|
Blood meal analysis to identify reservoir hosts for
Amblyomma americanum ticks.
|
|
|
|
|
| Subject: |
White-tailed deer
(Health aspects) RNA (Health aspects) Infection (Health aspects) |
| Authors: |
Allan, Brian F. Goessling, Lisa S. Storch, Gregory A. Thach, Robert E. |
| Pub Date: | 03/01/2010 |
| Publication: | Name: Emerging Infectious Diseases Publisher: U.S. National Center for Infectious Diseases Audience: Academic; Professional Format: Magazine/Journal Subject: Health Copyright: COPYRIGHT 2010 U.S. National Center for Infectious Diseases ISSN: 1080-6040 |
| Issue: | Date: March, 2010 Source Volume: 16 Source Issue: 3 |
|
|
|
| Accession Number: | 224101375 |
| Full Text: |
Zoonotic pathogens, which reside in animal reservoir species and
may at times spill over into human populations, are emerging at an
unprecedented rate (1). Among these pathogens, several vector-borne
pathogens have garnered considerable attention for the toll they exact
on human health, which a growing body of evidence indicates may be
exacerbated by anthropogenic environmental change (2-4). A rigorous
understanding of the transmission dynamics of pathogens from infected
wildlife hosts to vector organisms is critical to explorations of the
ecology of vector-borne diseases. Among the most rapidly emerging vector-borne zoonotic pathogens in the United States are several that are transmitted by the lone star tick (Amblyomma americanum). These pathogens include Ehrlichia chaffeensis and E. ewingii, both agents of human ehrlichiosis, and Borrelia lonestari, a potential agent of southern tick-associated rash illness (5). Ticks generally acquire pathogens by 2 primary modes of transmission: vertical (i.e., transovarial) transmission, whereby the pathogen is acquired maternally during development of the egg, and horizontally, whereby the pathogen is acquired through a blood meal on a reservoir-competent and infectious animal host. Recent research suggests that E. chaffeensis and E. ewingii are acquired horizontally (6,7); B. lonestari is likely transmitted horizontally and vertically (8). Several lines of evidence suggest that white-tailed deer (Odocoileus virginianus) are a major reservoir host for all 3 pathogens (9). Nonetheless, several other species have also been implicated as potential reservoirs, and our understanding of their relative roles in disease transmission remains incomplete. Efforts to identify reservoir hosts for vector-borne zoonotic pathogens have historically been labor-intensive exercises, often requiring the capture of potential wildlife hosts, experimental infection with the pathogen of interest, and a subsequent examination of the efficiency with which these hosts pass the infectious agent to vector organisms under controlled conditions (10). However, such laboratory-based estimates may fail to capture the true distribution of host reservoir competencies because of unknown consequences of host selection behavior by vector organisms or the unmeasured contributions of cryptic reservoir hosts (11). An efficient solution has emerged in the form of host blood meal identification by molecular methods. Because of the challenges posed by the duration of tick life cycles and host-seeking behavior, the feasibility of host blood meal identification in ticks was only recently established (12). Research efforts have converged upon a 2-step process: PCR amplification of and labeling with biotin any remnant vertebrate DNA isolated from a tick, and reverse line blot (RLB) hybridization whereby host-specific oligonucleotide probes are used to detect the biotin-labeled amplified host DNA. Several researchers have successfully used this technology to identify the reservoir hosts for numerous pathogens transmitted by Ixodes ricinus, a preeminent vector of tick-borne diseases in Europe (13-16). We describe the development of host-specific probes and the identification of host blood meals in wild-caught nymphal life stage A. americanum and present direct estimates of the reservoir capacity (an estimate of the absolute contribution of a reservoir host to the prevalence of infection in a tick population) for white-tailed deer and other reservoir hosts for the emerging A. americanum-associated zoonotic pathogens (17). Materials and Methods Field Collections Questing A. americanum ticks were collected from 5 conservation areas and state parks in and surrounding St. Louis, Missouri, USA, during 2005 and 2007-2008. Ticks were collected either by dragging a 1-[m.sup.2] white cloth along the ground and over vegetation or by using C[O.sub.2]-baited traps, whereby sublimating dry ice was used to attract ticks, which then became ensnared on double-sided carpet tape surrounding the trap. Both methods have proven effective for sampling nymphal and adult life stages of A. americanum (18). Captured ticks were removed and preserved in 70% ethanol for future identification and molecular analyses. Sampling efforts were limited to deciduous forested areas, which are the primary habitats in which A. americanum completes its life cycle (5). All subsequent analyses were limited to host-seeking nymphal life stage ticks, which for A. americanum are often presumed to have taken only 1 prior blood meal in the larval life stage. Laboratory Methods DNA Extraction and Amplification Nymphal life stage A. americanum were identified under a dissecting microscope before DNA extraction using the method of Kierans and Durden (19). Ticks were individually processed using 1 of 2 methods. All ticks collected in 2005 and most of those collected in 2007 were processed using the ammonium hydroxide method described previously by Pichon et al. (13). The remainder of the 2007 and all of the 2008 ticks were processed using a modified method described by Hammer et al. (20). The success of each method of DNA extraction was confirmed by PCR amplification and agarose gel electrophoresis of tick mitochondrial 16S rDNA as described (21,22). Vertebrate DNA was amplified by PCR using the biotin labeled primer 0049, described by Pichon et al. 2003 (13), and primer 0035 (5'-TTCTAGAGCTAATACATGCCRA -3'). These primers amplify a portion of the vertebrate (mammal and reptile) 18S rRNA gene. Primers were obtained from IDT. As with the bacterial DNA amplifications, at least 1 positive control (DNA from vertebrate tissue) and 1 negative control (negative DNA extraction control) were included with each set of PCRs. Vertebrate Tissue DNA Extraction, Sequencing, and Probe Design A small piece of vertebrate tissue, generally liver or muscle, was frozen on dry ice and then pulverized. The sample was then prepared using either the ammonium hydroxide or Chelex method. The resulting supernatant was removed to a fresh tube and a dilution of this supernatant was used in the PCRs. Primers 0066 and 0067 (13) were used to amplify a 350-400-bp fragment of the vertebrate 18S rRNA gene. This fragment contains the area amplified by primers 0049 and 0035. Primers were obtained from IDT. PCR products were purified by using the Wizard SV Gel and PCR Clean-Up System (Promega Corporation, Madison, WI, USA). The purified amplicons were double-strand sequenced by using primers 0066 and 0067 by the Protein and Nucleic Acid Chemistry Laboratory at Washington University with ABI Prism Dye Terminator BigDye Premix version 1.1 (Applied Biosystems, Foster City, CA, USA). MegAlign and EditSeq softwares (DNASTAR, Inc., Madison, WI, USA) were used to align and edit sequence data. The obtained sequences were aligned with 18S sequences found in GenBank and areas of variability were used to design probes. Reverse Line Blot Hybridization An RLB assay was used to identify bacterial DNA amplified from the tick lysates. In the assay, biotin-labeled PCR products are hybridized against a set of bacteria-specific probes (Table 1) that have been covalently linked to an activated Biodyne C membrane (Pall, Ann Arbor, MI, USA) by their 5' amino group. Our method is based on RLB techniques previously described (13,23). The probes were applied in lines to an activated membrane using a Miniblotter 45 (Immunetics, Cambridge, MA, USA). The membrane was stored at 4[degrees]C until use. Before starting the hybridization, the membrane was incubated in hybridization buffer (0.3 mol/L sodium chloride, 0.02 mol/L sodium phosphate buffer, 0.002 mol/L EDTA, 0.1% sodium dodecyl sulfate) for 45 min at 42[degrees]C. For the hybridization step, the membrane was placed in the Miniblotter with the orientation shifted 90[degrees] so that the probe lanes were aligned perpendicular to the slots. Each slot was filled with 140 [micro]L of denatured biotinylated PCR products (10 [micro]L PCR products in 140 [micro]L hybridization solution, heated at 99[degrees]C for 10 min, then cooled on ice) and incubated at 42[degrees]C for 90 min. The PCR solutions were aspirated off and the membrane was washed twice with hybridization buffer at room temperature, then twice at 50[degrees]C with preheated buffer. Biotin-labeled PCR products hybridized to probes were detected using the CDP-Star Universal Detection Kit (Sigma, St. Louis, MO, USA) and exposure to Blue Ultra Autorad film (ISC BioExpress, Kaysville, UT, USA). A second RLB assay using host specific probes was used to identify vertebrate DNA amplified from the tick lysates (Table 2). The protocol for the vertebrate RLB was the same as for the bacterial RLB except the prehybridization wash, hybridization and high stringency wash steps were all conducted at 62[degrees]C. Tick Identification To confirm correct identification of A. americanum nymphs used in our study, we selected 4 tick samples for which we amplified and then double-strand sequenced a portion of the tick 16S rRNA gene. The 16S+1 and 16S-2 primers described in Black and Piesman (21) were used for PCR amplification and sequencing. Statistical Analyses All statistics were calculated using Poptools version 3.0 in Microsoft Excel (Microsoft, Redmond, WA, USA) (24). We used [chi square] tests with the Yates continuity correction to analyze patterns of pathogen co-infection and the distributions of blood meals among hosts. We estimated 95% confidence intervals for our estimates of reservoir capacity based upon identifiable blood meals using the Wilson score method without continuity correction. Results Pathogen Detection Three of the most widely reported pathogens associated with A. americanum (E. chaffeensis, E. ewingii, and B. lonestari) were detected among collections from [greater than or equal to] 3 of 5 study sites (i.e., each pathogen was detected from ticks collected at [greater than or equal to] 3 locations). Of the 1,383 nymphal life stage A. americanum ticks tested, 19 (1.4%) contained E. chaffeensis, 31 (2.2%) contained E. ewingii, and 18 (1.3%) contained B. lonestari. No co-infections with >1 pathogen were detected in any tick. However, [chi square] analyses for each pair of pathogens indicated that this outcome did not differ from random chance (E. chaffeensis and E. ewingii: [chi square] = 0.013, df = 1, p = 0.908; E. ewingii and B. lonestari: [chi square] = 0.024, df = 1, p = 0.877; B. lonestari and E. chaffeensis: [chi square] = 0.359, df = 1, p = 0.549). Host Probes DNA from 13 vertebrate species (for which sequences of 18S rDNA were not available in the GenBank database) were purified and subsequently amplified for sequencing. The amplicons were double-strand sequenced and these sequences together with those available in the GenBank database were aligned to generate vertebrate host probes (Table 2). Eventually, 20 host probes were established, and 34 vertebrate species that were identified from the literature as potentially important hosts were correctly identified to the matching host probe, with 1 exception (Tamias striatus reacted with Canidae probe) (Table 3). Detection of Host DNA Purified lysates from all 1,383 nymphal life stage A. americanum screened for pathogenic microbes in the previous analyses were also subjected to host blood meal iden tification. Remnant host DNA from 869 (62.8%) of these ticks hybridized with 10 of the 20 host probes used (Table 4). Of these samples, 389 (44.8%) hybridized to the Ruminantia probe, which for wildlife hosts in the St. Louis, Missouri, region is likely limited to white-tailed deer (Table 3). The remaining blood meals were distributed across a variety of taxa. DNA from more than 1 host was detected in 141 nymphal life-stage ticks (Table 4). Of the 68 A. americanum nymphs containing pathogenic bacteria, 47 (69.1%) contained identifiable vertebrate DNA (i.e., that hybridized with [greater than or equal to] 1 host probe; Table 5). Of the 15 E. chaffeensis-positive samples that contained identifiable vertebrate DNA, 8 hybridized only with the Ruminantia probe, and 4 others hybridized with the Ruminantia probe plus [greater than or equal to] 1 additional probes; thus 12 of 15 identifiable samples hybridized with the Ruminantia probe. The other identifiable E. chaffeensis-positive samples hybridized either with the Sciurus (n = 2) or the Leporidae (n = 1) probes. For the 23 identifiable E. ewingii-positive samples, 12 contained DNA that hybridized only with the Ruminantia probe, 3 that hybridized only with the Sciurus probe, and 1 that hybridized only with the Leporidae probe. All 6 of the identifiable mixed blood meal DNAs hybridized with [greater than or equal to] 2 of these 3 host probes. The remaining identifiable E. ewingii-positive sample hybridized only with the Passeriformes probe. For the 9 identifiable B. lonestari-positive samples, 4 hybridized with the Ruminantia probe, 1 hybridized with the Sciurus probe, 1 hybridized with the Passeriformes probe, and 1 hybridized with the Squamata/Testudines probe (which is expected to detect DNA from lizards, snakes, and turtles). Because there is evidence that B. lonestari can be transovarially transmitted (8), it is crucial to test whether the associations between host blood meals and pathogen infections differ from a distribution expected by random chance alone. The frequency of association between B. lonestari infection and the Ruminantia probe ([chi square] = 0.033, df = 1, p = 0.855), the Sciurus probe ([chi square] = 0.217, df = 1, p = 0.641), the Passeriformes probe ([chi square] = 0.209, df = 1, p = 0.647), and the Squamata/Testudines probe ([chi square] = 0.639, df = 1, p = 0.424) did not differ from a distribution expected by random chance. Owing to the detection of host blood meals in pathogen-positive and pathogen-negative ticks, we were able to generate estimates of reservoir capacity (calculated as the proportion of blood meals from a given host that result in an infection for a given pathogen and includes the end products of tick feeding and molting success) for each taxonomic grouping of reservoir host and pathogen species (Table 6). Tick Identification Two of the tick samples analyzed contained DNA that reacted with the Squamata/Testudines probe, 1 of which was also positive for B. lonestari, and 2 samples contained DNA that reacted with the Passeriformes probe, 1 of which was also positive for E. ewingii. The sequences obtained from the 4 ticks were identical except for an extra basepair in 2 of the sequences. The sequences were compared with 16S sequences of other potential tick species in Genbank and had 98%-100% homology with A. Discussion Three of the zoonotic pathogens primarily associated with A. americanum (E. chaffeensis, E. ewingii, and B. lonestari) were detected at our field sites at infection rates in nymphal life stage ticks comparable to levels reported elsewhere in the region (25,26). Our array of host probes indicates that A. americanum feed from a variety of vertebrate hosts in the larval life stage, consistent with observations from field studies (5). We found that most nymphal A. americanum infected with E. chaffeensis fed upon a white-tailed deer in the larval stage, consistent with the prevailing hypothesis that this is the major wildlife reservoir for this emerging pathogen (9). Analysis of 3 other E. chaffeensis-positive blood meals associated with the Sciurus and Leporidae probes suggests that members of the genus Sciurus (likely fox and gray squirrels, S. niger and S. carolinensis, respectively) and eastern cottontail rabbits (Sylvilagus floridanus) may also function as wildlife reservoirs for E. chaffeensis. Most blood meals detected from E. ewingii-positive ticks were also associated with the Ruminantia, Sciurus, or Leporidae probes. Considering the lack of evidence for transovarial transmission of E. chaffeensis (6) and E. ewingii (7), we consider the wildlife hosts in these taxa to be the major reservoir hosts in this region. No consistent associations between the sources of host blood meals and infection rates with B. lonestari in nymphal life stage ticks were found. In light of evidence that B. lonestari can be transovarially transmitted (27), it may not be possible to determine whether an infected tick acquired this pathogen through a blood meal from an infective host or through vertical transmission from mother to offspring. Therefore, host blood meal identification may not be an adequate means to identify reservoir hosts for this pathogen. Increased samples sizes combined with knowledge of transovarial transmission rates may eventually enable researchers to quantify the contributions of reservoir hosts to infection prevalence of B. lonestari in A. americanum. Our data enable us to further generate estimates of reservoir capacity, defined as the absolute contribution of a reservoir host to the prevalence of pathogen infection in a tick population. This metric includes the influence of host abundance, the probability that a host is infected, infectivity of that host, and tick feeding and molting success rates (17). Although this metric should not be mistaken for an estimate of actual reservoir competence (i.e., the proportion of ticks that become infected from feeding on infective hosts), it may be more informative because it includes the outcome of several ecologic processes that ultimately determine human risk of exposure to tick-borne pathogens. We found that white-tailed deer do not yield the highest absolute estimates of reservoir capacity for any of the 3 pathogens in our study. However, estimated confidence intervals suggest this outcome may be due to small sample sizes for estimates of reservoir capacity for other reservoir hosts. In light of evidence that white-tailed deer are often infected with these pathogens throughout the range of A. americanum ticks (28-30), we hypothesize that white-tailed deer may be weakly competent reservoirs for these pathogens. However, when taking into account the frequency with which A. americanum encounter these abundant hosts, (i.e., reservoir potential) (31), it remains apparent that white-tailed deer are major reservoir hosts for A. americanum-associated zoonoses. From the nymphal life stage A. americanum that yielded detectable host DNA in this study, 16.2% hybridized with >1 taxonomic probe. Mixed blood meals, presumably caused by bouts of interrupted feeding, have been reported from other studies on ixodid ticks using host blood meal identification, at similar rates to those reported here (15,16). For example, Moran Cadenas et al. reported multiple host detections from 19.2% of detectable blood meals in Ixodes ricinus, with no differences between nymphal and adult life stages (15). The absence of a detectable blood meal in 37.2% of the A. americanum nymphs examined in our study is also consistent with results from other studies using host blood meal identification in ixodid ticks (13-16). We speculate that the degradation of remnant host DNA is the primary cause of this phenomenon, because our ability to detect host blood meals declined later in the season (unpub. data). It is crucial to temper our conclusions about the role of various hosts derived from our data with some exploration of other factors that may influence the outcome of host blood meal identification. Various factors may influence the detectability of host blood meals, such as the presence of nucleated erythrocytes, host blood volume, permissiveness of hosts (a measure of the ability of a tick to successfully feed to repletion on a given host), and the region of DNA targeted for analysis (12). Because the first step of the PCR in our study is subject to dominant template bias, remnant DNA from nucleated erythrocytes may mask mammalian DNA present in mixed blood meals. Additionally, we did not directly quantify the sensitivity of our various host probes, although we did attempt to identify host probe concentrations that yielded equivalent reactions. Nonetheless, variation in host probe sensitivity may introduce another source of error in our findings. In light of these potential limitations to host blood meal identification, field-based studies will remain necessary in order to determine if host blood meal distributions are consistent with the availability of hosts and host-vector interactions. Host blood meal identification by molecular methods offers a direct and efficient approach for understanding the contributions of both reservoir competent and incompetent hosts to the transmission dynamics of tick-borne diseases. Through this emerging technology, we show the major role played by white-tailed deer in facilitating the emergence of A. americanum-associated zoonoses. However, the apparent contributions of various other hosts to pathogen transmission highlight the need for a community approach to understanding vector-borne zoonoses. Future applications of these methods will generate information for approaching a variety of topics of pressing concern to public health, including the potential impact of anthropogenic landscape change on human risk of exposure to zoonotic pathogens. DOI: 10.3201/eid1603.090911 Acknowledgments We thank Jonathan Chase, Felicia Keesing, Richard Ostfeld, the Chase Laboratory group, and 2 anonymous reviewers for helpful comments and suggestions. We also thank Monique Gaudreault-Keener for help with laboratory analyses and Russell Blaine, Kelly Oggenfuss, Richard Ostfeld, Maria Thaker, and Walter Wehtje for help with obtaining vertebrate tissue samples. This research was supported by a Doctoral Dissertation Improvement Grant from the National Science Foundation, a Science to Achieve Results Graduate Fellowship from the Environmental Protection Agency, and a Lewis and Clark Fund for Exploration and Field Research Grant from the American Philosophical Society to B.F.A. and Washington University Research Support for Senior Administrators to R.E.T. References (1.) Jones KE, Patel NG, Levy MA. Global trends in emerging infectious diseases. Nature. 2008;451:990-4. DOI: 10.1038/nature06536 (2.) Ostfeld RS, Keesing F, Schauber EM, Schmidt KA. The ecological context of infectious disease: diversity, habitat fragmentation, and Lyme disease risk in North America. In: Aguirre A, Ostfeld RS, Tabor G, House CA, Pearl M, editors. Conservation medicine: ecological health in practice. New York: Oxford University Press; 2002. p. 207-19. (3.) Patz JA, Daszak P, Tabor GM, Aguirre AA, Pearl M, Epstein J, et al. Unhealthy landscape: policy recommendations on land use change and infectious disease emergence. Environ Health Perspect. 2004;112:1092-8. (4.) Dobson A, Cattadori I, Holt RD, Ostfeld RS, Keesing F, Krichbaum K, et al. Sacred cows and sympathetic squirrels: the importance of biological diversity to human health. PLoS Med. 2006;3: e231. DOI: 10.1371/journal.pmed.0030231 (5.) Childs JE, Paddock CD. The ascendancy of Amblyomma americanum as a vector of pathogens affecting humans in the United States. Annu Rev Entomol. 2003;48:307-37. DOI: 10.1146/annurev. ento.48.091801.112728 (6.) Long SW, Zhang X, Zhang J, Ruble RP, Teel P, Yu XJ. Evaluation of transovarial transmission and transmissibility of Ehrlichia chaffeensis (Rickettsiales: Anaplasmataceae) in Amblyomma americanum (Acari: Ixodidae). J Med Entomol. 2003;40:1000-4. DOI: 10.1603/0022-2585-40.6.1000 (7.) Stromdahl EY, Vince MA, Billingsley PM, Dobbs NA, Williamson PC. Rickettsia amblyommii infecting Amblyomma americanum larvae. Vector-Borne Zoonot Dis. 2008;8:1-9. DOI: 10.1089/ vbz.2007.0136 (9.) Paddock CD, Yabsley MJ. Ecological havoc, the rise of white-tailed deer, and the emergence of Amblyomma americanum-associated zoonoses in the United States. Curr Top Microbiol. 2007;315:289-324. DOI: 10.1007/978-3-540-70962-612 (10.) LoGiudice K, Ostfeld RS, Schmidt KA, Keesing F. The ecology of infectious disease: effects of host diversity and community composition on Lyme disease risk. Proc Natl Acad Sci U S A. 2003;100:56771. DOI: 10.1073/pnas.0233733100 (11.) Brisson D, Dykhuizen DE, Ostfeld RS. Conspicuous impacts of inconspicuous hosts on the Lyme disease epidemic. Proc R Soc B. 2008;275:227-35. DOI: 10.1098/rspb.2007.1208 (12.) Kent RJ. Molecular methods for arthropod blood meal identification and applications to ecological and vector-borne disease studies. Mol Ecol Resour. 2009;9:4-18. DOI: 10.1111/j.1755-0998 .2008.02469.x (13.) Pichon B, Egan E, Rogers M, Gray J. Detection and identification of pathogens and host DNA in unfed host-seeking Ixodes ricinus L. J Med Entomol. 2003;40:723-31. DOI: 10.1603/0022-2585-40.5.723 (14.) Pichon B, Rogers M, Egan D, Gray J. Blood meal analysis for the identification of reservoir hosts for tick-borne pathogens in Ireland. Vector-Borne Zoonot Dis. 2005;5:172-80. DOI: 10.1089/ vbz.2005.5.172 (15.) Moran Cadenas FM, Rais O, Humair PF, Douet V, Moret J, Gern L. Identification of host blood meal source and Borrelia burgdorferi sensu lato in field-collected Ixodes ricinus ticks in Chaumont (Switzerland). J Med Entomol. 2007;44:1109-17. DOI: 10.1603/00222585(2007)44[1109:IOHBSA]2.0.CO;2 (16.) Humair PF, Douet V, Cadenas FM, Schouls LM, Van de Pol I, Gern L. Molecular identification of blood meal source in Ixodes ricinus ticks using 12S rDNA as a genetic marker. J Med Entomol. 2007;44:86980. DOI: 10.1603/0022-2585(2007)44[869:MIOBSI]2.0.CO;2 (17.) Gray JS, Kahl O, Lane RS, Stanek G, eds. Lyme borreliosis: biology, epidemiology and control. Oxford (UK): CABI Publishing; 2002. (18.) Schulze TL, Jordan RA, Hung RW. Biases associated with several sampling methods used to estimate abundance of Ixodes scapularis and Amblyomma americanum (Acari: Ixodidae). J Med Entomol. 1997;34:615-23. (19.) Keirans JE, Durden LA. Illustrated key to nymphs of the tick genus Amblyomma (Acari: Ixodidae) found in the United States. J Med Entomol. 1998;35:489-95. (20.) Hammer B, Moter A, Kahl O, Alberti G, Gobel UB. Visualization of Borrelia burgdorferi sensu lato by fluorescence in situ hybridization (FISH) on whole-body sections of Ixodes ricinus ticks and gerbil skin biopsies. Microbiol. 2001;147:1425-36. (21.) Black WC IV, Piesman J. A phylogeny of hard and soft tick taxa based on mitochondrial 16S ribosomal DNA sequences. Proc Natl Acad Sci U S A. 1994;91:10034-8. DOI: 10.1073/pnas.91.21.10034 (22.) DeShields A, Borman-Shoap E, Peters JE, Gaudreault-Keener M, Arens MQ, Storch GA. Detection of pathogenic ehrlichia in ticks collected at acquisition sites of human ehrlichiosis in Missouri. Mo Med. 2004;101:132-7. (23.) Rijpkema SG, Molekenboer MJ, Schouls LM, Jongejan F, Schellekens JG. Simultaneous detection and genotyping of three genomic groups of Borrelia burgdorferi sensu lato in Dutch Ixodes ricinus ticks by characterization of the amplified intergenic spacer region between 5S and 23S rRNA genes. J Clin Microbiol. 1995;33:3091-5. (24.) Hood GM. 2008. PopTools version 3.0.6. http://www.cse.csiro.au/poptools (25.) Bacon RM, Gilmore RD Jr, Quintana M, Piesman J, Johnson BJ. DNA evidence of Borrelia lonestari in Amblyomma americanum (Acari: Ixodidae) in southeast Missouri. J Med Entomol. 2003;40:590-2. DOI: 10.1603/0022-2585-40.4.590 (26.) Mixson TR, Campbell SR, Gill JS, Ginsberg HS, Reichard MV, Schulze TL, et al. Prevalence of Ehrlichia, Borrelia, and Rickettsial agents in Amblyomma americanum (Acari: Ixodidae) collected from nine states. Vector-Borne Zoonot. 2006;43:1261-8. (27.) Stromdahl EY, Williamson PC, Kollars TM, Evans SR, Barry RK, Vince MA, et al. Evidence for Borrelia lonestari DNA in Amblyomma americanum (Acari: Ixodidae) removed from humans. J Clin Microbiol. 2003;41:5557-62. DOI: 10.1128/JCM.41.12.5557 5562.2003 (28.) Yabsley MJ, Varela AS, Tate CM, Dugan VG, Stallknecht DE, Little SE, et al. Ehrlichia ewingii infection in white-tailed deer (Odocoileus virginianus). Emerg Infect Dis. 2002;8:668-71. (29.) Arens MQ, Liddell AM, Buening G, Gaudreault-Keener M, Sumner JW, Comer JA, et al. Detection of Ehrlichia spp. in the blood of wild white-tailed deer in Missouri by PCR assay and serologic analysis. J Clin Microbiol. 2003;41:1263-5. DOI: 10.1128/JCM.41.3.1263 1265.2003 (30.) Moore VA IV, Varela AS, Yabsley MJ, Davidson WR, Little SE. Detection of Borrelia lonestari, putative agent of southern tick-associated rash illness, in white-tailed deer (Odocoileus virginianus) from the southeastern United States. J Clin Microbiol. 2003;41:424-7. DOI: 10.1128/JCM.41.1.424-427.2003 (31.) Brunner JL, LoGuidice KL, Ostfeld RS. Estimating reservoir competence of Borrelia burgdorferi hosts: prevalence and infectivity, sensitivity, and specificity. J Med Entomol. 2008;45:139-47. DOI: 10.1603/0022-2585(2008)45[139:ERCOBB]2.0.CO;2 Author affiliation: Washington University in St. Louis, St. Louis, Missouri, USA (B.F. Allan, L.S. Goessling, R.E. Thach); and St. Louis Children's Hospital, St. Louis (G.A. Storch) Dr Allan is a postdoctoral fellow studying the community ecology of vector-borne diseases at Washington University's Tyson Research Center. His research interests include understanding the effects of anthropogenic environmental change on the emergence of infectious diseases vectored by ticks and mosquitoes. Address for correspondence: Brian F. Allan, Tyson Research Center, Washington University in St. Louis, 6750 Tyson Valley Rd, Eureka, MO 63025, USA; email: ballan@wustl.edu Table 1. Oligonucleotide sequences of bacterial probes used in reverse
line blot assay
Probe ID Nucleotide sequence (5' [right arrow] 3')
Ptg011 AACATGAACATCTAAAAACATAAA
Ptg012 AACATTTAAAAAATAAATTCAAGG
Ptg013 CATTAAAAAAATATAAAAAATAAATTTAAGG
Ptg009 CTTTGACCATATTTTTATCTTCCA
Ptg010 AACACCAATATTTAAAAAACATAA
Ptg003 CGAACTTCTGGGTCAAGAC
Ptg020 AGATAACTACTCTCCGTTTG
Ptg022 TCCTAATAGGGGGAGTC
Ptg023 CTTTTAACAGAGGGAGTCA
Ptg024 TCCTAACAGGGGGAGTC
Ptg007 TGGGGATTTTTTATCTCTGTG
Ptg021 CTACCACTGACGCTGAT
Ptg027 CTTCGGAACGCAGTGAC
Ptg026 CTTGGGGAGGACGTTAC
Ptg029 GCCTATRAGTTAATAGCTTGT
Ptg028 TCCTGCGATCTTTCTAGA
Ptg032 CATCCAGGGAAGTAAGC
Ptg030 GCTACAACTGACACTGATG
Ptg031 TACAACTGACGCTAATGC
Ptg035 TCGGAAGATTATCTTTCGG
Probe ID Target organism (rRNA genes)
Ptg011 Borrelia garinii (23S-5S)
Ptg012 B. afzelii (23S-5S)
Ptg013 B. valaisiana (23S-5S)
Ptg009 B. burgdorferi s.l. (23S-5S)
Ptg010 B. burgdorferi s.s. (23S-5S)
Ptg003 B. burgdorferi s.l. (16S)
Ptg020 B. lonestari (16S)
Ptg022 Ehrlichia chaffeensis (16S)
Ptg023 E. ewingii (16S)
Ptg024 E. canis/ovina/muris (16S)
Ptg007 Anaplasma phagocytophilum (16S)
Ptg021 Rickettsia rickettsii (16S)
Ptg027 Francisella tularensis + F. philomiragia (16S)
Ptg026 F. tularensis subsp. tularensis (16S)
Ptg029 F. philomiragia (16S)
Ptg028 F. endosymbiont of Dv (16S)
Ptg032 Arsenophonus spp. (16S)
Ptg030 R. endosymbiont of Dv (16S)
Ptg031 R. amblyommii + Rickettsia sp. (16S)
Ptg035 R. amblyommii (16S)
Probe ID Reference sequence
Ptg011 *
Ptg012 *
Ptg013 *
Ptg009 *
Ptg010 *
Ptg003 T
Ptg020 AY166715
Ptg022 M73222
Ptg023 M73227
Ptg024 AY394465, AY318946,
ABO13009
Ptg007 ([dagger])
Ptg021 DQ150694
Ptg027 Z21932, Z21933
Ptg026 Z21932
Ptg029 Z21933
Ptg028 AF166256
Ptg032 AY265347
Ptg030 AY375427
Ptg031 U11012
Ptg035 U11012
* Designed by Rijpkema et al. 1995 (23).
([dagger]) Designed by Pichon et al. 2003 (13).
Table 2. Oligonucleotide sequences of vertebrate probes used in
reverse line blot assay *
Probe ID Probe name Nucleotide sequence
(5' [right arrow] 3')
PRNA010 Aves CCGACCTCCGGGGACGC
PRNA012 Passeriformes GGGCCCGCCCGGCAGCT
PRNA029 Galliformes GGGCTCGCCCGGCGGCT
PRNA042 Squamata/testudines CGCTGACCTCCGGGGATGC
PRNA043 Amphibia CGCTGACCCCCAGGGATGC
PRNA045 Ruminantia GGTCAGCCTCCTCCCGGC
PRNA018 Leporidae CGGGGGGGTGGGCGCCG
PRNA047 Leporidae/carnivore GGTCAGCCTCCCCCCGGC
PRNA046 Canidae GGTCAGCCTCCCTCCGGC
PRNA026 Sciurus CGGTCAGCTTCCCCCCGG
PRNA037 Blarina AGCCTCCCCTCGGCTCCG
PRNA030 Erinaceus CTCCCTCCGGCTCCGGC
PRNA017 Myodes 1 GAGCTCCCCCGCGGCCC
PRNA050 Myodes 2 CGACGGGCGCCGACCCC
PRNA011 Murinae/gerbilinae CCCTCCCGGCTCCGGCCG
PRNA034 Rattus CGGTCAGCCCCCTCCCGG
PRNA033 Mus CCGGTGAGCTCCCTCCCGG
PRNA035 Sigmodontinae TCAGCTCCCTCCCGGCCCC
PRNA032 Didelphis CGGCGGCTTCCCCCTAACC
PRNA048 Mephitis GGTCAGCCTCTCCCCGGC
Probe ID Reference sequence
PRNA010 *
PRNA012 *
PRNA029 *
PRNA042 Sceloporus undulatus (M36359, M59400), Crotaphytus
collaris collarist (FJ797666), Trachemys scriptat
(FJ797668), Scincella lateralis (AY217908), Eumeces
fasciatus (AY217920), Elaphe obsoletat (FJ797667),
Heterodon platirhinos (M59392)
PRNA043 Rana amurensis (AF542043), R. chensinensis (AY145522),
Xenopus laevis (X04025)
PRNA045 Odocoileus virginianust (FJ797665), Capreolus capreolus L
(AY150545), Cervus elaphus L (AY150547), Bos taurus
(AY779625)
PRNA018 *
PRNA047 Sylvilagus floridanus (FJ797663), Procyon lotort
(FJ797659), Felis catus L (AY150542),
PRNA046 Canis latranst (FJ797662), Canis lupus familiarist
(FJ797658), C. lupus familiaris (DQ287955), Vulpes vulpes
(AY150549)
PRNA026 *
PRNA037 Blarina sp.t (FJ797661)
PRNA030 *
PRNA017 *
PRNA050 Myodes glareolus (AY150543)
PRNA011 *
PRNA034 Rattus norvegicus (X01117)
PRNA033 Mus musculus (X00686)
PRNA035 Peromyscus sp.t (FJ797660), Peromyscus leucopus
(AY591913)
PRNA032 Didelphis virginiana (J311677)
PRNA048 Mephitis mephitist (FJ797664)
* Designed by Pichon et al. 2003 (13).
([dagger]) Sequence obtained in this study.
Table 3. Hybridization by host DNA to vertebrate reverse line blot
probes
Probe ID Probe name Vertebrate DNA hybridized
PRNA010 Aves Turdus migratorius, Meleagris
gallopavo, Gallus gallus, Chen
caerulescens
PRNA012 Passeriformes T. migratorius
PRNA029 Galliformes M. gallopavo, G. gallus, C.
caerulescens
PRNA042 Squamata/testudines Crotophytus collaris, Elaphe
obsoleta, Trachemys scripta elegans
PRNA043 Amphibia Rana clamitans
PRNA045 Ruminantia Odocoileus virginianus, Cervus
elephus, Bos taurus, Sus scrofa
domestica
PRNA018 Leporidae Sylvilagus floridanus, Sus scrofa
domestica
PRNA047 Leporidae/carnivora S. floridanus, Felis catus, Procyon
lotor
PRNA046 Canidae Canis lupus familiaris, C. latrans,
Vulpes vulpes, Tamias striatus*
PRNA026 Sciurus Sciurus carolinensis, Sciurus niger,
S. griseus, Marmota monax
PRNA037 Blarina Blarina brevicauda, Sorex vagrans
PRNA030 Erinaceus No hybridization with any vertebrate
DNA tested
PRNA017 Myodes 1 Myodes gapperi
PRNA050 Myodes 2 M. gapperi, Microtus californicus
PRNA011 Murinae/gerbilinae Rattus norvegicus, Mus musculus,
Zapus hudsonius
PRNA034 Rattus Rattus norvegicus
PRNA033 Mus M. musculus
PRNA035 Sigmodontinae Peromyscus spp., Neotoma fuscipes
PRNA032 Didelphis Didelphis virginiana
PRNA048 Mephitis Mephitis mephitis
* The reaction was confirmed by using 2 tissue samples. The PCR
amplicon was sequenced and matches the Canidae probe.
Table 4. Identification of host DNA in questing Amblyomma americanum
nymphs, Missouri, USA, 2005 and 2007-2008
Host data 2005 2007
No. nymphs analyzed (no. hosts identified) 75 (33) 489 (240)
No. (%) nymphs per identified host
Ruminantia 5 (15.2) 147 (61.3)
Galliformes 4 (12.1) 16 (6.7)
Passeriformes 1 (3.0) 17 (7.1)
Sciurus 17 (51.5) 13 (5.4)
Leporidae 3 (9.1) 3 (1.3)
Squamata/testudines 0 15 (6.3)
Canidae 0 1 (0.4)
Leporidae/carnivora 0 0
Sigmodontinae 1 (3.0) 1 (0.4)
Mixed 2 (6.1) 27 (11.3)
Host data 2008 All
No. nymphs analyzed (no. hosts identified) 819 (596) 1,383 (869)
No. (%) nymphs per identified host
Ruminantia 237 (39.8) 389 (44.8)
Galliformes 77 (12.9) 97 (11.2)
Passeriformes 76 (12.8) 94 (10.8)
Sciurus 65 (10.9) 95 (10.9)
Leporidae 15 (2.5) 21 (2.4)
Squamata/testudines 3 (0.5) 18 (2.1)
Canidae 7 (1.1) 8 (0.9)
Leporidae/carnivora 3 (0.5) 3 (0.3)
Sigmodontinae 1 (0.2) 3 (0.3)
Mixed 112 (18.8) 141 (16.2)
Table 5. Blood meal source in pathogen-positive Amblyomma
americanum nymphs, Missouri, USA, 2005 and 2007-2008
No. A. americanum nymphs infected
Ehrlichia Borrelia
Host chaffeensis E. ewingii lonestari
Ruminantia 8 12 4
Sciurus 2 3 1
Leporidae 1 1 0
Passeriformes 0 1 1
Squamata/testudines 0 0 1
Mixed 4 6 2
Not identified 4 8 9
Total 19 31 18
Table 6. Estimates of reservoir capacity for reservoir hosts of
Amblyomma americanum-associated zoonoses *
% Bloodmeals associated with
pathogen infection (95% CI)
Host Ehrlichia chaffeensis E. ewingii
Ruminantia 2.1 (30 -75.2) 3.1 (33.0-70.8)
Sciurus 2.1 (3.7-37.9) 3.2 (4.5-32.1)
Leporidae 4.8 (1.2-29.8) 4.8 (0.8-21.0)
Passeriformes 0 1.1 (0.8-21.0)
Squamata/testudines 0 0
* CI, confidence interval. Borrelia lonestari is omitted because of
the confounding influence of transovarial transmission. |
| Gale Copyright: | Copyright 2010 Gale, Cengage Learning. All rights reserved. |