|
Cloning and expression analysis of allograft
inflammatory factor type 1 in coelomocytes of antarctic sea urchin
(Sterechinus neumayeri).
|
|
|
|
|
| Article Type: | Report |
| Subject: |
Sea urchins
(Research) Immune response (Research) |
| Authors: |
Ovando, Fernanda Gimpel, Carla Cardenas, Constanza Da Silva, Jose Roberto Machado Cunha De Lorgeril, Julien Gonzalez, Marcelo |
| Pub Date: | 08/01/2012 |
| Publication: | Name: Journal of Shellfish Research Publisher: National Shellfisheries Association, Inc. Audience: Academic Format: Magazine/Journal Subject: Biological sciences; Zoology and wildlife conservation Copyright: COPYRIGHT 2012 National Shellfisheries Association, Inc. ISSN: 0730-8000 |
| Issue: | Date: August, 2012 Source Volume: 31 Source Issue: 3 |
| Topic: | Event Code: 310 Science & research |
| Geographic: | Geographic Scope: Antarctica Geographic Code: 8ANTA Antarctica |
|
|
|
| Accession Number: | 303011415 |
| Full Text: |
ABSTRACT We have cloned and characterized for the first time an
allograft inflammatory factor 1 (Sn-AIF-1) from the Antarctic sea
urchin. We report the cloning of Sn-AIF-I cDNA and the characterization
of its expression in coelomocytes after a bacterial challenge. The cDNA
Sn-AIF-1 has a size of 608 bp and encodes a polypeptide of 151 aa. The
deduced anaino acid sequence has a putative size of 17.430 Da, an
isoelectric point of 4.92, and shows 2 elongation factor handlike motifs
that normally bind calcium ions. BLAST analysis revealed close matches
with other known AIF-1. The deduced amino acid sequence of Sn- AIF-1
showed high homology with AIF-1 in vertebrates such as fish, mice, and
humans; and in the case of invertebrates, the major degree of identity
(55%) was with a predicted sequence of the purple sea urchin AIF-1, and
52% corresponded to a sponge. Expression of Sn-AIF-1 mRNA was analyzed
by qPCR. Sn-AIF-1 mRNA expression was measured from coelomocytes after a
bacterial challenge using RT-PCR and revealed that the gene was
upregulated after 24 h. Sn-AIF-1 could participate in the inflammatory
response, particularly in the activation of coelomocytes and their
survival. KEY WORDS: Antarctica, sea urchin, Sterechinus neumayeri, coelomocytes, gene expression, AIF-1 INTRODUCTION The homeostasis of an organism is ensured by a delicate system that can be disrupted when the integrity of the animal is affected by mechanical damage, infection, or presence of parasites. Marine echinoderms represent an important group of invertebrates and a major component of marine communities that may be vulnerable to a variety of environmental pathogens. Their vulnerability may be increased by an increase in water temperature (Pearse 2006, Tajima et al. 2007), as occurs in global warming. Thus, the capacity to respond to a dynamic environment can dictate the success or failure of populations and species over time. In the case of Antarctic marine invertebrates, assessing their physiological ability to survive sublethal temperatures can indicate whether these animals may adjust to new environmental conditions. Their innate immune system supports the adaptation process. It allows the animals to protect themselves and maintain a certain balance between them and different populations of microorganisms that belong either to the marine environment or the body itself. The Antarctic sea urchin Sterechinus neumayeri has evolved under a cold and thermally stable environment for many years, similar to most of the Antarctic coastal benthic organisms. Physiological stress could increase their mortality rate and lower the recruitment success of the native species, thus opening an ecological niche for invading predators, which would be at a competitive advantage (Aronson et al. 2007). Like all invertebrates, sea urchins have an innate immune system. In this particular case, the characteristic cells are called coelomocytes. They represent the keys of an innate immune response, acting as the main effectors by, for example, being the primary mediators in the rejection of an allograft. These cells stay in the body cavity, on the coelomic fluid present in the circulatory system of adults and larvae echinoderms. The coelomocytes mediate immune responses, performing phagocytosis and encapsulation of foreign particles, in conjunction with the release of antimicrobial molecules by degranulation (Smith et al. 2006). Information regarding immune mechanisms of Antarctic marine invertebrates is limited. Few studies have been carried out, and mainly in the context of the inflammatory response and phagocytosis at low temperatures (Silva et al. 1998, Silva & Peck 2000, Silva et al. 2001). For S. neumayeri, the only available study is about the types of coelomocytes and their capacity as phagocytes (Shimada et al. 2002). In echinoderms, the classification of coelomocytes is based essentially on a morphological criterion (Gross et al. 2000), which distinguishes 4 categories: phagocytes, vibratile cells, red spherule cells, and colorless spherule cells. The purple sea urchin (Strongylocentrotus purpuratus) has been used as model for molecular, evolutionary, and cellular biology, as well as in immune response studies (Smith et al. 2006). In the past, molecular approaches have produced a significant amount of genetic information about different immune effectors. Techniques such as express sequence tag analyses, differential display, and suppressive subtractive hybridization have led to the characterization of an important number of immune-related genes expressed in sea urchin coelomocytes (Smith et al. 1996, Clow et al. 2000, Nair et al. 2005). It is expected that the purple sea urchin expresses a vast set of family genes related to an immune response after a lipopolysaccharide (LPS) challenge, as do other marine invertebrates. Surprisingly, the animal also expresses a high number of these genes, such as 185/333, toll-like receptors, leucine-rich repeat-containing proteins, and multiple scavenger receptor cysteine-rich (Rast et al. 2006, Terwilliger et al. 2007). During a microbial challenge, consisting of the injection of bacteria, either by LPS or natural infection, coelomocytes display great cellular activity, such as chemotaxis or proliferation. They migrate rapidly toward injured sites to discharge their molecular effector content or to display phagocytosis. In the case of the purple sea urchin, challenging it with LPS has been found to increase the expression of cell proliferation genes in coelomocytes. Express sequence tags related to proliferation or apoptosis were identified in 3 of these coelomocytes (Nair et al. 2005). The first is a polo-like kinase that is a serine/ threonine protein kinase implicated in mitosis, the second matched the Bax inhibitor-1 linked to the inhibition of the apoptotic pathway, and the third is an allograft inflammatory factor-1 (AIF-1). Last, there is a cytoplasmic Ca+2 binding protein expressed in macrophages and implicated in graft rejection (Autieri et al. 2000, Barr et al. 2004, Huckelhoven 2004). The sequence obtained from purple sea urchin, like AIF, has Genbank accession no. CV652693. In 2006, the genome of the purple sea urchin was sequenced and it produced another sequence similar to AIF derived by automatic computational analysis using gene prediction (Sea Urchin Sequencing Consortium 2006). MATERIALS AND METHODS Animals, Coelomocyte Counting, and Bacterial Challenge Antarctic sea urchins S. neumayeri were collected manually by scuba divers at depths ranging from 4-10 m. Experimental challenges were conducted with a first group of urchins (20 animals) to stimulate an immune response by injecting a mixture of 200 [micro]L per urchin (1 x [10.sup.6] bacteria/mL) of heat-killed strains (Escherichia coli, Sahnonella typhimurium and Staphylococcus aureus) into the coelomic cavity. A second group, used as a control group and not injected (20 animals), were arranged in situ with the stimulated group in separate cages at a depth of 6 m in Maxwell Bay (King George Island, Antarctica) during the experiment to avoid thermal stress. Twenty-four hours and 48 h after stimulation, coelomocytes of the stimulated and control groups were recovered (10 animals per time) from the body cavity and centrifuged immediately at 404g for 5 min (5[degrees]C). During this first phase, coelomocytes were used individually to count the total number of cell and red cell fractions in a Neubauer chamber. During the second phase, coelomocytes were stored in RNA (Ambion) for the subsequent total RNA extraction. Three independent experiments were performed with the same experimental conditions. To compare the data, Student's t-test using STATISTICA software was used, and a statistical difference was accepted when P < 0.05. RNA Extraction, cDNA Synthesis, PCR, and Cloning Total RNA was extracted from S. neumayeri from coelomocytes and tissues using a Trizol reagent (Invitrogen) and treated afterward with DNAse Turbo (Ambion) according to the manufacturers' instructions. Then, the quantity and the integrity of the total RNA were checked by spectrophotometric and agarose gel electrophoresis, respectively. A total of 1 [micro]g total RNA was reverse transcribed in a final volume of 20 [micro]L using M-MLV reverse transcription kits (Invitrogen) according to the manufacturer's instructions, cDNA has served as a matrix in PCR reactions on selected genes to isolate them or semi-quantify their expressions. Primers were designed from the sea urchin AIF cDNA sequence (Nair et al. 2005) AIF 1 Forward (Fw): TGTCAACAAAGAGGGGGAAA, AIF 2 Fw: ACGG AAGTGGAACCATCAAC, and AIF 3 Reverse (Rv): CAGA TGTGGAGCAGCGTAAA to amplify full Antarctic sea urchin AIF cDNA. The elongation factor (EF) was used as a reference gene (EF Fw: TCATCTACAAATGCGGTGGA, EF Rv: GGTGCATCGATGACAGTGAC). cDNA was amplified by PCR, using 1 U Taq polymerase (Invitrogen) and 1 [micro]M each primer at a final volume of 25 [micro]L. An amplification program for PCR consisted of 5 min at 94[degrees]C, followed by 30 cycles at 94[degrees]C for 45 sec, 55[degrees]C for 45 sec, and 72[degrees]C for 1 min, and finally an elongation step at 72[degrees]C for 10 min. Amplified products were analyzed on 1% agarose gels, cloned into the PCR 2.1 TOPO TA cloning vector (Invitrogen), and sequenced from both directions with T7 and T3 primers. Sequence Analysis General homology searches were performed with Blast (Altschul et al. 1990) using the NCBI server. Physicochemical parameters of a protein sequence were determined using Prot-Param through the ExPASy server. Deduced amino acid sequences were aligned by ClustalW (Larkin et al. 2007) and analyzed with Jalview (Waterhouse et al. 2009). Phylogenetic and molecular evolutionary analyses were conducted using MEGA version 3.0 (Tamura et al. 2007). The tree was inferred using the Unweighted Pair Group Method with Arithmetic Mean (UPGMA), based on the alignment of the sequences using ClustalW (alignment was improved using the Seaview software). Resultant tree topologies were evaluated by bootstrap analyses based on 1,000 resamplings. A homology model for the amino acid sequence was constructed via the Swiss model (Arnold et al. 2006) and analyzed using the Swiss-Pdb viewer (Guex & Peitsch 1997) and VMD software (Humphrey et al. 1996). The EF hand motifs were determined by bioinformatic tools (SMART) (Schultz et al. 1998). Quantitative PCR Analyses Quantitative PCR (qPCR) analysis was done to determine whether acute changes in Sn-AIF-1 expression could be detected from coelomocytes sampled 24 h and 48 h poststimulation. The primers AIF 2 Fw and AIF 3 Rv were used. The qPCR reactions were composed of 1.0 [micro]L cDNA diluted at a 1:10 ratio, 0.5 [micro]L both primers (5 [micro]M) adding 25 [micro]L of a ready-to-use solution of SYBR Green PCR Master Mix (Applied Biosystems) and 23 [micro]L ultra pure water to completed 50 [micro]L final reaction volume. Amplification conditions, performed in an ABI Thermocycler 7500, consisted of 40 cycles at 94[degrees]C for 10 min, 94[degrees]C for 1 min, 55[degrees]C for 1 min, and 72[degrees]C for 1 min with a single fluorescence measurement; a melting curve program; and finally a cooling step. For further analysis of the expression level, the crossing points (CP) were determined for each transcript using the 7500 program version 2.0.1 (Applied Biosystems). Specificity of qPCR product was determined by agarose gel electrophoresis and melting curve analysis. The copy ratio of each analyzed cDNA was determined as the mean of 3 technical replicates. The relative expression level of Sn-AIF-I was calculated based on the [2.sup.-[DELTA][DELTA]CP] method using the EF-1[alpha] as the reference gene (Livak & Schmittgen 2001). Three independent experiments were performed on a pool of 10 sea urchins from both defined groups and with the same timing. Data were subjected to Student's t-test. RESULTS Coelomocyte Count The results obtained show a significant increase in the total amount of coelomocytes in sea urchins exposed to the bacteria injection after 24 h (6.27 [+ or -] 1.0 x [10.sup.6]/mL, P < 0.05) compared with the control group at the same time (3.7 [+ or -] 0.5 x [10.sup.6]/mL). However, at 48 h postinjection, the total number of coelomocytes (5.8 [+ or -] 1.4 x [10.sup.6]/mL) was not significantly greater than that of the control group (4.6 [+ or -] 0.4 x [10.sup.6]/mL; Fig. 1A). Red cells did not present significant differences, but only a tendency to increase, resulting from high interindividual variation in stimulated urchins (Fig. 1B). [FIGURE 1 OMITTED] Characteristics of Sn-AIF-1 Transcript and Protein PCR amplification of an AIF in S. neumayeri with primers, designed from AIF sequences available in the public database, allowed us to obtain a sequence of 641 nucleotide (nt) named Sn-AIF-1 (GenBank accession no. FJ824731). The sequence of Sn-AIF-l is composed by an incomplete 5' UTR of 110 nt followed by an ORF of 456 nt, then an incomplete 3' UTR of 82 nt. The best hits of Sn-AIF-1, through Blastn homology search, are S. purpuratus sequences (83 % of nucleotide identity). The deduced amino acid sequence Sn-AIF-1 (GenBank accession no. ACO40483) is composed of 151 aa with a molecular weight of 17.43 KDa and an isoelectric point of 4.92. A summary of the main features of Sn-AIF-I and comparisons with sequences from others species are presented in Table 1. In the multiple alignment showed in Figure 2, Sn-AIF-1 presented identities between 55.6% (S. purpuratus) and 38.1% (bovine and mouse). Interestingly, Sn-AIF-1 presents a relatively low isoelectric point compared with other species (except for S. purpuratus); it also exhibits a high Gly/Ala ratio, a high percentage of polar amino acids without charge, and a slightly higher Ile/Leu ratio compared with other AIF sequences. The charge is in the same range of other invertebrates, and the content of charged residues is equivalent between sea urchins but a little less than other species. The hydrophobic amino acid content was calculated by using the grand average of hydropathicity (GRAVY) index. The negative value for Sn-AIF-1 was less than the value calculated for S. purpuratus AIF-1 and other AIF family proteins (Table 1), indicating that Sn-AIF-1 is less hydrophobic. Moreover, the aliphatic index was calculated using the method of Ikai (1980), and Sn-AIF-1 was lower than the S. purpuratus AIF-1 (Table 1). Sn-AIF-1 has 2 canonical EF hands with a motif signature PS00018 (http://www.expasy.org/prosite/PS00018), whereas the other proteins have only one canonical motif. The second is usually a degenerate motif with some amino acid changes (Fig. 2). The first EF hand motif presents high homology between species. The amino acids with potential calcium-binding activity are mostly Asp in the invertebrate AIF, whereas the second EF loop has low homology and the potential residues that bind calcium are mostly polar amino acids without charge (Fig. 2). In Sn-AIF-I, the 2 calcium-binding loops of 12 aa are located between positions 62 and 73, and 98 and 109, respectively, and are flanked by 2 helixes forming an EF hand motif(Fig. 3). The homology model constructed with Homo sapiens AIF as a template (PDB ID 2G2B), was consistent with the secondary structure prediction, showing a tendency toward a random coil at the N and C terms, and the helix-loop-helix structure was very similar to other AIFs in the rest of the protein showing the 2 EF hand motifs and the potential calcium-binding amino acids (Figs. 2 and 3). A detailed comparison with the potential sequence of S. purpuratus showed that the 2 EF loops are highly conserved without any changes in the calcium-binding residues. There are only 2 amino acid changes in the second loop: [F.sub.107][R.sub.108] in Sn-AF1 with [Y.sub.79][K.sub.80]. Other changes in amino acids outside the active regions are [T.sub.37][Q.sub.38][N.sub.39][T.sub.40][L.sub.84][H.sub.87][Q.sub.112] [T.sub.119] [N.sub.132] [E.sub.134] [K.sub.137] [V.sub.139] [P.sub.141] in Sn-AF1 by [H.sub.9][K.sub.10][T.sub.11][L.sub.12] [P.sub.56] [Q.sub.59] [H.sub.84] [S.sub.91] [M.sub.104] [A.sub.106] [I.sub.109] [T.sub.111] [L.sub.113] in S. purpuratus. On the other hand, AIF-1 contains a typical pattern of precursors of hormonally active peptide (-KR-KK-GKR-). However, this motif in Sn-AIF-1 and also in the S. purpuratus sequence presents 5 amino acid substitutions (Fig. 2). In the first double basic (KR), 2 amino acid substitutions are produced; the lysine (K) is changed by arginine (R) and R is changed by valine (V). In the second double (KK), K is changed by R; in the final tripeptide (GKR), the K and R are replaced by glycine (G) and K, respectively. Phylogenetic Analyses Phylogenetic analysis showed, as with the amino acid identities between sequences (Table 1), 2 major clusters of species. On the one hand, the first cluster is composed exclusively of sequences from vertebrate species in which mammals are grouped like fishes (Fig. 4). On the other hand, the second cluster is composed exclusively of sequences from invertebrate species with Sn-AIF- 1 similar to the S. purpuratus sequence. The tree suggests that the Sn-AIF-I gene is an ortholog of an AIF gene sequence already described for the purple sea urchin (Nair et al. 2005). The tree was split depending on the origin of the AIF inferred protein sequence that contained the EF hand motif. Gene Expression of Sn-AIF-1 in Urchin Tissues and During Bacterial Stimulation First, a classic PCR approach was used to estimate the Sn-AIF-I gene expression level in different tissues in coelomocytes, the axial organ, and the digestive gland. Results show a constitutive expression in all tissues compared with EF expression signals. However, the Sn-AIF expression in the digestive gland was more elevated than in the other tissues (Fig. 5A). [FIGURE 2 OMITTED] Second, we used qPCR to evaluate expression-level changes of Sn-AIF-1 in coelomocytes during a bacterial challenge. Although Sn-AIF-1 was expressed constitutively in uninfected urchins, relative expression of Sn-AIF-1 presented a significant increase 24 h postinjection compared with noninjected sea urchins, returning to a noninjected urchin's level at 48 h post-infection (Fig. 5B). We can notice that relative expressions of Sn-AIF-1 were calculated using EF-l[alpha] as the reference gene. DISCUSSION It has been reported that several temperate echinoderm species are capable of differentiating self from nonself tissues through allograft rejection studies (Smith & Davidson 1992, Smith et al. 2006). The cells responsible for this action are coelomocytes, which play a role as the main effectors of the immune response and as the primary mediators of allograft rejection (Coffaro & Hinegardner 1977, Smith et al. 2006). Insight into the immune response of Antarctic organisms has been poorly studied because we have little information about the molecular process related to immune response at polar temperatures. The current study reports the identification of an AIF in coelomocytes of the Antarctic sea urchin S. neumayeri (Sn-AIF-1) that shows an increase of expression during the first phase of the immune response of a bacterial challenge. In addition, some physicochemical properties of Sn-AIF-1 could be associated with a cold adaptation, because the protein is less hydrophobic than temperate AIF. [FIGURE 3 OMITTED] In echinoderms, the recognition response of self and nonself could be observed by the rejection of the grafts, a reaction comparable with that of vertebrates. In echinoderms, the coelomocytes play a role similar to that of macrophages in this important process (Coffaro & Hinegardner 1977). Sea urchin coelomocytes produce a typical gene activation response in the presence of bacteria, allogenic stimulation, and injury (Smith et al. 1996). The potential role of coelomocytes in the immune response of the Antarctic sea urchin is still unclear. AIF was first identified in rat cardiac allografts with chronic rejection (Utans et al. 1995). The expression of this gene was shown to be inducible on the allografts, but not in the autografts from sponges (Kruse et al. 1999). The sequence of Sn-AIF-1 was obtained using primers designed from conserved regions of different proteins isolated from other organisms, such as sea urchins, sponges, molluscs, fishes and mammals. However, the sequence of AIF-1 from S. purpuratus, was isolated from coelomocytes using the suppressive subtractive hybridization approach (Nair et al. 2005). AIF has a conserved sequence motif that represents a typical signature of protein precursors. This motif is also a characteristic of peptide hormones flanked by dibasic sites, constituting cleavage sites for the processing enzymes (Steiner et al. 1992, Seidah et al. 1993). The sequence GKR is a signal for the formation of a C-terminal amide during the assembly. The Sn-AIF-1 protein could be a precursor protein and could show dissimilar sequences of these motifs, which are used for posttranslational modifications. The Antarctic sea urchin shows 5 substitutions in this motif, and the charged lysine is replaced by a hydrophobic amino acid, valine, or neutral glycine. Interestingly, the same substitutions are present in the purple sea urchin. The roles in protein processing of these substitutions in urchin species have yet to be elucidated. The high homology between the 2 sea urchin species compared with other species is also found, but to a lesser degree, in calcium-binding sites of the EF hands, which present the same 3-dimensional predicted structure that a human AIF. The first calcium-binding sites appear identical, but 2 substitutions are detected in the second motif, in S. neumayeri compared with S. purpuratus. These calcium-binding sites have been identified in different proteins related to calcium regulation, which include calmodulin, troponin C, and parvalbumins (Lewit-Bentley & Rety 2000). Low temperature could be affecting the binding affinity of calcium in cold-adapted animals. The substitutions between Antarctic and purple sea urchins in calcium-binding sites and in entire EF hands could be sites of interests to study calcium affinity according to different temperature. A comparison of Sn-AIF1 with parvalbumins shows a higher homology between the 2 EF loops and the potential calcium-binding amino acids. Although there are different proteins, the tendency of increased polar noncharged anaino acids is a shared feature with Antarctic organisms (Erickson et al. 2005, Erickson & Moerland 2006). If we compare these modifications with another protein that has an EF hand motif present in polar fish parvalbumins, these amino acid substitutions are not implicated directly in the calcium-binding activity. Arctic and Antarctic fish have greater affinity to calcium compared with other like temperate fish (Erickson et al. 2005). Last, the high homology of AIF between urchin species is showed by the phylogenetic tree construct from available AIF sequences, which present a distribution of species in accordance with classical phylogenetic groups. [FIGURE 4 OMITTED] The behavior of Sn-AIF1 in amino acid contents can be related to those reported for other proteins in cold-adapted changes. The low content of Ala, in contrast to Gly, is related to a decrease in bulky side chains and an increase in structural flexibility features (Hochachka & Somero 2002). Besides, the high percentage of polar amino acids without charge is related to hydrogen bond formation, which may contribute to the interaction with the solvent, ensuring stability and functionality at low temperatures. In addition, most of these residues (S, T, Q, N) are located in the exposed area of the protein, according to the homology model, reinforcing the observations made for the primary structure, as well as Gly. Another characteristic of Sn-AIF1 is their low values of GRAVY and in the aliphatic index, by contrast proteins having high thermostability proteins with high thermostability shown higher indices in hydrophobic amino acid and in the relative volumes of the Ala, Val, Ile, and Leu residues (Ikai 1980, Kulakova et al. 1999). The role of Sn-AIF-1 in the immune response of S. neumayeri has been approached in this study by measuring an increase in coelomocyte expression 24 h after bacterial stimulation (not only a constitutive expression). During this bacterial stimulation, we also observed an increase of the total number of coelomocytes, which is in accordance with previous studies of echinoderms S. purpuratus and Asterias rubens, in which bacteria and LPS produced an increase in the number of coelomocytes after injection (Clow et al. 2000, Coteur et al. 2002., Holm et al. 2008). This production of coelomocytes is associated with the clearance of bacteria in coelomic fluid of the sea star (Desmarterias inbricata) after injection, by phagocytosis, digestion of bacteria, and lysosome involvement (Kaneshiro & Karp 1980). However, an increase in the number of coelomocytes is detected at 24 h and 48 h after stimulation, whereas Sn-AIF-I expression returns to basal level at 48 h after stimulation. This temporal variation between coelomocyte number and Sn-AIF-1 expression at 48 h could be the result of an implication of Sn-AIF-1 in the early immune response (until 24 h). The transitory role of Sn-AIF-1 is in agreement with human AIF-1, which has been reported to be a modulator for the immune response in macrophages (Utans et al. 1995, Utans et al. 1996), and strongly induced by cytokines and T lymphocytes (Autieri et al. 2000). Recently, in the mussel Mytilus galloprovincialis, the expression of AIF was over-expressed by injection of Vibrio splendidus in association with several other genes implicated in cell proliferation (Venier et al. 2011). The overexpression of a mammal's AIF-1 promotes cell activation, proliferation, and survival of different cells implicated in the inflammatory reaction (Autieri & Carbone 2001, Yang et al. 2005, Tian et al. 2009). Sn-AIF-1 seems to be associated with an immune response related to the first phase of coelomocyte proliferation. Together with the specific expression in coelomocytes, Sn-AIF- 1 could be a good candidate to localize hematopoietic sites and identify distinct cell types involved in this inflammatory response. In echinoderms, several organs and tissues have been proposed as hematopoietic tissues (Munoz-Chapuli et al. 2005, Holm et al. 2008). The main tissues are coelomic epithelium, axial organ, and the Tiedemann bodies. [FIGURE 5 OMITTED] However, in Antarctic echinoderms, there aren't any studies regarding which organs or tissues are implicated in cellular proliferation or how that proliferation is possible at low temperatures. The potential to evaluate the immune response, physiochemical properties, as well as possible adaptation to the cold in these Antarctic organisms, such as S. neumayeri, should be investigated in future studies. ACKNOWLEDGMENTS This study was supported by grants from the CONICYT-Chile (Fondecyt 11090265) and logistic support by the Chilean Antarctic Institute (INACH) by project OA-03-07. We thank Emma Newcomb and Cesar Cardenas for diving support. We acknowledge Rigofredo Veneros at the Servicio Agricola Ganadero (SAG, Punta Arenas) for providing technical facilities. LITERATURE CITED Altschul, S. F., W. Gish, W. Miller, E. W. Myers & D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410. Arnold, K., L. Bordoli, J. Kopp & T. Schwede. 2006. The SWISS-MODEL workspace: a Web-based environment for protein structure homology modelling. Bioinformatics 22:195-201. Aronson, R. B., S. Thatje, A. Clarke, L. Peck, D. B. Blake, C. D. Wilga & B. A. Seibel. 2007. Climate change and invasibility of the Antarctic benthos. Annu. Rev. Ecol. Evol. Syst. 38:129-154. Autieri, M. V., A. Mu & C. Carbone. 2000. Expression of allograft inflammatory factor-1 (AIF1) is a marker of activated human VSMC and arterial injury. Arterioscler. Thromb. Vasc. Biol. 20: 1737-1744. Autieri, M. V. & C. M. Carbone. 2001. Overexpression of allograft inflammatory factor-I promotes proliferation of vascular smooth muscle cells by cell cycle deregulation. Arterioscler Thromb Vasc Biol 21:1421-1426. Barr, F. A., H. H. W. Sillje & E. A. Nigg. 2004. Polo-like kinase and the orchestration of cell division. Nat. Rev. Mol. Cell Biol. 5:429-440. Clow, L. A., P. S. Gross, S. C. Shih & L. C. Smith. 2000. Expression of SpC3, the sea urchin complement component, in response to lipopolysaccharide. Immunogenetics 51 : 1021-1033. Clow, L. A., D. A. Ratios, P. S. Gross & L. C. Smith. 2004. The sea urchin complement homologue, SpC3, functions as an opsonin. J. Exp. Biol. 207:2147-2155. Coffaro, K. A. & R. T. Hinegardner. 1977. Immune response in the sea urchin Lytechinus pictus. Science 197:1389-1390. Coteur, G., G. DeBecker, M. Warnau, M. Jangoux & P. Dubois. 2002. Differentiation of immune cells challenged by bacteria in the common European starfish, Asterias rubens (Echinodermata). Eur. J. Cell Biol. 81:313-418. Erickson, J. R. & T. S. Moerland. 2006. Functional characterization of parvalbumin from the Arctic cod (Boreogadus saida): similarity in calcium affinity among parvalbumins from polar teleosts. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 143:228-233. Erickson, J. R., B. D. Sidell & T. S. Moerland. 2005. Temperature sensitivity of calcium binding for parvalbumins from Antarctic and temperate zone teleost fishes. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 140:179-185. Gross, P. S., L. A. Clow & L. C. Smith. 2000. SpC3, the complement homologue from the purple sea urchin, Strongylocentrotus purpuratus, is expressed in two subpopulations of the phagocytic coelomocytes. Immunogenetics 5 l: 1034-1044. Guex, N. & M. C. Peitsch. 1997. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18:2714-2723. Hochachka, P. W. & G. N. Somero. 2002. Biochemical adaptation: mechanism and process in physiological evolution. Oxford: Oxford University Press. 466 pp. Holm, K., S. Dupont, H. Skold, A. Stenius, M. Thorndyke & B. Hernroth. 2008. Induced cell proliferation in putative haematopoietic tissues of the sea star, Asterias rubens (L.). J. Exp. Biol. 211: 2551-2558. Huckelhoven, R. 2004. BAX inhibitor-1, an ancient cell death suppressor in animals and plants with prokaryotic relatives. Apoptosis 9: 299-307. Humphrey, W., A. Dalke & K. Schulten. 1996. VMD: visual molecular dynamics. J. Molec. Graphics. 14:33-38. Ikai, A. 1980. Thermostability and aliphatic index of globular proteins. J. Biochem. 88:1895-1898. Kaneshiro, E. & R. Karp. 1980. The ultrastructure of coelomocytes of the sea star Dermasterias imbricata. Biol. Bull. 159:295-310. Kulakova, L., A. Galkin, T. Kurihara, T. Yoshimura & N. Esaki. 1999. Cold-active serine alkaline protease from the psychotrophic bacterium Shewanella strain Ac 10: gene cloning and enzyme purification and characterization. Appl. Environ. Microbiol. 65:611-617. Kruse, M., R. Steffen, R. Batel, I. M. Muller & W. E. Muller. 1999. Differential expression of allograft inflammatory factor 1 and of glutathione peroxidase during auto- and allograft response in marine sponges. J. Cell Sci. 112:4305-4313. Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan, H. McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R. Lopez, J. D. Thompson, T. J. Gibson & D. G. Higgins. 2007. ClustalW and Clusta1X version 2. Bioinformatics 23:2947-2948. Lewit-Bentley, A. & S. Rety. 2000. EF-hand calcium-binding proteins. Curr. Opin. Struct. Biol. 10:637-643. Livak, K. J. & T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C (T)). Methods 25:402-408. Munoz-Chapuli, R., R. Carmona, J. A. Guadix, D. Macias & J. M. Perez-Pomares. 2005. The origin of the endothelial cells: an evodevo approach for the invertebrate/vertebrate transition of the circulatory system. Evol. Dev. 7:351-358. Nair, S. V., H. Del Valle, P. S. Gross, D. P. Terwilliger & L. C. Smith. 2005. Macroarray analysis of coelomocyte gene expression in response to LPS in the sea urchin: identification of unexpected immune diversity in an invertebrate. Physiol. Genomics 22:33-47. Pearse, J. S. 2006. Ecological role of purple sea urchin. Science 314:940. Rast, P. J., L. C. Smith, M. Loza-Coll, T. Hibino & G. W. Litman. 2006. Genomic insights into the immune system of the sea urchin. Science 314:952-956. Schultz, J., F. Milpetz, P. Bork & C. P. Ponting. 1998. SMART, a simple modular architecture research tool: identification of signaling domains. Proc. Natl. Acad. Sci. USA 95:5857-5864. Sea Urchin Sequencing Consortium. 2006. The genome of the sea urchin Strongylocentrotus purpuratus. Science 314:941-952. Seidah, N. G., R. Day & M. Chretien. 1993. The family of pro-hormone and pro protein convertases. Biochem. Soc. Trans. 21:685-691. Shimada, J. C., L. R. Porto-Neto, M. B. B. C. Dauriz, B. E. Jensch-Junior & J. R. M. C. Silva. 2002. Phagocytosis in vitro and in vivo in the Antarctic sea urchin Sterechinus neumayeri at 0 [degrees]C. Polar Biol. 25:891-897. Silva, J. R. M. C., F. J. Hernandez-Blazquez & R. L. Barbieri. 1998. Induced inflammatory response in the Antarctic fish Nothothenia neglecta. Polar Biol. 20:206-212. Silva, J. R. M. C., F. J. Hernandez-Blazquez, L. R. Porto-Neto & J. C. S. Borges. 2001. Comparative study of in vivo and in vitro phagocytosis including germicida capacity in Odontaster validus (Koehler, 1906) at 0[degrees]C. J. Invertebr. Pathol. 77:180-185. Silva, J. R. M. C. & L. Peck. 2000. Induced in vitro phagocytosis of the Antarctic starfish Odontaster validus (Koehler, 1906) at 0[degrees]C. Polar Biol. 23:225-230. Smith, L. C. & E. H. Davidson. 1992. The echinoid immune system and the phylogenetic occurrence of immune mechanisms in deuterostomes. Immunol. Today. 13:356-362. Smith, L. C., L. Chang, R. J. Britten & E. H. Davidson. 1996. Sea urchin genes expressed in activated coelomocytes are identified by expressed sequence tags: complement homologues and other putative immune response genes suggest immune system homology within the deuterostomes. J. Immunol. 156:593-602. Smith, L. C., J. P. Rast, V. Brockton, D. P. Terwilliger, S. V. Nair, K. M. Buckley & A. J. Majeske. 2006. The sea urchin immune system. Inv. Surv. J. 3:25-39. Steiner, D. F., S. P. Smeekens, S. Ohagi & S. J. Chan. 1992. The new enzymology of precursor processing endoproteases. J. Biol. Chem. 267:23435-23438. Tajima, K., J. R. M. C. Silva & J. M. Laurence. 2007. Disease in sea urchins. In: J. M. Lawrence, editor. Developments in aquaculture and fisheries science, vol. 37. Edible sea urchins: biology and ecology. Amsterdam: Elsevier. pp. 167-182. Tamura, K., J. Dudley, M. Nei & S. Kumar. 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24:1596-1599. Terwilliger, D. P., K. M. Buckley, V. Brockton, N. J. Ritter & L. C. Smith. 2007. Distinctive expression patterns of 185/333 genes in the purple sea urchin, Strongylocentrotus purpuratus: an unexpectedly diverse family of transcripts in response to LPS, [beta]-1, 3-glucan, and dsRNA. BMC Mol. Biol. 8:1-16. Tian, Y., S. Jain, S. E. Kelemen & M. V. Autieri. 2009. AIF-I expression regulates endothelial cell activation, signal transduction, and vasculogenesis. Am. J. Physiol. Cell Physiol. 296:256-266. Utans, U., R. J. Arceci, Y. Yamashita & M. E. Russell. 1995. Cloning and characterization of allograft inflammatory factor-l: a novel macrophage factor identified in rat cardiac allografts with chronic rejection. J. Clin. Invest. 95:2954-2962. Utans, U., W. C. Quist, B. M. McManus, J. E. Wilson, R. J. Arceci, A. F. Wallace & M. E. Russell. 1996. Allograft inflammatory factor-1: a cytokine-responsive macrophage molecule expressed in transplanted human hearts. Transplantation 61 : 1387-1392. Venier, P., L. Varotto, U. Rosani & C. Millino, B. Celegato, F. Bernante, G. Lanfranchi, B. Novoa, P. Roch, A. Figueras & A. Pallavicini 2011. Insights into the innate immunity of the Mediterranean mussel Mytilus galloprovincialis. BMC Genomics 12:69. Waterhouse, A. M., J. B. Procter, D. M. Martin, M. Clamp & G. J. Barton. 2009. Jalview version 2: a multiple sequence alignment editor and analysis workbench. Bioinformatics 25:1189-1191. Yang, Z. F., D. W. Ho, C. K. Lau, C. T. Lam, C. T. Lum, R. T. Poon & S. T. Fan. 2005. Allograft inflammatory factor-1 (AIF-1) is crucial for the survival and pro-inflammatory activity of macrophages. Int. Immunol. 17:1391-1397. FERNANDA OVANDO, (1) CARLA GIMPEL, (1) CONSTANZA CARDENAS, (2) JOSE ROBERTO MACHADO CUNHA DA SILVA, (3) JULIEN DE LORGERIL (4) AND MARCELO GONZALEZ (1) * (1) Laboratorio de Biorrecursos Antarticos, Departamento Cientifico, Instituto Antartico Chileno, Plaza Munoz Gamero 1055, Punta Arenas, Chile; (2) Nucleo de Biotecnologia Curauma, Pontificia Universidad Catolica de Valparaiso, A venida Universidad 330, Curauma, Valparaiso, Chile; (3) Instituto de Ciencias Biomedicas I, Departamento de Histologia e Embriologia, Av. Prof. Lineu Prestes, 1524, CEBIMar-Universidad de Sao Paulo, Brazil; (4) Ifremer, CNRS, Universitd de Montpellier II, IRD, UMR 5119 < * Corresponding author. E-mail: mgonzalez@inach.cl DOI: 10.2983/035.031.0336 TABLE 1.
Summary of the main features of AIF-1 proteins.
Length
Organism #aas (a) MW (b) %Id (c) Charge
Sterechinus neumayeri 151 17.4 -- -6
Strongylocentrotus parpuratus 123 14.1 79.7 -2
Suberites domuncula 144 16.6 52.1 -5
Haliotis discus 151 17.1 49.7 -6
Bos taurus 147 16.9 38.1 -1
Mus musculus 147 16.9 38.8 -2
Homo sapiens 147 16.7 39.7 -1
G/A I/L L/M
Organism pI (d) Ratio Ratio Ratio
Sterechinus neumayeri 4.9 5.5 1.2 6.0
Strongylocentrotus parpuratus 5.7 2.7 0.7 1.2
Suberites domuncula 6.1 1.4 0.3 6.3
Haliotis discus 5.2 1.3 0.4 6.6
Bos taurus 5.6 1.4 0.5 6.8
Mus musculus 6.0 1.7 0.4 5.4
Homo sapiens 6.0 2.0 0.4 5.4
K/R % Charged GRAVY
Organism Ratio aas RKDE Index (e)
Sterechinus neumayeri 2.1 33.1 -0.887
Strongylocentrotus parpuratus 3.7 32.6 -0.543
Suberites domuncula 3.8 36.8 -0.836
Haliotis discus 5.0 35.8 -0.514
Bos taurus 3.2 34.7 -0.690
Mus musculus 1.9 34.1 -0.716
Homo sapiens 3.2 34.7 -0.699
Aliphatic % Polar
Organism Index aas STNQ
Sterechinus neumayeri 68.34 21.2
Strongylocentrotus parpuratus 78.46 16.3
Suberites domuncula 75.90 15.3
Haliotis discus 78.74 12.6
Bos taurus 75.03 16.3
Mus musculus 78.98 17.0
Homo sapiens 77.01 15.6
(a), Number of amino acid; (b), molecular weight; (c), percentage
of amino acid identity; (d), isoelectric point; (e), grand
average of hydropathicity. |
| Gale Copyright: | Copyright 2012 Gale, Cengage Learning. All rights reserved. |