Lack of association of high-risk human papillomavirus in ocular surface squamous neoplasia in India.
Abstract: * Context.--Ocular surface squamous neoplasia (OSSN) represents a spectrum of ocular surface tumors ranging from intraepithelial to invasive. The genesis of OSSN is multifactorial, possibly including human papillomavirus (HPV) infection, the role of which is controversial.

Objective.--To evaluate the role of high-risk HPV16 and HPV18 in OSSN.

Design.--Retrospective and prospective noncomparative case series. In this study, histologically proven cases of OSSN were evaluated in formalin-fixed, paraffin-embedded sections (n = 50) and fresh tissues (n = 7) for the presence of HPV by polymerase chain reaction using MY09/MY11 consensus primers, HPV16 and HPV18 type-specific primers, and in situ hybridization-catalyzed reporter deposition (ISH-CARD). Cervical tumors (n = 19) along with SiHa and HeLa cell lines served as positive controls for HPV analysis.

Results.--The study included 48 patients with OSSN who accounted for 57 specimens, with a median patient age of 28.5 years (range, 1.5-70 years). These specimens included 36 squamous cell carcinomas and 21 conjunctival intraepithelial neoplasias. All of the cases were found to be negative for high-risk HPV using polymerase chain reaction and ISH-CARD assay, whereas the SiHa and HeLa cell lines were appropriately positive. Of the cervical tumors that served as positive controls, 18 were positive for HPV16, and 1 was positive for HPV18.

Conclusions.--Sensitive, type-specific polymerase chain reaction for detection of HPV16 and HPV18, polymerase chain reaction assay for consensus HPV sequences, and ISH-CARD did not show the presence of high-risk HPV in OSSN. Thus, HPV appears to play no significant role in the etiology of OSSN in India.

(Arch Pathol Lab Med. 2009;133:1246-1250)
Article Type: Clinical report
Subject: Papillomavirus infections (Development and progression)
Papillomavirus infections (Demographic aspects)
Squamous cell carcinoma (Development and progression)
Squamous cell carcinoma (Demographic aspects)
Authors: Manderwad, Guru Prasad
Kannabiran, Chitra
Honavar, Santosh G.
Vemuganti, Geeta K.
Pub Date: 08/01/2009
Publication: Name: Archives of Pathology & Laboratory Medicine Publisher: College of American Pathologists Audience: Academic; Professional Format: Magazine/Journal Subject: Health Copyright: COPYRIGHT 2009 College of American Pathologists ISSN: 1543-2165
Issue: Date: August, 2009 Source Volume: 133 Source Issue: 8
Topic: Canadian Subject Form: Eye tumours; Eye tumours
Geographic: Geographic Scope: India Geographic Code: 9INDI India
Accession Number: 230247111
Full Text: Human papillomavirus (HPV) is an epitheliotropic double-stranded DNA virus belonging to the Papoviridae family. (1) The role of HPV in the genesis of squamous cell carcinoma of the cervix, (2) anogenital region, (3) carcinoma of the head and neck, (4) and oral mucosa is well established, but its role in ocular surface squamous neoplasia (OSSN) is still unclear. These tumors, most often seen in elderly patients, comprise a spectrum of intraepithelial and invasive tumors. Collectively, they are the most common tumors of the ocular surface. (5) They are slow growing, and they usually appear as masslike lesions associated with redness and conjunctivitis. Contributing factors implied in the pathogenesis of OSSN include high exposure to ultraviolet rays, irradiation, (6) immunosuppression after human immunodeficiency virus infection, (7) organ transplantation, (8) chronic irritation, (9) and genetically predisposed states, such as xeroderma pigmentosum (XP). (10)

HPV6 and HPV11 have been shown to be associated with benign papillomas of human conjunctiva, (11-17) but the role of high-risk HPVs, specifically HPV16 and HPV18, in the development of OSSN is not clear. Some studies have reported the association of high-risk HPV, (18-26) whereas others have not found an association. (27-33) In this study, we sought to elucidate the role of high-risk HPV (HPVs 16 and 18) in OSSN occurring in South India, using a sensitive type-specific polymerase chain reaction (PCR) assay and the in situ hybridization-catalyzed reporter deposition (ISH-CARD) method.

MATERIALS AND METHODS

Patients and Specimens

The study protocol was approved by the Institutional Review Board of the L V Prasad Eye Institute. In this retrospective and prospective study, we reviewed the records of the Ophthalmic Pathology Service at L V Prasad Eye Institute for cases with a histologic diagnosis of OSSN from 2001 through 2006. Laboratory processing of the preserved blocks involved fixation with 10% formalin (neutralized) and embedding in paraffin, with storage at room temperature. Blocks with a large amount of tissue were sectioned and selected for DNA extraction and for ISH. During the course of the study, supplemental fresh tumor tissue from OSSN patients collected from excisional biopsies received in the ophthalmic pathology laboratory for diagnostic purposes was included. The medical records of the patients were reviewed for clinical details, making special note of demographics, recurrences of OSSN, and other systemic diseases. Results of human immunodeficiency virus testing, if done, were included in the analysis. Fresh tissues from 19 cervical tumors along with SiHa and HeLa cell lines were used as positive controls for HPV analysis.

Detection of HPV by PCR

Sections of thickness were prepared from each paraffin

block. DNA extraction was done using a QIAamp DNA mini kit (Qiagen, Hilden, Germany). The consensus primer (M09/My11) was used for amplifying HPV; this primer can detect both high risk (16, 18, 33, 26, 31, 51, 52, 55, and 56) and low-risk (6, 11, 40, 42, 51, 53, 54, 57, 66, and 73) HPV types. Type-specific primers designed internal to the degenerate primers in the L1 region34,35 were used for amplifying specific HPV16 and HPV18 sequences. The primer sequences are shown in the Table. Amplification was done for 35 cycles of denaturation at 95[degrees]C for 30 seconds, annealing at 56.5[degrees]C for 30 seconds, and extension at 72[degrees]C for 30 seconds, with a single cycle of final extension at 72[degrees]C for 5 minutes. DNA extracted from a SiHa cell line was used as the positive control for HPV16, whereas DNA extracted from a HeLa cell line was used as the positive control for consensus primers and for HPV18-specific primers. Negative controls for PCR assays were set up using deionized water instead of the DNA template. The suitability of DNA extracted from tissue sections was confirmed by the amplification of the cellular gene Myocilin, using primers capable of amplifying conserved 200 bp of coding sequence (primer sequence in the Table). Amplification products were subjected to electrophoresis using 1.5% of the agarose gel and were visualized by ethidium bromide staining.

[FIGURE 1 OMITTED]

HPV In Situ Hybridization-Catalyzed Reporter Deposition

We used a modified ISH assay based on the deposition of a large number of haptenized tyramide molecules by peroxidase activity. (36) Catalyzed reporter deposition increases the sensitivity of ISH from 2- to 100-fold and can detect a single copy of HPV in tissue sections. (37) Briefly, the sections were mounted on triethoxysialine-coated slides, deparaffinized, and rehydrated in gradient alcohol. Tissues were retrieved using a tissue retrieval solution (Dako, Glostrup, Denmark) by the microwave method at 99[degrees]C for 30 minutes, and tissue was digested in a solution of proteinase K (1:5000 dilution in 0.05 M Tris-HCl) at pH 7.6 (Qiagen). Endogenous peroxidase activity was inhibited using 0.3% [H.sub.2][O.sub.2] in methanol. Slides were allowed to dry for 15 minutes, and then 1 drop of HPV16 and HPV18 biotinylated DNA probe (Dako) was added. The probe and the HPV target DNA were denatured at 92[degrees]C for 5 minutes and kept for hybridization at 37[degrees]C for 60 minutes. Slides were then washed with 1x Tris-buffered saline with 0.05% Tween-20, pH 7.6. A stringent wash (Dako) was done at 58[degrees]C for 30 minutes. Detection of the hybridized probe was performed using the GenPoint Tyramide Signal Amplification system (Dako). Sections from the blocks made from SiHa and HeLa cell lines were used as positive controls for HPV16 and HPV18, respectively.

RESULTS

Of the 264 OSSN cases seen during the past 5 years, invasive squamous cell carcinomas were identified in 159 cases (60.3%). The remaining 105 cases were intraepithelial tumors. All cases were diagnosed on excision biopsy, but 21 (6.5%) underwent radical surgery in the form of exenteration or enucleation, suggesting extensive disease. In this study, we included 48 patients with OSSN who contributed to 57 specimens (53 excision biopsy and 4 exenteration).

The median age of the patients included in this study was 28.5 years (range, 1.5-70 years), with male preponderance (2:1). Eleven patients were diagnosed as having XP, and 3 patients were human immunodeficiency virus seropositive. The 3 human immunodeficiency virus-sero-positive patients had low T-cell counts and were initiated on highly active antiretroviral therapy after primary management of OSSN. In this subset of 57 tumor tissues, 36 were invasive squamous cell carcinoma, and 21 were intraepithelial tumors. Nine tumor tissue samples were recurrent tumor specimens obtained from 3 XP patients. DNA extracted from all of the samples (50 fixed tissues and 7 fresh samples) was amplified using the internal control myocilin exon 3 gene primers, which showed a product of 200 bp, confirming that the quality of DNA extracted from fixed tissues was suitable for PCR (Figure 1, A). Amplification of the DNA with HPV-specific primers showed that all OSSN cases were negative for conserved HPV sequences as well as for HPV16 and HPV18 (Figure 1, C), whereas the positive controls for HPV16 (220 bp) and HPV18 (240 bp), and the consensus primer (450 bp) were amplified. Amplification was also noticed in cervical tumor using consensus primers (450 bp), as well as in SiHa and HeLa cell lines. All OSSN cases were also negative for HPV16 and HPV18 using the ISH-CARD method. Sections from SiHa and HeLa cell line blocks were positive for HPV16 and HPV18, respectively, using the ISH-CARD method. In the fresh tissues evaluated from 19 cervical tumors, HPV16 was detected in 18 cases and HPV18 in 1 case using both PCR and ISH-CARD assay (Figures 1, B, and 2).

[FIGURE 2 OMITTED]

COMMENT

Surface squamous neoplasia of the eye ranges from simple dysplasia to frank squamous cell carcinoma. Overall, the average incidence ranges from 0.13 per 100000 in Kampala, Uganda, (7) to 1.9 per 100000 in Brisbane, Australia, (38) with the highest incidence in whites and in the elderly population. In India, no incidence of OSSN has been reported to date. A recent study done in Pakistan by Babar et al (39) reported the frequency of OSSN among patients admitted to hospitals as 0.37%. At our tertiary center, the occurrence of OSSN in younger people appears to be high compared with the distribution described in Western countries. (5) This could be attributed to a referral bias, a high number of cases of XP, or a true reflection of a high prevalence in the young. Although the genesis of OSSN is considered multifactorial, ultraviolet radiation, (40,41) XP, (42) and immunodeficieny (43) all appear to be important.

The role of high-risk HPV types in oncogenesis is well established in cervical and anogenital cancers. (2,3) Although we did not study conjunctival papilloma, we found no presence of high-risk HPV in OSSN, as indicated by the negative results, despite its consistent detection in positive controls.

This is the first study, to our knowledge, that has used the ISH-CARD technique for the analysis of HPV in conjunctival neoplasia. The ISH-CARD technique is highly sensitive in detecting low copies of HPV. Conventional ISH can detect 40 kb of DNA and 10 to 20 copies of mRNA. (44) The CARD signal amplification technique was introduced by Bobrow et al (36) for use in immunoblotting and enzyme-linked immunosorbent assay. It is based on the deposition of a large number of haptenized tyramide molecules by peroxidase activity. Previous studies have shown the sensitivity of ISH for detection of levels as low as a single copy of HPV (37) in the cell or in tissue preparations. All of our cases were shown to be negative by the ISH-CARD method, suggesting that these cases were likely to be truly negative for HPV because the sensitivity of the ISH-CARD technique would be high enough to detect even low levels of HPV DNA.

The absence of HPV in OSSN by PCR and ISH-CARD cases suggests that in Indian patients, HPV is not associated with OSSN. In studies done elsewhere, (45) nested PCR was used to demonstrate HPV in conjunctival neoplasms, but this technique may show false-positive results because of an increased likelihood of carryover during PCR. We chose not to use this technique because we felt that if a virus were driving tumor cell proliferation, we should have no difficulty in detecting it in the large blocks we had available for study. Even though the clinical and histologic spectrum of squamous cell carcinoma is expected to be the same everywhere, the notable difference in the age and the absence of HPV in our population could point toward some other undetermined etiologic factors that could explain the geographic differences. We therefore conclude that HPV subtypes, including types 16 and 18, are unlikely to play a significant role in the genesis of OSSN in patients of South Indian origin.

We thank the Hyderabad Eye Research Foundation and the Indian Council of Medical Research (no. 5/4/6/13/02-NCD-II) for funding this research. We also thank G. Swarnalatha, MD, at Apollo Hospitals for providing us with cervical tumors, and Robert J. Biggar, MD, at L V Prasad Eye Institute, Hyderabad, for critical review of the manuscript.

References

(1.) Howley PM, Schlegel R. The human papillomaviruses: an overview. Am J Med. 1998;85(2A):1 55-1 58.

(2.) Crum CP, Ikerberg H, Richart RM, Gissman L. Human papillomavirus type 16 and early cervical neoplasia. N Eng J Med. 1984;310(14):880-883.

(3.) Palefsky JM. Human papillomavirus infection and anogenital neoplasia in human immunodeficiency virus-positive men and women. J Natl Cancer Inst Monogr. 1998;23:15-20.

(4.) Romanitan M, Nasman A, Ramqvist T, et al. Human papillomavirus frequency in oral and oropharyngeal cancer in Greece. Anticancer Res. 2008; 28(48):2077-2080.

(5.) Lee GA, Hirst LW. Ocular surface squamous neoplasia. Surv Ophthamlol. 1995;39(6):429-450.

(6.) Lee GA, William G, Hirst LW, Greece AC. Risk factors for the development of ocular surface epithelial dysplasia. Ophthalmology. 1994;101(2):360-364.

(7.) Newton R, Ziegler J, Ateenyi-Agaba C, et al. The epidemiology of the conjuctival squamous cell carcinoma in Uganda. Br J Cancer. 2002;87(3):301-308.

(8.) Macarez R, Bossis S, Robinet A, Le Callonnec A, Charlin JF, Colin J. Conjunctival epithelial neoplasias in organ transplant patients receiving cyclosporine therapy. Cornea. 1999;18(4):495-497.

(9.) Poole TR, Graham EM. Ocular manifestations of rheumatologic disorders. Curr Opin Ophthalmol. 1999;10(6):458-463.

(10.) Hertle RW, Durso F, Metzler JP, Varsa EW. Epibulbar squamous cell carcinomas in brothers with Xeroderma pigmentosa. J Pediatr Ophthalmol Strabismus. 1991;28(6):350-353.

(11.) Michel JL, Guiguen Y, Leger F, Gain P, Valanconny C, Cambazard F. Human papillomavirus type 6/11 in conjunctival papilloma. Ann Dermatol Venereol. 1996;123(2):90-92.

(12.) McDonnell PJ, McDonnell JM, Kessis T, Green WR, Shah KV. Detection of human papillomas virus type 6/11 DNA in conjunctival papillomas by the in situ hybridization with radioactive probes. Hum Pathol. 1987;18(11):1115-1119.

(13.) Lass JH, Grove AS, Papale JJ, Albert DM, Jenson AB, Lancaster WD. Detection of human papillomavirus DNA sequences in conjunctival papilloma. Am J Ophthalmol. 1983;96(5):670-674.

(14.) Sen S, Sharma A, Panda A. Immunohistochemical localization of human papillomavirus in conjunctival neoplasias: a retrospective study. Indian J Ophthal mol. 2007;55(5):361-363.

(15.) Sjo NC, Heegaard S, Prause JU, von Buchwald C, Lindeberg H. Human papillomavirus in conjunctival papilloma. BrJOphthalmol.2001;85(7):785-787.

(16.) Sjo NC, von Buchwald C, Cassonnet P, et al. Human papillomavirus in normal conjunctival tissue and in conjunctival papilloma: types and frequencies in a large series. Br J Ophthalmol. 2007;91(8):1014-1015.

(17.) Minchiotti S, Masucci L, Serapiao Dos Santos M, et al. Conjunctival papilloma and human papillomavirus: identification of HPV types by PCR. Eur J Ophthalmol. 2006;16(3):473-477.

(18.) Nakamura Y, Mashima Y, Kameyama K, Mukai M, Oguchi Y. Detection of human papillomavirus infection in squamous tumors of the conjunctiva and lacrimal sac by immunohistochemistry, in situ hybridization and polymerase chain reaction. Br J Ophthalmol. 1 997;81(4):308-313.

(19.) Moubayed P, Mwakyoma H, Schneider DT. High frequency ofhuman papilloma virus 6/11, 16 and 18 infections in precancerous lesions and squamous cell carcinoma of the conjunctiva in subtropical Tanzania. Am J Clin Pathol. 2004; 122(6):938-943.

(20.) McDonnell JM, Mayr AJ, Martin WJ. DNA of human papillomavirus type 16 in dysplastic and malignant lesions of the conjunctiva and cornea. N Engl J Med. 1989;320(22):1442-1446.

(21.) Saegusa M, Takano Y, Hashimura M, Okavasu I, Shiga J. HPV type 16 in conjunctival and junctional papilloma, dysplasia, and squamous cell carcinoma. J Clin Pathol. 1995;48(12):1 106-1110.

(22.) Toth J, Karcioglu ZA, Moshfeghi AA, Issa TM, Al-Ma'ani JR, Patel KV. The relationship between human papillomavirus and p53 gene in conjunctival squamous cell carcinoma. Cornea. 2000;19(2):159-162.

(23.) Scott IU, Karp CL, Nuovo GJ. Human papillomavirus 16 and 18 expression in conjunctival intraepithelial neoplasia. Ophthalmology. 2002;109(3):542-547.

(24.) McDonnell JM, McDonnell PJ, Sun YY. Human papillomavirus DNA in tissues and ocular surface swabs of patients with conjunctival epithelial neoplasia. Invest Ophthalmol Vis Sci. 1992;33(1):184-189.

(25.) Wadell KM, Lewallen S, Lucas SB, Ateenyi-Agaba C, Herrington CS, Liomba G. Carcinoma of the conjunctiva and HIV infection in Uganda and Malawi. Br J Ophthalmol. 1996;80(6):503-508.

(26.) Ateenyi-Agaba C, Wiederpass E, Smet A, et al. Epidermodysplasia verruciformis human papillomavirus types and carcinoma of the conjunctiva: a pilot study. Br J Cancer. 2004;90(9):1777-1779.

(27.) Tulvatana W, Bhattarakosal P, Sansoopha L, et al. Risk factors for conjunctival squamous cell neoplasia: a matched case-control study. Br J Ophthalmol. 2003;87(4):396-398.

(28.) Palazzi MA, Erwenne CM, Villa LL. Detection of the human papillomavirus in epithelial lesions of the conjunctiva. Sao Paulo Med J. 2000;118(5):125-130.

(29.) Tornesello ML, Duraturo ML, Waddell KM, et al. Evaluating the role of human papillomavirus in conjuctival neoplasia. Br J Cancer. 2006;94(3):446-449.

(30.) Tuppurainen K, Raninen A, Kosunen O, et al. Squamous cell carcinoma of the conjunctiva. Failure to demonstrate HPV DNA by in situ hybridization and polymerase chain reaction. Acta Ophthalmol (Copenh). 1992;70(2):248-254.

(31.) Dushku N, Hatcher SL, Albert DM, Reid TW. p53 expression and relation to human papillomavirus infection in pingueculae, pterygia, and limbal tumors. Arch Ophthalmol. 1999;117(12):1593-1599.

(32.) de Koning MN, Waddell K, Magyezi J, et al. Genital and cutaneous human papillomavirus (HPV) types in relation to conjunctival squamous cell neoplasia: a case-control study in Uganda. Infect Agent Cancer. 2008;3:12.

(33.) Eng HL, Lin TM, Chen SY, Wu SM, Chen WJ. Failure to detect human papillomavirus DNA in malignant epithelial neoplasms of conjunctiva by polymerase chain reaction. Am J Clin Pathol. 2002;117(3):429-436.

(34.) Manos MM, Ting Y, Wright DK, Lewis AJ, Broker TR, Wolinsky SM. Use of polymerase chain reaction amplification for the detection of genital human pap illomavirus. CancerCell. 1989;7:209-214.

(35.) Orjuela M, Castaneda VP, Ridaura C, et al. Presence of human papilloma virus in tumor tissue from children with retinoblastoma: an alternativemechanism for tumor development. Clin Cancer Res. 2000;6(10):4010-4016.

(36.) Bobrow MN, Harris TD, Shaughnessy KJ, Litt GJ. Catalyzed reporter deposition, a novel method of signal amplification. Application to immunoassays. J Immunol Methods. 1989;125(1-2):279-285.

(37.) Cooper K, Taylor L. Human papillomavirus detection by in situ hybridization signal amplification based on biotinylated tyramine deposition. Mol Pathol. 1997;50(4):224.

(38.) Lee GA, Hirst LW. Incidence of ocular surface epithelial dysplasia in metropolitan Brisbane: a 10-year survey. Arch Ophthalmol. 1992;110(4):525-527.

(39.) Babar TF, Khan MN, Hussain M, Shah SA, Khan MY, Khan MD. Spectrum of ocular surface squamous neoplasia. J Coll Physicians Surg Pak. 2007;17(6): 344-346.

(40.) Irvine AR. Dyskeratotic epibulbar tumors. Trans Am Ophthalmol Soc. 1963;61:243-273.

(41.) Erie JC, Campbell RJ, LiesegangTJ. Conjunctival and corneal intraepithelial and invasive neoplasia. Ophthalmology. 1986;93(2):176-183.

(42.) Gaasterland DE, Rodrigues MM, Moshell AN. Ocular involvement in Xeroderma pigmentosum. Ophthalmology. 1982;89(8):980-986.

(43.) Winward KE, Curtin VT. Conjunctival squamous cell carcinomain apatient with human immunodeficiency virus infection. Am J Ophthalmol. 1989;107(5): 554-555.

(44.) Hoefler H, Childers H, Montminy MR, Lechan RM, Goodman RH, Wolfe HJ. In situ hybridization methods for thedetection ofsomatostatin mRNAin tissue sections using antisense RNA probes. Histochem J. 1986;18(11-12):597-604.

(45.) Karcioglu ZA, IssaTM. Human papillomavirus in neoplastic and non-neoplastic conditions of the external eye. Br JOphthalmol. 1997;81(7):595-598.

Guru Prasad Manderwad, MSc; Chitra Kannabiran, PhD; Santosh G. Honavar, MD; Geeta K. Vemuganti, MD, DNB

Accepted for publication April 21, 2009.

From the Ophthalmic Pathology Services (Drs Manderwad and Vemuganti), the Kallam Anji Reddy Molecular Genetics Laboratory (Dr Kannabiran), and the Department of Ophthalmic Plastic Surgery, Orbit and Ocular Oncology (Dr Honavar), Kallam Anji Reddy Campus, L V Prasad Eye Institute, Hyderabad, India.

The authors have no relevant financial interest in the products or companies described in this article.

Reprints: Geeta K. Vemuganti, MD, DNB, Ophthalmic Pathology Services, Hyderabad Eye Research Centre, Kallam Anji Reddy Campus, L V Prasad Eye Institute, L V Prasad Marg, Banjara Hills, Hyderabad 500 034, India (e-mail: geeta@lvpei.org).
Primer Sequences (a)

                                                   Annealing
Name                 Primer Sequence               Temperature

Myocilin exon: 3 F   5' GAACTCGAACAAACCTGGGA3'     56.5[degrees]C
Myocilin exon: 3 R   5' CATGCTGCTGTACTTATAGCGG3'
My09 HPV F           5' CGTCCMARRGGAWACGATC3'      56.5[degrees]C
My11 HPV R           5' GCMCAGGGWCATAAYAATGG3'
HPV16 F              5' TACCTACGACATGGGGAGGA3'     56.5[degrees]C
HPV16 R              5' TGACAAGCAAT TGCCTGGGT3'
HPV18 F              5' CCTGGGCAATATGATGCTA3'      56.5[degrees]C
HPV18 R              5' CCTTATTTTCADGCCGTGCA3'

Abbreviations: F, forward ; HPV, human papillomavirus; R, reverse.

(a) In primer sequences, W indicates A+T+C; M indicates A+C; and R
and Y indicate primers (A+G) and pyramidine (C+T), respectively.
Gale Copyright: Copyright 2009 Gale, Cengage Learning. All rights reserved.