F. Lang and S. Broer. 2000. The heterodimeric amino acid transporter 4F2hc/y+LAT2 mediates arginine efflux in exchange with glutamine. Biochem. J. 349: 787-795. Chillaron, J., R. Roca, A. Valencia, A. Zorzano and M. Palacin. 2001. Heteromeric amino acid transporters: biochemistry, genetics, and physiology. Am. J. Physiol. Renal Physiol. 281:995-1018. Dall'Asta, V., O. Bussolati, R. Sala, B. M. Rotoli, G. Sebastio, M. P. Sperandeo, G. Andria and G. C. Gazzola. 2000. Arginine transport through system y+L in cultured human fibroblasts: normal phenotype of cells from LPI subjects. Am. J. Physiol., Cell Physiol. 279:1829-1837. Deves, R., P. Chavez and C. A. Boyd. 1992. Identification of a new transport system (y+L) in human erythrocytes that recognizes lysine and leucine with high affinity. J. Physiol. 454: 491-501. Gasteiger, E., A. Gattiker, C. Hoogland, I. Ivanyi, R. D. Appel and A. Bairoch. 2003. ExPASy: the proteomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 31: 3784-3788. Gottesdiener, K. M., B. A. Karpinski, T. Lindsten, J. L. Strominger, N. H. Jones, C. B. Thompson and J. M. Leiden. 1988. Isolation and structural characterization of the human 4F2 heavy-chain gene, an inducible gene involved in T-lymphocyte activation. Mol. Cell. Biol. 8:3809-3819. Hofmann, K. and W. Stoffel. 1993. TMbase - A database of membrane spanning proteins segments. Biol. Chem. 374:166. Livak, K. J. and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2[DELTA][DELTA]CT method. Methods 25:402-408. Mastroberardino, L., B. Spindler, R. Pfeiffer, P. J. Skelly, J. Loffing, C. B. Shoemaker and F. Verrey. 1998. Amino-acid transport by heterodimers of 4F2hc/CD98 and members of a permease family. Nature 395:288-291. Novak, D. A., J. C. Matthews, M. J. Beveridge, S.Y. M. Yao, J. Young and M. S. Kilberg. 1997. Demonstration of system y+L activity on the basal plasma membrane surface of rat placenta and developmentally regulated expression of 4F2HC mRNA. Placenta 18:643-648. Palacin, M., R. Estevez, J. Bertran and A. Zorzano. 1998. Molecular biology of mammalian plasma membrane amino acid transporters. Physiol. Rev. 78:969-1054. Pfeiffer, R., G. Rossier, B. Spindler, C. Meier, L. Kuhn and F. Verrey. 1999. Amino acid transport of y+L-type by heterodimers of 4F2hc/CD98 and members of the glycoprotein-associated amino acid transporter family. EMBO J. 18:49-57. Pineda, M., E. Fernandez, D. Torrents, R. Estevez, C. Lopez, M. Camps, J. Lloberas, A. Zorzano and M. Palacin. 1999. Identification of a membrane protein, LAT-2, that Co-expresses with 4F2 heavy chain, an L-type amino acid transport activity with broad specificity for small and large zwitterionic amino acids. J. Biol. Chem. 274:19738-19744. Sato, H., M. Tamba, T. Ishii and S. Bannai. 1999. Cloning and expression of a plasma membrane cystine/glutamate exchange transporter composed of two distinct proteins. J. Biol. Chem. 274:11455-11458. Toivonenb, M., J. Mykkanena, P. Aulaa, O. Simelld, M-L. Savontausb and K. Huoponenb. 2002. Expression of normal and mutant GFP-tagged y+L amino acid transporter-1 in mammalian cells. Biochem. Biophys. Res. Commun. 291: 1173-1179. Torrents, D., J. Mykkanen, M. Pineda, L. Feliubadalo, R. Estevez, Rd Cid, P. Sanjurjo, A. Zorzano, V. Nunes, K. Huoponen, A. Reinikainen, O. Simell, M-L. Savontaus, P. Aula and M. Palacin. 1999. Identification of SLC7A7, encoding y+LAT-1, as the lysinuric protein intolerance gene. Nat. Genet. 21:293-296. Verrey, F., C. Meier, G. Rossier and L. C. Kuhn. 2000. Glycoprotein-associated amino acid exchangers: broadening the range of transport specificity. Pflugers Arch.: European Journal of Physiology 440:503-512. Verrey, F., D. L. Jack, I. T. Paulsen, M. H. Saier and R. Pfeiffer. 1999. New glycoprotein-associated amino acid transporters. J. Membr. Biol. 172:181-192. Verrey, F., E. I. Closs, C. A. Wagner, M. Palacin, H. Endou and Y. Kanai. 2004. CATs and HATs: the SLC7 family of amino acid transporters. Pflugers Arch.: European Journal of Physiology 447:532-542. Zhi Ai-min, Feng Ding-yuan, Zhou Xiang-yan, Zou Shi-geng, Huang Zhi-yi, Zuo Jian-jun, Ye Hui, Zhang Chang-ming, Dong Ze-min and Liu Zhun. 2008. Molecular cloning, tissue distribution and segmental ontogenetic regulation of [b.sup.0,+] amino acid transporter in lantang pigs. Asian-Aust. J. Anim. Sci. 21: 1134-1143. Zou Shi-geng, Zhi Ai-min, Zhou Xiang-yan, Zuo Jian-jun, Zhang Yan, Huang Zhi-yi, Xu Ping-Wen and Feng Ding-yuan. 2009. Molecular cloning, segmental distribution and ontogenetic regulation of cationic amino acid transporter 2 in Pigs. Asian Aust. J. Anim. Sci. 22:712-720. Ai-min Zhi (1, 2), (a), Xiang-yan Zhou (3) (a), Jian-jun Zuo (1), Shi-geng Zou (1), Zhi-yi Huang (1), Xiao-lan Wang (1), Lin Tao (1) and Ding-yuan Feng (1), ** (1) College of Animal Science, South China Agricultural University, Guangzhou, 510642, China (2) Henan Provincial Key Laboratory for Animal Immunology, Henan Academy of Agricultural Sciences, Zhengzhou 450002, China. (3) ASIAPAC (DongGuan) Biotecnology Co, Ltd, Dongguan 523808, China. * Sequence data from this article have been deposited with the GenBank Data Library under Accession No. EU047705. ** Corresponding Author: Dingyuan Feng. Tel: +86-20-8528 6090, Fax: +86-20-85280740, E-mail: fengdy@scau.edu.cn (a) These two authors contribute equally to this work. Received May 6, 2009; Accepted July 20, 2009 Table 1. Primers for Smart RACE cDNA and ORF Amplification Primer Application ZA1 EST ZA2 EST GSP1 First PCR NGSP1 Second PCR GSP2 First PCR NGSP2 Second PCR [y.sup.+]LAT1 forward Real-time PCR [y.sup.+]LAT1 reverse Real-time PCR 18S forward Real-time PCR 18S reverse Real-time PCR ZY1 ORF clone ZY2 ORF clone ZM1 ORF clone ZM2 ORF clone Primer Sequence ZA1 5' CCTTTGTTATGCGGAACTGGGCACC 3' ZA2 5' CCACAAAGAAAAGCCTAGAAGCAGCCAC 3' GSP1 5' CGAGGCTCCCTGACCAAGTCTAACAAT 3' NGSP1 5' CCAGAGTCGGATGAAGGCAAGGAGTC 3' GSP2 5' ACAGGTGACATCGCTCTGGCACTCTACT 3' NGSP2 5' CCAGTGATGCTGTTGCTGTGACTTTTGC 3' [y.sup.+]LAT1 forward 5'-GAGCCCACAAAGAAAAGC-3' [y.sup.+]LAT1 reverse 5'-GCCCATTGTCACCATCATC-3' 18S forward 5'-GGACATCTAAGGGCATCACAG-3' 18S reverse 5'-AATTCCGATAACGAA CGAGACT-3' ZY1 5' CATGGTTGACGGCATGAAG 3' ZY2 5' GTTTAGACTTGGGATCTTGTTGC 3' ZM1 5' CCCAAGCTTATGGTTGACGGCATGA 3' ZM2 5' GGCTGAATTCGTTTAGACTTGGGATCTTGTTGC 3' |
| Gale Copyright: | Copyright 2010 Gale, Cengage Learning. All rights reserved. |