|
Borrelia, Ehrlichia, and Rickettsia spp. in ticks
removed from persons, Texas, USA.
|
|
|
|
|
| Article Type: | Report |
| Subject: |
Tick-borne diseases
(Demographic aspects) Tick-borne diseases (Care and treatment) Tick-borne diseases (Diagnosis) Disease transmission (Demographic aspects) Disease transmission (Reports) Medical screening (Usage) Borrelia (Risk factors) Ehrlichia (Risk factors) Rickettsia (Risk factors) |
| Authors: |
Williamson, Phillip C. Billingsley, Peggy M. Teltow, Glenna J. Seals, Janel P. Turnbough, Meredith A. Atkinson, Samuel F. |
| Pub Date: | 03/01/2010 |
| Publication: | Name: Emerging Infectious Diseases Publisher: U.S. National Center for Infectious Diseases Audience: Academic; Professional Format: Magazine/Journal Subject: Health Copyright: COPYRIGHT 2010 U.S. National Center for Infectious Diseases ISSN: 1080-6040 |
| Issue: | Date: March, 2010 Source Volume: 16 Source Issue: 3 |
| Geographic: | Geographic Scope: United States Geographic Code: 1USA United States |
|
|
|
| Accession Number: | 224101376 |
| Full Text: |
Data concerning the full distribution of tick-borne agents and
their potential relationship to both emerging and characterized
illnesses in the southern United States are not widely available.
Persons who become ill after a tick bite may be at increased risk
because a tick bite may not be considered as the source of the pathogen
and because of the length of time that febrile illness may elude
effective treatment. Detailed knowledge of the causative agents, their
distribution, and their relationship to potential vectors is also
lacking. Most tick survey data for microorganisms in the genera
Borrelia, Rickettsia, and Ehrlichia have been collected in areas where
the associated diseases are considered endemic. Lyme disease, Rocky
Mountain spotted fever, or human monocytotrophic ehrlichiosis are not
considered to be endemic to Texas. Studies of microorganisms carried in
ticks in non-disease-endemic areas might provide information about
potentially pathogenic organisms, their vectors, and reservoirs. These
data might also provide an opportunity to examine the ecology of
emerging zoonoses for which different ecologic determinants for disease
transmission may be present. In 2000, the 77th Texas Legislature Subcommittee on Administration prepared a report addressing the potentially severe nature of tick-borne disease in Texas. As of October 1, 2004, the Tick-Borne Disease Research Laboratory at the University of North Texas Health Science Center (UNTHSC) became the primary facility for testing ticks submitted to the Texas Department of State Health Services (TX DSHS). Methods From October 1, 2004, through September 30, 2008, tick specimens were submitted to UNTHSC through the Zoonosis Control Program of the TX DSHS. Only ticks that had been attached to a person were submitted to UNTHSC, where they were screened for the genera Borrelia, Rickettsia, and Ehrlichia with genus-specific PCRs. Ticks were identified to the species level by TX DSHS entomologists before being transferred to UNTHSC (1-3). Poor condition of some specimens made identification by morphologic examination difficult. Unidentified ticks were conclusively identified by molecular methods developed at UNTHSC, which used amplification of 12S rDNA (Table 1) and sequence determination (data not shown). Additionally, the identity of any tick containing an organism not previously reported in that species was also confirmed by the same molecular methods. Of all tick specimens, 10% were screened by the same molecular identification technique to verify the accuracy of morphologic identification. Ticks were bisected laterally by using aseptic technique and a sterile scalpel blade. For independent verification of results, half of each tick was stored in 100% ethanol at -80[degrees]C. For larvae and nymphs, the entire tick was used for DNA extraction. Total DNA was isolated from the second half by using an E.N.Z.A. Mollusc DNA Isolation Kit (Omega Bio-Tek, Inc., Norcross, GA, USA) according to manufacturer's recommended protocol. Extracted DNA was subjected to PCR that used primers for the amplification of the tick's 12S rDNA or Borrelia spp., Ehrlichia spp., and Rickettsia spp. genes (Table 1). The locations of PCR setup and PCR product handling were physically separated. Reaction setup was performed in a class II type B2 biological safety cabinet that had been cleaned with 0.6% sodium hypochlorite daily and UV irradiated for 30 min before and after each use. To minimize risk for contamination, pipettor sets were dedicated to specific functions, i.e., reagent dispensing, template isolation, PCR setup, and template handling. Certified DNA/RNase-free filter barrier tips were used to prevent aerosol contamination. PCR setup was never performed in the presence of isolation materials, and reagent handling was separated both physically and temporally from templates. PCR assays were performed in duplicate with appropriate controls. A typical, initial PCR was performed in a 25-[micro]L reaction volume by using 5 pmol/L of each appropriate primer in conjunction with a final reaction concentration of 1x GeneAmp PCR Buffer II (Applied Biosystems, Foster City, CA, USA), 160 ng/[micro]L bovine serum albumin, 1.0 mmol/L Mg[Cl.sub.2], 200 [micro]mol/L of each dNTP, 1.25 U Amplitaq (Applied Biosystems), and 10 [micro]L of template. To establish the species of the tick specimen, we amplified 12S rDNA with the following cycle parameters: 95[degrees]C for 5 min; then 40 cycles each consisting of 95[degrees]C for 30 s, 45[degrees]C for 30 s, 72[degrees]C for 60 s; and a final 72[degrees]C extension for 5 min. Thermal cycling parameters for the initial PCRs of bacterial genes were 95[degrees]C for 5 min; then 40 cycles each consisting of 95[degrees]C for 60 s, 55[degrees]C for 60 s, 72[degrees]C for 30 s; and a final 72[degrees]C extension for 5 min. Nested PCR was performed by using the same reaction setup and 1.0 [micro]L of amplified PCR mix as template. Nested PCR setup was performed in a dedicated dead air space cabinet that had been decontaminated in the same manner as the class II type B biosafety cabinet. The thermal cycling profile for the nested reactions was 95[degrees]C for 5 min; then 30 cycles each consisting of 95[degrees]C for 60 s, 55[degrees]C for 60 s, 72[degrees]C for 60 s; and a final 72[degrees]C extension for 5 min. Verification of amplification was performed by agarose gel electrophoresis, followed by staining with 1X SYBR Green I (BioWhittaker Molecular Applications ApS, Rockland, ME, USA). Amplicons were examined with a UVP EC3 Imaging System (UVP, LLC, Upland, CA, USA) and subsequently analyzed by VisionworksLS Image Acquisition and Analysis Software (UVP, LLC). Secondary PCR systems (Table 1) were used to confirm positive results and did not contain primers that would amplify control DNA commonly used in the laboratory. Unincorporated primers were removed from samples producing amplicons before sequence determination by using ExoSAP-IT (USB Corporation, Cleveland, OH, USA). DNA sequencing was performed for both strands of the PCR amplicons by using a BigDye Terminator Cycle Sequencing Kit, version 3.1 (Applied Biosystems). Unincorporated dye terminators were removed before electrophoresis by using Performa DTR Gel Filtration Cartridges (Edge BioSystems, Gaithersburg, MD, USA). Capillary electrophoresis was performed by using an ABI PRISM 310 Genetic Analyzer (Applied Biosystems). Final sequence analysis and editing was performed by using Sequencer 4.7 (Gene Codes Corporation, Ann Arbor, MI, USA). Using BLASTN, version 2.2.10 (www.ncbi.nlm.nih.gov/blast/ Blast.cgi), we then compared edited sequence data with genetic sequences from characterized examples of Borrelia spp., Rickettsia spp., and Ehrlichia spp. published in Gen Bank. Results DNA sequences consistent with those of Borrelia spp. were derived from A. americanum, A. cajennense, D. variabilis, and I. scapularis ticks. The most commonly encountered Borrelia genetic material demonstrated at least 99% sequence identity or was identical to that of previously sequenced Candidatus Borrelia lonestari isolates (AY850063, AF538852) (19). Additionally, a borreliae flaB sequence was generated from 1 D. variabilis tick, which had 94% sequence similarity with that of Candidatus Borrelia texasensis (AF264901) (20) and sequences amplified from an uncultured Borrelia sp. from the bat tick Carios kelleyi (EF688577, EF688579) (21) and (EU492387). The flaB sequence contained 11 single-nucleotide polymorphisms relative to the corresponding section of AF264901. The Borrelia sp. 16S rDNA sequence generated from the same D. variabilis tick was also identical to that published for Candidatus B. texasensis (AF467976) (20,22). This tick was submitted from Webb County, the same Texas county from which the borreliae that produced GenBank sequence AF264901 were isolated. A single I. scapularis specimen produced the flaB sequence, which had 99% identity with B. burgdorferi (AE000783) (23). Genetic data consistent with those from Ehrlichia spp. were observed for A. americanum, A. cajennense, and A. maculatum ticks. Amplicons produced from A. americanum and A. maculatum ticks were 99% similar to the homologous region of the E. chaffeensis disulfide oxidoreductase gene (dsb) sequences in GenBank (CP000236) (24). A single sample from A. cajennense ticks produced a DNA sequence that was 97% similar to that of the CP000236 se quence and contained 8 single-nucleotide polymorphisms relative to the similar sequence. Several single-nucleotide polymorphisms locations are at the same position as nucleotide differences identified between the dsb gene of E. ewingii (AY428950) (25) and E. canis (AF403710) (26). The nucleotide polymorphisms found within the dsb gene did not change the predicted amino acid sequence in relation to E. chaffeensis (data not shown). Discussion By screening a diverse group of Texas tick species for a range of microorganisms and potential pathogens, we identified several novel associations: Candidatus B. lonestari in A. cajennense ticks, E. chaffeensis in A. cajennense ticks, and A. maculatum, and R. parkeri in D. variabilis ticks (Table 3). Because the geographic distribution of diseases caused by the agents is generally characterized by the distribution of the tick vectors, these findings provide insights regarding the distributions and endemicity of several potential emerging tick-borne agents. SFGR were the most commonly observed agents in this survey. Both Candidatus R. amblyommii and Candidatus R. cooleyi are not well studied and are of undetermined pathogenicity. Current average SFGR seropositivity in Texas residents is also unknown, yet prior estimates indicate that it is higher than would be assumed from cases of Rocky Mountain spotted fever reported to the TX DSHS (27). Transmission through blood products has been noted previously (28,29). Unreported subclinical infections might cause concern about local blood products and could potentially compromise immunodeficient transfusion recipients. Additionally, detection of R. amblyommii in questing A. americanum larvae suggests transovarial transmission of the microbe, and the likelihood of pathogen transmission by larvae could be magnified by their habit of mass attack (huge numbers on a single host). An overall Borrelia spp. MIR of 1.1% was observed for the entire 4-year collection. Prevalence of Candidatus B. lonestari in ticks from Texas was low. However, Candidatus B. lonestari sequences were detected in A. americanum ticks regardless of geographic origin. The MIR was slightly higher for A. americanum (2.53%) ticks during periods when that tick was the most abundant species parasitizing humans (October 1, 2007 through October 1, 2008). These rates are within ranges previously established in the literature (30-32). A single isolate of Candidatus B. lonestari was observed in A. cajennense ticks. This represents the potential for Candidatus B. lonestari to use hard ticks of species other than A. americanum in its maintenance cycle and suggests that Candidatus B. lonestari may occur in areas outside the natural distribution of A. americanum ticks. An MIR of 1.3% for Borrelia spp. was found for in D. variabilis and may indicate the presence of uncharacterized borreliae strains in Texas tick populations. A. cajennense ticks have been associated with E. ruminantium (33) and spotted fever group Rickettsia spp. (34). According to seropositivity in a human population in Argentina, these ticks have also been suspected of transmitting ehrlichiosis (35). The presence of E. chaffeensis in an A. cajennense tick seems novel. Long et al. (13) suggest an E. ewingii MIR of 7.6% in southcentral Texas A. americanum ticks. Similar results for Ehrlichia spp. in A. cajennense tick populations may be plausible. Screening ticks for a range of bacterial agents has provided several additional associations. These findings provide insights regarding the distributions and endemicity of potentially pathogenic and emerging tick-borne agents. Some of these tick-borne agents may pose an unknown health risk. Because of the wide distribution of these ticks, accurate assessments of the frequency of bacterial agents in these tick populations, their potential for causing human disease, and the ability for these tick species to act as competent vectors are warranted. Continued study and monitoring will play a vital role in public health assessment for related disease risks. DOI: 10.3201/eid1603.091333 Acknowledgments We thank Chris Paddock and Bruce Budowle for their review of the manuscript. This project was supported by the State of Texas. References (1.) United States Department of Agriculture. Ticks of veterinary importance. Agriculture Handbook no. 485. Rockville (MD): The Department; 1976. p. 21-35. (2.) Cooley RA, Kohls GM. The genus Ixodes in North America. Washington: US Government Printing Office; 1945. p. 7-11. (3.) Keirans JE, Litwak TR. Pictorial key to the adults of hard ticks, family Ixodidae (Ixodida: Ixodoidea), east of the Mississippi River. J Med Entomol. 1989;26:435-48. (4.) Barbour AG, Maupin GO, Teltow GJ, Carter CJ, Piesman J. Identification of an uncultivable Borrelia species in the hard tick Amblyomma americanum: possible agent of a Lyme disease-like illness. J Infect Dis. 1996;173:403-9. (5.) Regnery RL, Spruill CL, Plikaytis BD. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions oftwo rickettsial genes. J Bacteriol. 1991;173:1576-89. (6.) Eremeeva M, Yu X, Raoult D. Differentiation among spotted fever group rickettsiae species by analysis of restriction fragment length polymorphism of PCR-amplified DNA. J Clin Microbiol. 1994;32:803-10. (7.) Kollars TM Jr, Kengluecha A. Spotted fever group Rickettsia in Dermacentor variabilis (Acari: Ixodidae) infesting raccoons (Carnivora: Procyonidae) and opossums (Marsupialia: Didelphimorphidae) in Tennessee. J Med Entomol. 2001;38:601-2. DOI: 10.1603/00222585-38.4.601 (8.) Webb L, Carl M, Malloy DC, Dasch GA, Azad AF. Detection of murine typhus infection in fleas by using the polymerase chain reaction. J Clin Microbiol. 1990;28:530-4. (9.) Doyle CK, Labruna MB, Breitschwerdt EB, Tang YW, Corstvet RE, Hegarty BC, et al. Detection of medically important Ehrlichia by quantitative multicolor TaqMan real-time polymerase chain reaction of the dsb gene. J Mol Diagn. 2005;7:504-10. (10.) Dawson JE, Stallknecht DE, Howerth EW, Warner C, Biggie K, Davidson WR, et al. Susceptibility of white-tailed deer (Odocoileus virginianus) to infection with Ehrlichia chaffeensis, the etiologic agent of human ehrlichiosis. J Clin Microbiol. 1994;32:2725-8. (11.) Dawson JE, Biggie KL, Warner CK, Cookson K, Jenkins S, Levine JF, et al. Polymerase chain reaction evidence of Ehrlichia chaffeensis, an etiologic agent of human ehrlichiosis, in dogs from southeast Virginia. Am J Vet Res. 1996;57:1175-9. (12.) Anderson BE, Sumner JW, Dawson JE, Tzianabos T, Greene CR, Olson JG, et al. Detection of the etiologic agent of human ehrlichiosis by polymerase chain reaction. J Clin Microbiol. 1992;30:775-80. (13.) Long SW, Pound JM, Yu XJ. Ehrlichia prevalence in Amblyomma americanum, central Texas. Emerg Infect Dis. 2004;10:1342-3. (14.) Billings AN, Teltow GJ, Weaver SC, Walker DH. Molecular characterization of a novel Rickettsia species from Ixodes scapularis in Texas. Emerg Infect Dis. 1998;4:305-9. DOI: 10.3201/eid0402.980221 (15.) Weller SJ, Baldridge GD, Munderloh UG, Noda H, Simser J, Kurtti TJ. Phylogenetic placement of rickettsiae from the ticks Amblyomma americanum and Ixodes scapularis. J Clin Microbiol. 1998;36:1305 17. (16.) Roux V, Fournier PE, Raoult D. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J Clin Microbiol. 1996;34:2058-65. (17.) Silveira I, Pacheco RC, Szabo MP, Ramos HG, Labruna MB. Rick ettsia parkeri in Brazil. Emerg Infect Dis. 2007;13:1111-3. (18.) Wikswo ME, Hu R, Dasch GA, Krueger L, Arugay A, Jones K, et al. Detection and identification of spotted fever group rickettsiae in Dermacentor species from southern California. J Med Entomol. 2008;45:509-16. DOI: 10.1603/0022-2585(2008)45[509:DAIOSF]2.0.CO;2 (19.) Moore VA IV, Varela AS, Yabsley MJ, Davidson WR, Little SE. Detection of Borrelia lonestari, putative agent of southern tick-associated rash illness, in white-tailed deer (Odocoileus virginianus) from the southeastern United States. J Clin Microbiol. 2003;41:424-7. DOI: 10.1128/JCM.41.1.424-427.2003 (20.) Lin T, Gao L, Seyfang A, Oliver JH Jr. 'Candidatus Borrelia texasensis' from the American dog tick Dermacentor variabilis. Int J Syst Evol Microbiol. 2005;55:685-93. DOI: 10.1099/ijs.0.02864-0 (21.) Gill JS, Ullmann AJ, Loftis AD, Schwan TG, Raffel SJ, Schrumpf ME, et al. Novel relapsing fever spirochete in bat tick. Emerg Infect Dis. 2008;14:522-3. DOI: 10.3201/eid1403.070766 (22.) Lin T, Oliver JH Jr, Gao L. Comparative analysis of Borrelia isolates from southeastern USA based on randomly amplified polymorphic DNA fingerprint and 16S ribosomal gene sequence analyses. FEMS Microbiol Lett. 2003;228:249-57.: 10.1016/S0378-1097 (03)00763-8 (23.) Fraser CM, Casjens S, Huang WM, Sutton GG, Clayton R, Lathigra R, et al. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature. 1997;390:580-6. DOI: 10.1038/37551 (24.) Hotopp JC, Lin M, Madupu R, Crabtree J, Angiuoli SV, Eisen JA, et al. Comparative genomics of emerging human ehrlichiosis agents. PLoS Genet. 2006;2:e21. DOI: 10.1371/journal.pgen.0020021 (25.) Labruna MB, McBride JW, Camargo LM, Aguiar DM, Yabsley MJ, Davidson WR, et al. A preliminary investigation of Ehrlichia species in ticks, humans, dogs, and capybaras from Brazil. Vet Parasitol. 2007;143:189-95. DOI: 10.1016/j.vetpar.2006.08.005 (26.) McBride JW, Ndip LM, Popov VL, Walker DH. Identification and functional analysis of an immunoreactive DsbA-like thio-disulfide oxidoreductase of Ehrlichia spp. Infect Immun. 2002;70:2700-3. DOI: 10.1128/IAI.70.5.2700-2703.2002 (27.) Taylor JP, Tanner WB, Rawlings JA, Buck J, Elliott LB, Dewlett HJ, et al. Serological evidence of subclinical Rocky Mountain spotted fever infections in Texas. J Infect Dis. 1985;151:367-9. (28.) Arguin PM, Singleton J, Rotz LD, Marston E, Treadwell TA, Slater K, et al. An investigation into the possibility of transmission of tick-borne pathogens via blood transfusion. Transfusion-associated Tick-borne Illness Task Force. Transfusion. 1999;39:828-33. DOI: 10.1046/j.1537-2995.1999.39080828.x (29.) McQuiston JH, Childs JE, Chamberland ME, Tabor E. Transmission of tick-borne agents of disease by blood transfusion: a review of known and potential risks in the United States. Transfusion. 2000;40:274-84. DOI: 10.1046/j.1537-2995.2000.40030274.x (30.) Stromdahl EY, Williamson PC, Kollars TM Jr, Evans SR, Barry RK, Vince MA, et al. Evidence ofBorrelia lonestari DNA in Amblyomma americanum (Acari: Ixodidae) removed from humans. J Clin Microbiol. 2003;41:5557-62. DOI: 10.1128/JCM.41.12.5557-5562.2003 (31.) Taft SC, Miller MK, Wright SM. Distribution of borreliae among ticks collected from eastern states. Vector Borne Zoonotic Dis. 2005;5:383-9. DOI: 10.1089/vbz.2005.5.383 (32.) Mixson TR, Campbell SR, Gill JS, Ginsberg HS, Reichard MV, Schulze TL, et al. Prevalence of Ehrlichia, Borrelia, and rickettsial agents in Amblyomma americanum (Acari: Ixodidae) collected from nine states. J Med Entomol. 2006;43:1261-8. DOI: 10.1603/00222585(2006)43[1261:POEBAR]2.0.CO;2 (33.) Mahan SM, Peter TF, Simbi BH, Kocan K, Camus E, Barbet AF, et al. Comparison of efficacy of American and African Amblyomma ticks as vectors of heartwater (Cowdria ruminantium) infection by molecular analyses and transmission trials. J Parasitol. 2000;86:44-9. (34.) de Lemos ER, Machado RD, Coura JR, Guimaraes MA, Freire NM, Amorim M, et al. Epidemiological aspects of the Brazilian spotted fever: seasonal activity of ticks collected in an endemic area in Sao Paulo, Brazil. Rev Soc Bras Med Trop. 1997;30:181-5. (35.) Ripoll CM, Remondegui CE, Ordonez G, Arazamendi R, Fusaro H, Hyman MJ, et al. Evidence of rickettsial spotted fever and ehrlichial infections in a subtropical territory of Jujuy, Argentina. Am J Trop Med Hyg. 1999;61:350-4. Author affiliations: University of North Texas Health Science Center, Fort Worth, Texas, USA (P.C. Williamson, P.M. Billingsley, J.P. Seals); Texas Department of State Health Services, Temple, Texas, USA (G.J. Teltow); and University of North Texas, Denton, Texas, USA (M.A. Turnbough, S.F. Atkinson) Dr Williamson is an assistant professor in the Institute of Investigative Genetics at the University of North Texas Health Science Center and director for the Tick-borne Disease Research Laboratory in the Center for Biosafety and Biosecurity. His primary research focus is the development of methods and tools for rapid assessment of disease outbreak and the study of efficient mechanisms for researching the epidemiology, genetics, and associated clinical manifestations of emerging pathogens. Address for correspondence: Phillip C. Williamson, University of North Texas Health Science Center, Institute of Investigative Genetics, 3500 Camp Bowie Blvd, Fort Worth, TX 76107-2699, USA; email: phwilliam@ hsc.unt.edu Table 1. Nucleotide sequence of primers used for PCR screening of tick
specimens removed from humans, Texas, October 1, 2004, to September
30, 2008 *
Primer name Gene Primer sequence
(5' [right arrow] 3')
Tick DNA
85F 12S TTAAGCTTTTCAGAGGAATTTGCTC
225R 12S TTTWWGCTGCACCTTGACTTAA
Borrelia spp.
FlaLL flaB ACATATTCAGATGCAGACAGAGGT
FlaRL flaB GCAATCATAGCCATTGCAGATTGT
FlaLS flaB AACAGCTGAAGAGCTTGGAATG
FlaRS flaB CTTTGATCACTTATCATTCTAATAGC
BL-Fla 522F flaB GGTACATATTCAGATGCAGACAGAGGG
BL-Fla 1182R flaB GCACTTGATTTGCTTGTGCAATCATAGCC
BL-Fla 662F flaB CTGAAGAGCTTGGAATGCAACCTGC
BL-Fla 860R flaB GAGCTAATCCCACCTTGAGCTGG
BL-Fla 341F flaB AGCTGATGATGCTGCTGGTATGGG
BL-Fla 730R flaB GCTTGTGCTCCAGTTAGTGATGCTGG
BL-16S 227F 16S TCACACTGGAACTGAGATACGGTCC
BL-16S 920R 16S GAATTAAACCACATGCTCCACCGC
BL-HSP 71F groEL CTTATGTTGAAGGAATGCAATTTGA
BL-HSP 271R groEL CAATATCTTCAGCAATAATTAGCAAAGGT
Rickettsia spp.
Rr.190 70P rompA ATGGCGAATATTTCTCCAAAA
Rr.190 602N rompA AGTGCAGCATTCGCTCCCCCT
BG1-21 rompB GGCAATTAATATCGCTGACGG
BG2-20 rompB GCATCTGCACTAGCACTTTC
RrCS 372 gltA TTTGTAGCTCTTCTCATCCTATGGC
RrCS 989 gltA CCCAAGTTCCTTTAATACTTCTTTGC
Primer 1 17kDa GCTCTTGCAACTTCTATGTT
Primer 2 17kDa CATTGTTCGTCAGGTTGGCG
Ehrlichia spp.
Ehr DSB 330F dsb GATGATGTCTGAAGATATGAAACAAAT
Ehr DSB 728R dsb CTGCTCGTCTATTTTACTTCTTAAAGT
ECC-F 16S AGAACGAACGCTGGCGGCAAGCC
ECB-R 16S CGTATTACCGCGGCTGCTGGCA
ECAN-F 16S ATTTATAGCCTCTGGCTATAGGA
HE1-F 16S CAATTGCTTATAACCTTTTGGTTATAAAT
EE72-F 16S AATTCCTAAATAGTCTCTGACTATT
HE3-R 16S TATAGGTACCGTCATTATCTTCCCTAT
Primer name Specificity Screen [T.sub.M] Reference
Tick DNA
85F Unknown Primary 54.0 This study
225R Unknown Primary 52.7 This study
Borrelia spp.
FlaLL Genus Primary 58.3 (4)
FlaRL Genus Primary 58.9 (4)
FlaLS Genus Primary 57.5 (4)
FlaRS Genus Primary 53.3 (4)
BL-Fla 522F B. lonestari Primary 61.3 This study
BL-Fla 1182R B. lonestari Primary 64.0 This study
BL-Fla 662F B. lonestari Primary 62.8 This study
BL-Fla 860R B. lonestari Primary 61.2 This study
BL-Fla 341F Genus Alternate 63.2 This study
BL-Fla 730R Genus Alternate 64.1 This study
BL-16S 227F Genus Alternate 62.1 This study
BL-16S 920R Genus Alternate 61.0 This study
BL-HSP 71F B. lonestari Alternate 55.6 This study
BL-HSP 271R B. lonestari Alternate 58.2 This study
Rickettsia spp.
Rr.190 70P Genus Primary 52.5 (5)
Rr.190 602N Genus Primary 64.9 (5)
BG1-21 Genus Alternate 55.6 (6)
BG2-20 Genus Alternate 55.2 (6)
RrCS 372 Genus Alternate 59.0 (7)
RrCS 989 Genus Alternate 57.5 (7)
Primer 1 Genus Alternate 52.3 (8)
Primer 2 Genus Alternate 57.9 (8)
Ehrlichia spp.
Ehr DSB 330F Genus Primary 55.5 (9)
Ehr DSB 728R Genus Primary 56.6 (9)
ECC-F Genus Alternate 68.1 (10)
ECB-R Genus Alternate 65.6 (10)
ECAN-F E. canis Alternate 54.9 (11)
HE1-F E. chaffeensis Alternate 55.6 (12)
EE72-F E. ewingii Alternate 52.6 (11)
HE3-R Genus Alternate 57.6 (13)
* [T.sub.M], melting temperature, [degrees]C.
Table 2. Number and identity of ticks submitted to University of North
Texas Health Science Center by the Texas Department of State Health
Services Zoonosis Control Program, October 1, 2004, to September 30,
2008 *
No. positive/no. tested
Borrelia spp. Ehrlichia spp.
Tick UNE PE E UNE PE E
Amblyomma americanum
Adult male 0/0 1/116 0/1 0/0 0/116 0/1
Adult female 0/0 1/109 0/11 0/0 2/109 0/11
Nymph 0/0 1/92 1/27 0/0 0/92 0/27
Larva 0/0 0/11 0/0 0/0 0/11 0/0
A. cajennense
Adult male 0/0 0/44 0/2 0/0 1/44 0/2
Adult female 0/0 1/56 0/3 0/0 0/56 0/3
Nymph 0/0 0/52 0/3 0/0 0/52 0/3
Larva 0/0 0/12 0/0 0/0 0/12 0/0
A. maculatum
Adult male 0/0 0/7 0/0 0/0 1/7 0/0
Adult female 0/0 0/1 0/1 0/0 0/1 0/1
Nymph 0/0 0/1 0/0 0/0 0/1 0/0
Larva 0/0 0/1 0/0 0/0 0/1 0/0
Dermacentor variabilis
Adult male 0/1 0/71 0/1 0/1 0/71 0/1
Adult female 0/3 1/84 0/16 0/3 0/84 0/16
Nymph 0/0 0/0 0/2 0/0 0/1 0/2
Larva 0/0 0/0 0/0 0/0 0/1 0/0
Ixodes scapularis
Adult male 0/0 0/4 0/0 0/0 0/4 0/0
Adult female 0/0 0/41 0/22 0/0 0/41 0/22
Nymph 0/0 1/8 0/1 0/0 0/8 0/1
Larva 0/0 0/0 0/0 0/0 0/0 0/0
Rhipicephalus sanguineus
Adult male 0/0 0/23 0/0 0/0 0/23 0/0
Adult female 0/2 0/35 0/6 0/2 0/35 0/6
Nymph 0/0 0/5 0/15 0/0 0/5 0/15
Larva 0/0 0/0 0/1 0/0 0/0 0/1
Total 0/6 6/772 1/112 0/6 4/772 0/112
No. positive/no. tested
Rickettsia spp.
Tick UNE PE E Total
Amblyomma americanum
Adult male 0/0 25/116 0/1 26/117
Adult female 0/0 23/109 4/11 30/120
Nymph 0/0 18/92 9/27 29/119
Larva 0/0 0/11 0/0 0/11
A. cajennense
Adult male 0/0 0/44 0/2 1/46
Adult female 0/0 0/56 0/3 1/59
Nymph 0/0 3/52 1/3 4/55
Larva 0/0 1/12 0/0 1/12
A. maculatum
Adult male 0/0 0/7 0/0 1/7
Adult female 0/0 0/1 0/1 0/2
Nymph 0/0 0/1 0/1 0/1
Larva 0/0 0/0 0/0 0/0
Dermacentor variabilis
Adult male 0/1 4/71 0/0 4/73
Adult female 0/3 6/84 1/16 8/103
Nymph 0/0 0/0 0/2 0/2
Larva 0/0 0/0 0/0 0/0
Ixodes scapularis
Adult male 0/0 0/4 0/0 0/4
Adult female 0/0 26/41 6/22 32/63
Nymph 0/0 4/8 0/1 5/9
Larva 0/0 0/0 0/0 0/0
Rhipicephalus sanguineus
Adult male 0/0 0/23 0/0 0/23
Adult female 0/2 1/35 0/6 1/43
Nymph 0/0 0/5 1/15 1/20
Larva 0/0 0/0 0/1 0/1
Total 0/6 111/772 22/112 144/890
* Testing by PCR. Only tick species that showed evidence of containing
Borrelia, Ehrlichia, or Rickettsia spp. are shown. Seven specimens of
Otobius megnini, 2 of Amblyomma inornatum and Dermacentor albipictus,
and 1 each of Dermacentor andersonii and Dermacentor nigrolineatus
ticks were submitted during the project period. After clarification
with the submitter of the D. andersonii specimen, it was concluded
that the tick attachment may have occurred in Colorado. UNE,
unengorged; PE, partially engorged; E, engorged.
Table 3. No. ticks containing bacterial DNA sequences, Texas, October
1, 2004, to September 30, 2008 *
Bacterial agent
Candidatus
Borrelia B. Borrelia
Tick species spp. burgdorferi lonestari
Amblyomma 4
americanum
A. cajennense 11
A. maculatum
Dermacentor 1
variabilis
Ixodes scapularis 1
Rhipicephalus
sanguineus
Total 1 1 5
Bacterial agent
Candidatus Candidatus
Ehrlichia Rickettsia Rickettsia
Tick species chaffeensis amblyommii cooleyi
Amblyomma 2 77
americanum
A. cajennense 5
A. maculatum 1
Dermacentor 4
variabilis
Ixodes scapularis 35
Rhipicephalus 11
sanguineus
Total 4 87 35
Bacterial agent
Rickettsia R. R.
Tick species parkeri peacockii rhipicephali
Amblyomma 2
americanum
A. cajennense
A. maculatum
Dermacentor 4 2 1
variabilis
Ixodes scapularis 1
Rhipicephalus
sanguineus
Total 5 5 1
* Ticks submitted to the Texas Department of State Health Services and
identified by the University of North Texas Health Science Center,
Tick-Borne Disease Research Laboratory. Only those tick species that
showed evidence of containing Borrelia, Ehrlichia, or Rickettsia spp.
are shown. |
| Gale Copyright: | Copyright 2010 Gale, Cengage Learning. All rights reserved. |