Evaluation of nested polymerase chain reaction targeting hup B gene in the diagnosis of tubercular ascites.
Abstract: Abdominal tuberculosis usually has nonspecific presentation, frequently mimicking other diseases. Because of the limitations of the conventional methods of diagnosis of extra pulmonary tuberculosis, focus is shifted to molecular methods. The objectives of this study are to evaluate the role of nested Polymerase Chain Reaction (PCR) targeting hup B gene as a rapid diagnostic modality of tubercular ascites and also to detect the infecting species (Mycobacterium tuberculosis and Mycobacterium bovis). 100 suspected tubercular ascites patients were enrolled in the study. Ascitic fluid was processed by Universal Sample Processing (USP) method and two steps nested PCR was performed targeting hup B gene. Patients were put on Anti Tubercular Therapy [Category I, (2 HRZE + 4 HR) 3, RNTCP, India]. A positive response to therapy was considered as gold standard and PCR assay was compared to determine sensitivity, specificity, positive and negative predictive value in diagnosis of tubercular ascites. 79 patients could be followed up to see the response to therapy. Of these, 39 were PCR positive and 35 responded to Anti Tubercular therapy. The sensitivity, specificity, positive and negative predictive value were found to be 97.1%, 88.6%, 87.2% and 97.5% respectively. The good sensitivity and specificity obtained in the study suggests the use of PCR targeting hup B gene as a routine diagnostic tool for tubercular ascites. Another added advantage is the ability to identify between M. tuberculosis and M. bovis which otherwise have similar clinical presentation.

KEY WORDS: Hup B gene; M. tuberculosis; M. bovis; Nested Polymerase Chain Reaction
Article Type: Report
Subject: Tuberculosis (Complications and side effects)
Tuberculosis (Research)
Ascites (Diagnosis)
Ascites (Research)
Polymerase chain reaction (Research)
Authors: Jain, Anju
Sharma, Vivekanand
Patra, Surajeet Kumar
Goel, Atul
Sherwal, B.L.
Pub Date: 07/01/2012
Publication: Name: Internet Journal of Medical Update Publisher: Dr. Arun Kumar Agnihotri Audience: Academic; Professional Format: Magazine/Journal Subject: Health Copyright: COPYRIGHT 2012 Dr. Arun Kumar Agnihotri ISSN: 1694-0423
Issue: Date: July, 2012 Source Volume: 7 Source Issue: 2
Topic: Event Code: 310 Science & research
Geographic: Geographic Scope: India Geographic Code: 9INDI India
Accession Number: 299062123
Full Text: INTRODUCTION

Tuberculosis continues to be the leading cause of death due to a single infectious agent, despite the availability of preventive and therapeutic measures. Globally, around two billion people are infected and eight million new cases are added per year. In India, the prevalence of tuberculosis is around 380 million (1). The situation has aggravated with the almost pandemiclike situation of human immunodeficiency virus (HIV)-acquired immunodeficiency syndrome (AIDS) where tuberculosis is a major opportunistic infection. The causative agent in mammals is mycobacteria belonging to the "Mycobacterium tuberculosis complex" (2) which comprises of Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, Mycobacterium microti, Mycobacterium caprae and Mycobacterium canetti. Mycobacterium tuberculosis is the major human pathogen, although the other members of the complex especially Mycobacterium bovis has been recognized as a potential human pathogen.

The most frequent site of tubercular infection is lung but extra pulmonary tuberculosis (EPTB) may be seen in 10-15% cases. Tuberculosis of gastrointestinal tract is the sixth most frequent form of extra pulmonary tuberculosis after lymph nodes, genitourinary, bones, joints and meningeal tuberculosis (3). In India, abdominal tuberculosis accounts for 0.08% of all hospital admissions and the incidence varies from 2-11% of the tuberculosis patients. Abdominal tuberculosis generally includes the tubercular lesions of gastrointestinal tract (GIT), peritoneum, lymph nodes of mesentery, retroperitoneum (3).

Abdominal tuberculosis can have a varied presentation, frequently mimicking other diseases. Initial symptoms of abdominal tuberculosis like fever, pain, diarrhea, constipation, weight loss, anorexia and malaise are non-specific and nonalarming (4). Thus the primary disease progresses to the advanced stages leading to complications like ascites, obstruction, fistulas and peritonitis. This increases the morbidity and worsens the prognosis. Hence early diagnosis of tubercular ascites is crucial to prevent the morbidity and mortality related to it.

The conventional methods of diagnosis employ the microscopic identification of acid-fast bacilli (AFB) in smears stained by Ziehl -Neelsen technique and culturing of organisms in Lowenstein-Jensen medium. Culture is still considered as "gold standard" for diagnosis of tuberculosis but it requires 4-6 weeks for getting the confirmed diagnosis. Added to this is the paucibacillary nature of the extra pulmonary ascetic sample. This highlights the need for diagnostic techniques that are both rapid and sensitive.

In this scenario, the molecular methods like Polymerase Chain Reaction (PCR) plays vital role in early and rapid diagnosis of extra pulmonary paucibacillary tubercular ascites.

Various researchers like Prabhakar et al (5) reported the identification of an immunogenic histone like protein of M. tuberculosis (hlp Mt). The gene for this protein, named hup B (5,6) consists of 645bp in M. tuberculosis and 618bp in M. bovis. The difference in the base pairs has been attributed to a 27bp (9 amino acids) deletion after codon 128 at the C-terminal portion of the hup B gene in M. bovis (5-7). It is not present in other mycobacterial strains (5).

Nested PCR targeting C-terminal of hup B gene can be used for early and rapid diagnosis of extra pulmonary paucibacillary tubercular ascites and it has an added advantage of differentiating the two infecting species (M. tuberculosis and M. bovis). This differentiation is of clinical significance as M. bovis is intrinsically resistant to pyrazinamide, a first line drug in anti-tubercular therapy, which necessitates its replacement with another drug (8). Hence we evaluated the role of nested Polymerase Chain Reaction (PCR) targeting hup B gene in diagnosis of tubercular ascites and also to detect the infecting species (M. tuberculosis and M. bovis).

METHODOLOGY

The study was conducted jointly in the Departments of Biochemistry, Microbiology and Medicine, Lady Hardinge Medical College and Associated Hospitals, New Delhi, India after institutional ethical clearance.

A total of 100 patients meeting the selection criteria were enrolled in the study after informed written consent. Approximately 4 ml of ascitic fluid samples were taken under aseptic condition and collected in sterile vials from patients admitted in medicine wards of SSK Hospital after informed written consent.

Selection criteria

Any patients presenting with unexplained ascites were selected for study initially. They underwent routine cytological analysis (Inflammatory cell count like total leukocyte count, polymorphonuclear neutrophils and differential counts) and biochemical analysis for ascitic fluid (Total protein, albumin).

Of the above patients, all patients with exudative ascites (Total protein >2.5 gm/dl) (9) were taken up for the study. Patients with cardiac and chronic liver disease were included in the study only if the ascitic fluid indicated an increased inflammatory cell count. Diagnosed cases of cancer, which could present with ascites were excluded from the study. The patients were subjected to detailed history and clinical examination. Routine biochemical investigations (glucose; liver function tests like total and direct bilirubin, alanine aminotransferase, aspartate aminotransferase and alkaline phosphatase; kidney function tests like urea, creatinine and uric acid; electrolytes like sodium, potassium, calcium and phosphate; total protein and albumin; lipid profile like cholesterol, triglyceride) were done with serum samples. The ascitic fluid samples were stored at -200C in aliquots till further processing. It was subjected to:

* Biochemical analysis [Adenosine Deaminase (ADA),Lactate, Total protein, Albumin, Serum Ascitic Albumin Gradient (SAAG)]

* AFB smear microscopy and culture in Lowenstein-Jensen medium (LJ medium)

* Polymerase Chain Reaction (PCR)

The ascitic fluid samples were processed in the Mycobacteriology laboratory, Department of Microbiology, Lady Hardinge Medical College, New Delhi. Self protection practices such as use of overalls, double mask, double gloves, footwear and the hood with UV laminar airflow were followed. Mycobacterial DNA were extracted by using Universal Sample Processing (USP) method (10,11).

Nested PCR assay for hup B gene

The two step nested PCR assay of the processed clinical samples, targeting the hup B gene, was done using a 40 [micro]l reaction. The preparation of this reaction mixture was carried out in a hood with a laminar airflow taking all necessary precautions to prevent contamination and cross infection. Two sets of primers were used for the assay--N1S1 and CTFR.

N1 -- (5 - GAGGG TTGGGATGAACAAAGCAG - 3) S1 -- (5' - TATCCGTGTGTCTTGACCTATTTG - 3') CTF -- (5' - CCAAGAAGGCGACAAAGG - 3') CTR -- (5' - TTAGGGGACACCAAGCCCTCAGGAAGAGCA - 3')

PCR assay targeting hup B gene was done using a 40ul reaction mixture. The composition of the master mixture were water 27[micro]L, buffer 4[micro]L (1X), magnesium chloride 2 [micro]L (125 mM), dNTPs 0.8uL (200uM), forward and reverse primer 1[micro]L (0.5[micro]M) each and Taq polymerase 0.2[micro]L (1 U). DNA template is added to this 36 master mixture as following to make a 40 reaction mixture:

* For clinical samples - 36[micro]l of the master mixture + 4[micro]l of the DNA template

* For positive controls - 36[micro]l of the master mixture + 2[micro]l of the template DNA of M. Tuberculosis /M. Bovis + 2[micro]l of sterile water

* For negative controls - 36[micro]l of the master mixture + 4[micro]l of sterile water

The eppendorf tubes were vortexed and then centrifuged. After this they were put in the thermal cycler (PTC BIO RAD) for DNA amplification. The program for N1S1 PCR assay includes initial denaturation (95[degrees]C x 10'), cycle denaturation (94[degrees]C x 1.30'), cycle annealing (60[degrees]C x 1.30'), cycle extension (72[degrees]C x 1.50') and final extension (72[degrees]C x 30') with 35 numbers of cycles. Two 645 and 618bp products were obtained for M. tuberculosis and M. bovis respectively. The amplicons were electrophoresed on 1.5% agarose gel containing ethidium bromide and viewed under ultraviolet light in a gel documentation system (Alpha DigiDoc, Alpha Innotech Corporation). Using the amplified products of NISI PCR assay, a nested PCR for amplification of the C - terminal of the hup B gene was done.

The program for CTFR-PCR assay includes initial denaturation (95[degrees]C x 10'), cycle denaturation (94[degrees]C x 1'), cycle annealing and extension (60[degrees]C x 0.30') and final extension (72[degrees]C x 7') with 35 numbers of cycles. The size of the amplicons obtained after the second amplification was 118bp and 89bp for M. tuberculosis and M. bovis respectively. The products were resolved in 8% PAGE, stained with ethidium bromide and viewed in a gel documentation system (Alpha DigiDoc, Alpha Innotech Corporation).

Follow up

All patients were put on therapeutic trial of Category I ATT and were followed up for 3 months. The response to therapy was considered as the gold standard in our study.

Statistical analysis

Taking response to therapy as gold standard, sensitivity, specificity, positive predictive value and negative predictive value of different assay methods were calculated. The observed data were analysed by SPSS version 12.

RESULT

Of the hundred patients enrolled in our study, forty eight patients showed positivity for the hup B gene PCR assay. Of these 48 patients, 45 were positive for M. tuberculosis, 1 patient was infected with M. bovis and co-infection with both species was seen in two patients. (Figure 1)

A highly significant association was found with pH, ADA, IgG, cholesterol and lactate. (Table 1)

Follow up of patients

One hundred patients were enrolled in the study on the basis of clinical suspicion of tubercular ascites. All were put on therapeutic trial of anti tubercular therapy (ATT) [Category I, 2 (HRZE)3 + 4 HR as per Revised National Tuberculosis Control Programme (RNTCP), India]. Patients were followed up after 3 months to see the response to therapy. 21 patients were lost to follow up. 79 patients were left in the study to see the response to therapy and out of these 79 patients, only 39 were PCR positive and 35 responded to Anti Tubercular therapy. (Table 2)

Taking ATT response as gold standard, PCR assay had sensitivity, specificity, positive and negative predictive value are 97.1%, 88.6%, 87.2% and 97.5% respectively.

DISCUSSION

Tuberculosis (TB), though curable, still remains a major killer disease worldwide and twenty one percent of the world's TB-infected population is in India (1). Tuberculosis in humans is mainly caused by Mycobacterium tuberculosis but Mycobacterium bovis has also been recognized as a potential human pathogen.

Conventional methods like AFB smear microscopy and Culture are time consuming, thus they cannot be used for rapid diagnosis of tuberculosis. Polymerase chain reaction (PCR), targeting various genes for amplification has been tried as a rapid diagnostic technique.

Our results show that the PCR assay targeting hup B gene was positive in 48 patients including forty five patients positive for M. tuberculosis, one for M. bovis and two for both M .tuberculosis and M. bovis. In last few years, various researchers like Grange et al (12), Cosivi et al (13) and Cole et al (14) reported M. bovis infection in humans. Earlier studies on hup B gene by Mishra et al (7), Prasad et al (6) and Shah et al (15), also reported M. bovis infection in human extra pulmonary samples.

Of the 100 patients enrolled in our study, all were put on therapeutic trial of anti tubercular therapy (ATT) [Category I, 2 (HRZE)3+ 4 HR as per Revised National Tuberculosis Control Programme, India (RNTCP)]. Patients were followed up after 3 months to see the response to therapy. Twenty one patients were lost to follow up. 79 patients were left in the study to see the response to therapy and out of these 79 patients, only 39 were PCR positive and 35 responded to Anti Tubercular therapy.

Of the 35 patients that responded to ATT, only 34 were PCR positive. The false negative result found in the study could be attributed to the paucibacillary nature of the disease and disparity in the distribution of the bacilli in the sample aliquots (9).

Five false positive cases were obtained in the study. These cases did not improve after 3 months of therapeutic trials with ATT (Category I, RNTCP, India) (1) and were later diagnosed as carcinoma liver, carcinoma ovary, 2 cases of polymicrobial peritonitis and bacterial peritonitis respectively. In the 2 patients in whom malignancy was diagnosed, the false positivity could be attributed to the fact that in India where prevalence of tuberculosis is very high, the immunosuppressive nature of a malignant lesion is capable of reactivating a latent tubercular infection; hence malignancy and tuberculosis may coexist.

The PCR assay in our study showed a sensitivity of 97.1% and specificity of 88.6%. Various researchers using different targets in extra pulmonary samples have shown sensitivity and specificity ranging from 22-90% and 77-100% respectively (2,16). A study by Chakravorty et al (10) on extra pulmonary samples showed a sensitivity and specificity of 46.7-83% and 67-100% respectively. The positive predictive value 87.2% and negative predictive value 97.5% obtained in our study also correlated with the work by Chakravorty et al (10,11).

CONCLUSION

The good sensitivity and specificity obtained in the study advocates the use of PCR in future use as a routine diagnostic tool for tubercular ascites. Another added advantage is the ability to identify between M. tuberculosis and M. bovis which otherwise have similar clinical presentation.

REFERENCES

(1.) TB India 2009, RNTCP Status report 2009;13.

(2.) Nambam B, Prasad HK, Sherwal BL, et al. Comparative analysis of a hup B gene based diagnostic PCR with other conventional techniques for pediatric tuberculous meningitis. J Pediatr Infect Dis. 2006 Oct;1(3):143-8.

(3.) Uygur-Bayramicli O, Dabak G, Dabak R. A clinical dilemma: abdominal tuberculosis. World J Gastroenterol. 2003 May;9(5):1098-101.

(4.) Peda Veerraju E, Abdominal Tuberculosis. In: Satya Sri S, editor. Textbook of pulmonary and extrapulmonary tuberculosis. rd ed. New Delhi. 1998;250-2.

(5.) Prabhakar S, Mishra A, Singhal A, et al. Use of the hupB gene encoding a histone-like protein of Mycobacterium tuberculosis as a target for detection and differentiation of M. tuberculosis and M. bovis. J Clin Microbiol. 2004 Jun;42(6):2724-32.

(6.) Prasad HK, Singhal A, Mishra A, et al. Bovine tuberculosis in India: potential basis for zoonosis. Tuberculosis (Edinb). 2005 Sep Nov;85(5-6):421-8.

(7.) Mishra A, Singhal A, Chauhan DS, et al. Direct detection and identification of Mycobacterium tuberculosis and Mycobacterium bovis in bovine samples by a novel nested PCR assay: correlation with conventional techniques. J Clin Microbiol. 2005 Nov;43(11):5670-8.

(8.) Patra SK, Jain A, Sherwal BL, et al. Early diagnosis and species differentiation in multi drug resistant-tuberculosis by nested polymerase chain reaction targeting hupB gene. Int J Pharma Bio Sci. 2010 Jul Sep;1(3):1-7.

(9.) Fauci A, Braunwald E, Kasper DL, et al. Harrison's Principle of Internal Medicine, McGraw-Hill, USA, 17th ed, 2008;1:267.

(10.) Chakravorty S, Tyagi JS. Novel multipurpose methodology for detection of mycobacteria in pulmonary and extrapulmonary specimens by smear microscopy, culture, and PCR. J Clin Microbiol. 2005 Jun;43(6):2697-702.

(11.) Chakravorty S, Dudeja M, Hanif M, et al. Utility of universal sample processing methodology, combining smear microscopy, culture, and PCR, for diagnosis of pulmonary tuberculosis. J Clin Microbiol. 2005 Jun;43(6):2703-8.

(12.) Grange JM. Mycobacterium bovis infection in human beings. Tuberculosis (Edinb). 2001;81(1-2):71-7.

(13.) Cosivi O, Grange JM, Daborn CJ, et al. Zoonotic tuberculosis due to Mycobacterium bovis in developing countries. Emerg Inf Dis. 1998 Jan-Mar;4(1):59-70.

(14.) Cole ST, Brosch R, Parkhill J. et al. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature. 1998 Jan;393(6685):537-44.

(15.) Shah NP, Singh A, Jain A, et al. Occurrence of overlooked zoonotic tuberculosis: detection of Mycobacterium bovis in human cerebrospinal fluid. J Clin Microbiol. 2006 Apr;44(4):1352-8.

(16.) Verma P, Jain A , Patra SK ,Gandhi S, Sherwal BL, Chaudhary M. Evaluation of Polymerase Chain Reaction (PCR) using hupB gene in diagnosis of tuberculous lymphadenitis in fine needle aspirates. Indian J Tuberc. 2010 Jul;57(3):128-33.

(Received 19 August 2011 and accepted 21 October 2011)

Anju Jain * ([PSI]), Vivekanand Sharma **, Surajeet Kumar Patra ***, Atul Goel ([dagger]) and B L Sherwal ([double dagger])

* Director Professor, ** Resident, *** Senior Resident, Department of Biochemistry, ([dagger]) Professor, Department of Medicine, ([double dagger]) Director Professor, Department of Microbiology, Lady Hardinge Medical College and associated hospitals, New Delhi, India

([PSI]) Correspondence at: Department of Biochemistry, Lady Hardinge Medical College and associated hospitals, New Delhi, India; Phone: 00911123408149; Email: dranjujain@rediffmail.com
Table I. Comparative analysis of Ascitic fluid parameters in PCR
positive patients (n=48)

Parameters                     Positive   %      P value

pH (> 7)                       30         62.5   0.0001
SAAG (<1.1 gm/dl)              18         37.5   0.042
ZN stain                       1          2.1    0.954
Culture                        0          -      -
ADA (> 30 U/L)                 48         100    0.0001
IgG (> 400 U/ml)               46         95.8   0.0001
AF / Serum glu. ratio (<0.96)  31         64.6   0.907
Cholesterol (>55 mg/dl)        33         68.8   0.0001
Lactate (<25mg/dl)             43         89.6   0.0001

Table 2: Comparison between response to ATT

and PCR

                       Response to ATT
                       Positive          Negative   Total

PCR assay   Positive   34                5          39

            Negative   1                 39         40

Total                  35                44         79

Figure 1: Type of Mycobacterial Infection in
ascitic fluid

* M.tuberculosis   93.75%

* M.Bovis           2.08%

* Co-infection      4.17%

Note: Table made from pie chart
Gale Copyright: Copyright 2012 Gale, Cengage Learning. All rights reserved.