|
Bindin gene from the Kumamoto oyster Crassostrea
sikamea, and divergence of the fucose lectin repeats of bindin among
three species of Crassostrea.
|
|
|
|
|
| Article Type: | Report |
| Subject: |
Lectins
(Properties) Crassostrea (Genetic aspects) Oysters (Genetic aspects) |
| Authors: |
Wu, Qi Xu, Fei Bao, Yongbo Li, Li Zhang, Guofan |
| Pub Date: | 04/01/2011 |
| Publication: | Name: Journal of Shellfish Research Publisher: National Shellfisheries Association, Inc. Audience: Academic Format: Magazine/Journal Subject: Biological sciences; Zoology and wildlife conservation Copyright: COPYRIGHT 2011 National Shellfisheries Association, Inc. ISSN: 0730-8000 |
| Issue: | Date: April, 2011 Source Volume: 30 Source Issue: 1 |
| Topic: | Event Code: 310 Science & research |
| Product: | Product Code: 0913050 Oysters NAICS Code: 114112 Shellfish Fishing SIC Code: 0913 Shellfish |
| Geographic: | Geographic Scope: Japan Geographic Code: 9JAPA Japan |
|
|
|
| Accession Number: | 255839402 |
| Full Text: |
ABSTRACT Bindin is a major protein packaged as insoluble granules
in sperm acrosomes. It may be responsible for speciesspecific
recognition and binding of sperm to a glycoprotein receptor on the
surface of eggs. The putative functional region of bindin is a
fucose-binding lectin (F-lectin) domain. We cloned a novel bindin gene
from the Kumamoto oyster Crassostrea sikamea by 3' and 5'
RACE. The full-length cDNA of C. sikamea bindin was 1,134 bp, with a
774-bp open reading frame encoding 257 amino acids. The deduced amino
acid sequence contained a putative signal peptide of 24 amino acids. The
length of the bindin genomic DNA we obtained was 5,353 bp, containing 4
exons and 3 introns. We studied F-lectin repeats of the bindin gene from
3 species of Crassostrea to detect the relationship between them and
found 11, 2, and 5 haplotypes from C. sikamea, Crassostrea angulata, and
Crassostrea gigas, respectively. Phylogenetic trees showed a closer
relationship between C. gigas and C. angulata than between C. gigas and
C. sikamea. Two haplotypes of C. angulata fell into 2 different clades,
one in the C. gigas clade and the other in the C. sikamea clade. Deduced
amino acid sequences and hydropathy plots were considerably similar
among these species, indicating the close resemblance in the tertiary
structure of bindin proteins. To test for selection, we compared the
number of nonsynonymous substitutions and synonymous substitutions per
nucleotide site among the 18 F-lectin haplotypes. This analysis
identified 7 positively selected positions (P > 95%) among 18
haplotypes from the 3 species, all located on the F-lectin binding face
around the 3 residues that are specifically involved in binding fucose
(H37, R64, and R70). We hypothesize that these 7 clustered amino acids
may be related to species recognition and thus could impose selective
pressure on bindin divergence. KEY WORDS: Crassostrea, Crassostrea gigas, Crassostrea sikamea, Crassostrea angulata, fucose lectin repeats, sperm-egg interaction, positive selection INTRODUCTION Interaction between sperm and egg during fertilization involves a series of steps in many free-spawning marine invertebrates (Vacquier 1998). These steps include chemotaxis of the sperm to the egg (Kaupp et al. 2003, Darszon et al. 2006), induction of the acrosome reaction (Alves et al. 1997, Vacquier & Moy 1997, Vilela-Silva et al. 2002), and binding of the sperm to the egg (Foltz & Lennarz 1993). Each step may serve as a barrier to hybridization between even closely related taxa (Metz et al. 1994, Palumbi 1998). Recognition and adhesion between sperm and eggs are crucial for fertilization. Gamete recognition proteins (GRPs) play an important role in mediating sperm-egg recognition. One of the well-studied GRPs is bindin, the main granule in acrosome vesicles. Bindin was first found in sea urchins (Vacquier & Moy 1977) and subsequently in many (externally fertilized) marine invertebrates. The fucose-binding lectin (F-lectin) domain of bindin plays an important role in sperm-egg attachment and species recognition (Bjorklund et al. 2006, Moy & Vacquier 2008). F-lectin domains are widely distributed from prokaryotes to eukaryotes. In the bacterium Pseudomonas aeruginosa, lectin B plays a prominent role in human infections by binding specifically to L-fucose (Tielker et al. 2005). F-lectins have also been described as immune recognition molecules in both invertebrates and vertebrates such as horseshoe crabs (Salto et al. 1997), Japanese eels (Honda et al. 2000), and the striped bass Morone saxatilis (Odom & Vasta 2006). In Crassostrea species, F-lectin is the main functional domain of bindin for recognition during fertilization (Moy & Vacquier 2008). The Pacific oyster (Crassostrea gigas) and the Portuguese oyster (Crassostrea angulata) are so closely related that they were once considered the same species. Their taxonomic ambiguity was later clarified by using mtDNA markers (Boudry et al. 1998). The Kumamoto oyster (Crassostrea sikamea), inhabiting Ariake Bay, Kumamoto Prefecture, Kyushu, Japan (Sato 2000), is also a close relative of C. gigas and was once identified as a geographical subspecies of C. gigas based on ecobiological and morphological differences (Amemiya 1928). Studies were carried out to clarify the taxonomic status of C. sikamea, including experimental hybridization (Imai & Sakai 1961, Numachi 1978, Camara et al. 2008), serology (Numachi 1962), chromosome analysis (Armed 1975), and allozymes (Buroker et al. 1979, Ozaki & Fujio 1985). RFLP analysis of the mitochondrial 16S rRNA gene finally confirmed that it is a distinct species from C. gigas (Banks et al. 1994). One-way gametic incompatibility results in partial reproductive isolation between C. gigas and C. sikamea. C. gigas sperm can fertilize C. sikamea egg, forming viable hybrid offspring, but C. sikamea sperm cannot fertilize C. gigas egg (Banks et al. 1994). Hybridization between C. gigas and C. angulata is successful in both directions, and no hybridization barrier has been demonstrated (Huvet et al. 2004). In this study, we cloned the full-length cDNA and genomic DNA of bindin of C. sikamea, and cloned and analyzed F-lectin repeats within the bindin gene from 3 species of Crassostrea. These results are important in understanding the role of F-lectin repeats in speciation and hybridization among Crassostrea species. MATERIALS AND METHODS Collection and Sampling We collected 6 male C. angulata (Lamarck 1819) from Putian in Fujian, China, and 5 male C. sikamea (Amemiya 1928) from Xiaomiaohong oyster reef in Jiangsu, China. The adductor muscle of each specimen was dissected out, fixed in 80% ethanol, and stored frozen (-80[degrees]C) until use. Fresh and mature gonads were removed, and the DNA and the RNA were extracted immediately. All samples were identified by COI sequencing with primers COI-F and COI-R (Table 1) (Wang et al. 2008). Cloning the Full-Length eDNA of Bindin We isolated RNA from male oyster gonad using TRIzol reagent (Invitrogen, Carlsbad, CA) following the manufacturer's protocol; care was taken not to cross-contaminate samples between individuals. RQ1 RNase-Free DNase (Promega) was used to remove any DNA contaminants, cDNAs were synthesized from total RNAs with M-MLV reverse transcriptase (Promega) and oligo(dT)-adaptor primer. Conserved regions were identified by aligning 5 repeat sequences from the Pacific oyster C. gigas (GenBank accession nos. EF219425-EF219429) and designing a forward primer sBindin-F1 and a reverse primer sBindin-R1 within these regions. PCR was performed using a Bio-Rad PCR system. PCR products were cloned into the pMD18-T vector (TaKaRa) and sequenced in both directions with the universal vector primers M 13-47 and R-VM. The obtained partial sequence data were used to design primers for the SMART-RACE amplification of 3'- and 5'- ends of bindin cDNA. For the 3' RACE PCR, primer sBindin-F2 and oligo(dT)-adaptor were used in the first-round PCR, and primer sBindin-F3 and anchor primer AP were used in the second round. A 5' full RACE kit (TaKaRa) was used for 5' RACE PCR, in which primer sBindin-R2 and 5' RACE outer primer were used in the first-round PCR, and primer sBindin-R3 and 5' RACE inner primer were used in the second round. Primer sBindin-55 and sBindin-32 were designed according to the sequences of 5'- and 3'- ends to get the entire length of the bindin cDNA sequence (Table 1). All PCR products were cloned and sequenced following the procedures just described. The resulting sequences were verified and subjected to cluster analysis (Table 2). Genomic DNA was isolated from individual adductor muscle using the Genomic DNA Purification Kit (Promega), dissolved in TE buffer (10 mM Tris/1 mM EDTA, pH 8.0), and stored at -20[degrees]C. Based on the sequence of full-length bindin gene from C. gigas (GenBank accession nos. EU708435 and EU307654), and the sequence of cDNA from C. sikamea, primers were designed to amplify intron-1 (primers sBindin-55 and sBindin-Inla) and intron-2 (primers sBindin-59 and sBindin-In2a). To amplify F-lectin repeat sequences, primers Bindin-F6 and Bindin-32 were designed based on the sequences of intron-2 and 3' untranslated region (UTR). PCR products were cloned and sequenced following the procedures described earlier. Purified PCR products were cloned into the pMD18-T vector (TaKaRa) and sequenced in both directions (Table 1). [FIGURE 1 OMITTED] Cloning of the F-Lectin Repeats Primers were designed based on the sequence of the full-length bindin gene from C. gigas (GenBank accession nos. EU708435 and EU307654) to amplify the F-lectin repeats (primers Bindin-F/Bindin-R; Table 1) of C. sikamea and C. angulata. PCR was performed using a Bio-Rad PCR system. Amplification started at 94[degrees]C for 5 min for predenaturation, followed by 30 cycles of denaturation at 94[degrees]C for 30 sec, annealing at 59[degrees]C for 40 sec (depending on the length of template), and elongation at 72[degrees]C for 50 sec, with 10 min at 72[degrees]C for final elongation. Purified PCR products were cloned into the pMD18-T vector (TaKaRa) and sequenced in both directions as described. The resulting sequences were verified and subjected to cluster analysis. Analysis The nucleotide and deduced amino acid sequences were analyzed with BioEdit 7.0.9.0 (Hall 1999). The sequences were searched in the NCBI databases with BLAST. A multiple sequence alignment was created with ClustalX 1.83 (Thompson et al. 1997). The phylogenetic trees of the selected F-lectin repeats were produced with neighbor-joining (NJ) and minimum-evolution (ME) methods, and were analyzed using MEGA 4.0 (http://www.megasoftware.net). Bootstrap analysis (1,000 replications) was performed to test the reliability of nodes for the trees. A pairwise distance matrix for the NJ tree was produced using the method of Hasegawa et al. (1985) to evaluate the ratios of transition/transversion (after adjusting for gaps and ambiguities) in the nucleotide sequences. The SignalP program was used to identify the signal peptide (http:// www.cbs.dtu.dk/services/SignalP/). InterPro Scan was used to search motif sequences (http://www.ebi.ac.uk/InterProScan/). The compute pI/Mw tool of ExPASy (http://au.expasy.org/ tools/pi_tool.html) was used to calculate the molecular mass and the theoretical isoelectric point. The SWISS-MODEL Protein Modeling Server (http://swissmodel.expasy.org/) was used to construct the F-lectin 3D model. The DNAsp 4.10 program (Rozas et al. 2003) was used to analyze the haplotypes of F-lectin repeat. The method by Kyte and Duolittle (1982) was used to find the hydropathy plots. PAML software (Yang 1997, Yang & Nielsen 2000) was used to calculated the number of nonsynonymous (Dn) and synonymous (Ds) substitutions per site. RESULTS Full-Length cDNA and Deduced Amino Acid Sequence of Bindin The full-length bindin cDNA from C. sikamea (GenBank accession no. GQ131801) was 1,134 bp, with a 774-bp open reading frame (ORF) encoding 257 amino acids. This cDNA contained a 5' UTR of 88 nucleotides, a 3' UTR of 272 nucleotides including a stop codon (TAA), a poly (A) tail, and a putative polyadenylylation consensus signal with the sequence (AATAAA) 23 bp upstream of the polyadenylylation tail (Fig. 1). SignalP program analysis revealed that the cDNA contained a putative signal sequence of 24 amino acids. Signal sequences from C. sikamea (MLMDWLSLLFGALCVYLQTSISDG) and C. gigas (MLVDWLSVLFGALCVYLQTSISDG) shared great similarity. The calculated molecular mass of the deduced mature C. sikamea bindin was 28,924.48 Da, and it had a theoretical isoelectric point of 10.34. Crassostrea sikamea Bindin Gene The full length of the bindin gene was 5,353 bp (GenBank accession no. GQ131802), and was composed of 4 exons and 3 introns. All introns were located within the ORF, and all exon-intron junctions followed the consensus rule of the splice acceptor-GT/AG-splice donor for splicing. In C. sikamea, exon-1 encoded the 24-residue signal sequence and the first 6 mature amino acids (amino acids 1-30). Intron-1 (Inl, 624 bp) bisected codon R30 of the bindin cDNA. Exon-2 encoded the unique N-terminal oyster bindin sequence (residues 30-123), which was highly conserved in the C. gigas bindin sequence (Moy et al. 2008). Intron-2 (In2, 2,779 bp) contained a microsatellite of 33 GA repeats 54 bp 5' to the beginning of the F-lectin repeat exon-1. (One F-lectin repeat included 2 exons and I intron, so we named them exon-1 and exon-2 to identify them.) This [(GA).sub.33] microsatellite was important for splicing, because the number of GA repeats might influence the efficiency of splicing. In C. gigas, GA repeats were all found in 57 bp 5' to the F-lectin repeat exon-1. The sequence between the GA microsatellite and 5'- end of the F-lectin repeat exon-1 was highly conserved between these 2 Crassostrea species, with the identity ranging from 82.1-85.7%. This highly conserved sequence signaled the start of a new F-lectin repeat and may play an important role in splicing. Repeat exon-1 encoded the N-terminal half of the F-lectin repeats. The third intron of the C. sikamea bindin gene located in the middle of the F-lectin repeat was labeled intron-4, following Moy and Vacquier (2008). Intron-4 varied significantly in size and sequence in C. gigas (Moy et al. 2008), but did not find among 8 individuals in C. sikamea. This might be caused by the small sample size and the fact that our samples were all from the same location. The proportion of purine bases (A/T) of the entire bindin gene was 66.17% in C. sikamea. A/T contents in introns were much higher, even reaching 75.96% in intron-1 and 69.94% in intron-4. [FIGURE 2 OMITTED] [FIGURE 3 OMITTED] [FIGURE 4 OMITTED] Genomic Sequences of F-Lectin Repeats The F-lectin repeat sequences of the 3 species ranged from 399-bp (C. sikamea) to 414-bp (C. gigas) nucleotides in length. GenBank accession nos. are shown in Table 2. In C. sikamea, 11 haplotypes were identified among 17 sequences of F-lectin repeats from 5 males of the Nantong population. The haplotype diversity was 0.846, the number of variable sites was 18, the nucleotide diversity per site (Pi) was 0.006, and the mean content of G + C% was 41.2%. In C. angulata, 2 haplotypes were found among 6 F-lectin repeat sequences of 5 male oysters. The haplotype diversity was 0.600, the number of variable sites was 25, the nucleotide diversity per site (Pi) was 0.038, and the mean content of G + C% was 40%. For C. gigas, F-lectin repeat sequences from GenBank were used in this study, and 5 haplotypes were identified (GenBank accession nos. EF219425-EF219429). The haplotype diversity was 1.000 (probably resulting from bias in the GenBank submission), the number of variable sites was 25, the nucleotide diversity per site (Pi) was 0.027, and the mean content of G + C% was 40.8%. Multiple alignment of all 18 haplotype sequences resulted in a total length of 415 nucleotides. The total number of polymorphic sites was 55. Among the parsimony informative sites, 4 were 3-variant sites (119, 120, 137, and 368), and 1 was a 4-variant site (198). Table 3 shows that pairwise genetic distances ranged from 0.0024 (g3 and g4)-0.0593 (g1 and g5) within C. gigas, 0.0025-0.0100 within C. sikamea, 0.0752 (g1 and s4)--0.0935 (g2 and s10) between C. gigas and C. sikamea, 0.0098 (g5 and an1)--0.0897 (g3 and an2) between C. gigas and C. angulata, and 0.0151 (an2 and s4)--0.0776 (an 1 and s1/s2/s5/ s9/s10) between C. angulata and C. sikamea. The distance between an1 and an2 of C. angulata was 0.0621. The resulting phylogenetic trees using NJ (Fig. 2) and ME (Fig. 3) both consisted of 2 main clades. One clade contained 6 haplotype sequences including all sequences of C. gigas and an1 of C. angulata. The other clade comprised the rest of the 18 haplotype sequences. Haplotypes g1 and s2 were slightly separated from their homogeneous haplotypes by an1 and an2, respectively. Deduced Amino Acid Sequences of F-Lectin Repeats The deduced amino acid sequences are aligned and listed in Figure 4. The calculated molecular mass and the theoretical isoelectric point are given in Table 4. The theoretical isoelectric point of F-lectin repeats was similar to that of the entire deduced amino acid sequence of bindin in each species. Four cysteines (positions 27, 36, 88, and 105) were found in every F-lectin repeat sequence, with 2 in repeat exon-1 (positions 1-67) and 2 in repeat exon-2 (positions 68-133). In addition, an2 of C. angulata had a fifth cysteine at position 18. The 3 longest regions of perfect identity were the 13 residues from positions 1-13, the 12 residues from positions 68-79, and the 19 residues from positions 99-117. There were 2 occurrences of 2 contiguous positively charged amino acids in all sequences (positions 11-12, 86-87). One histidine and 2 arginines were conserved at positions 37, 64, and 70. The pairwise identity for all 18 F-lectin amino acid sequences is shown in Table 5. Haplotype g1 of C. gigas was more similar to an 1 of C. angulata than to the other 4 sequences of C. gigas. Haplotype an2 of C. anguluta had a closer relationship with the sequences of C. sikamea than with an1. Hydropathy Plots Hydropathy plots (Fig. 5) of the 18 F-lectin repeat sequences showed that they all had 3 hydrophilic domains (positions 31-45, 60-70, and 90-100) interrupted by 2 large hydrophobic domains (positions 53-55 and 75-81). (The similar hydropathy plots imply a similar tertiary structure.) The amplitude of hydrophilic peaks was obviously higher than that of hydrophobic peaks. The hydrophobic peaks were at positions 55 and 80. The hydrophilic peaks were at positions 36, 68, and 92. Although the overall trend was similar among the 18 F-lectin repeat sequences, peak values showed subtle differences. The value of the first hydrophilic peak (position 36) was close to -2.5 in C. sikamea and C. angulata, whereas in C. gigas the value was close to 2.0. The second hydrophilic peak at position 68 was close to -2.3 for haplotypes g1 and g2, but was about -1.5 for the others. Consequently, the second hydrophilic peak exceeded the first hydrophilic peak in g1 and g2. The value of the third hydrophilic peak was close to -1.5, except for g1, which was close to -2.0. Divergence of F-lectin Repeats among Crassostrea After aligning the 18 F-lectin repeat sequences, we quantified the number of Dn's and Ds's per nucleotide When Dn is significantly greater than Ds, it indicates that positive selection has occurred. We identified the particular codon sites that have been subjected to positive selection using the site model in the PAML software. We used likelihood ratio tests to detect positive selection. The first test compared M la (neutral) against M2a (selection), in which 2[DELTA]l was 22.98 (df= 2, P < 0.01), and 5 amino acid sites (positions 40, 66, 67, 123, and 125; P > 95%) were under positive selection. The second test compared M7 against M8, in which 7 sites (positions 16, 21, 40, 66, 67, 123, and 125; P > 95%) were shown under positive selection (2[DELTA]l = 23.08, df = 3, P < 0.01). So 7 positively selected positions (16, 21, 40, 66, 67, 123, and 125; P > 95%) were identified among 18 haplotypes of these 3 species (Fig. 5). Five sites were in the F-lectin repeat exon-1 (positions 16, 21, 40, 66, and 67) and 2 were in the F-lectin repeat exon-2 (positions 123 and 125). All 7 residues were located around the 3 recognition motif residues (H37, R64, and R70) in the 3D model (Fig. 6). [FIGURE 5 OMITTED] DISCUSSION This study demonstrates significant phylogenetic information for 18 haplotypes of 3 species. The NJ tree and ME tree showed that 5 haplotypes of C. gigas and 11 haplotypes of C. sikamea fell into 2 distinct clades. Previous studies suggested that C. gigas was more closely related to C. angulata than to C. sikamea. Our results show that an1 of C. angulata nested within the clade of C. gigas, which is consistent with phylogenetic trees based on mtCOI gene sequences (Reece et al. 2008, Wang et al. 2008). However, an2 of C. angulata is closely associated with the clade of C. sikamea. It is interesting that these 2 haplotypes of C. angulata fell into different clades. F-lectin repeats of bindin play an important role in species-specific binding between sperm and eggs during fertilization in open seawater. However, hybridization between species of Crassostrea has been observed. The hybridization between C. gigas and C. angulata is successful in the laboratory in both directions (Menzel 1974), and no hybridization barrier has yet been demonstrated (Huvet et al. 2001, Huvet et al. 2002). Several lines of evidence indicate that these 2 species can also hybridize in the wild (Huvet et al. 2004), despite the morphological (Batista et al. 2008), physiological (Haure et al. 2003), and especially genetic (Leitao et al. 2007) differences between 2 species. The Kumamoto oyster, C. sikamea, is also a close relative of the Pacific oyster, C. gigas. Previous studies have shown that gamete incompatibility results in partial reproductive isolation in hybridization between them. Hybridization asymmetry between C. gigas and C. sikamea has been observed, in which C. sikamea eggs can be fertilized by C. gigas sperm, but C. sikamea sperm cannot fertilize C. gigas eggs (Numachi 1977, Moy et al. 2008). Successful cross-breeding between 2 species suggests that bindin can be recognized by egg receptors of other species. First, C. gigas bindin is extraordinarily polymorphic. Southern blots hybridized to the 3' UTR indicate that bindin gene is a single-copy gene in C. gigas, but considerable numbers of cDNA variants can be produced by diverse splicing and recombination (Moy et al. 2008). And the number of F-lectin repeats is variable. An individual male can produce sperm containing 1-2 bindin, and different individuals can produce a different set of bindin variants (Moy et al. 2008). We speculate that there are some bindin types of C. gigas that can react with egg receptors of C. angulata and C. sikamea when fertilization conditions are appropriate. Second, data from nucleotide and amino acid sequences, and hydropathy plots showed that the tertiary structures of bindin proteins were very similar among the 3 species of Crassostrea. This similarity may contribute to the interaction of bindin to egg receptors of other species. [FIGURE 6 OMITTED] In externally fertilized marine invertebrates, GRPs are characterized by considerable interspecific divergence and rapid evolution (Swanson & Vacquier 2002). These divergences of species-specific GRPs play an important role in establishing barriers to cross-fertilization. GRPs in abalone (Haliotis), such as lysine and an 18-kDa fusagenic protein, show extensive divergence and rapid accumulation of nonsynonymous substitutions among closely related species (Lee et al. 1995, Hellberg & Vacquier 1999, Swanson & Vacquier 1995, Metz et al. 1998). The Dn-to-Ds ratio provides a sensitive measure to detect selective pressure at the protein level (Yang & Nielsen 2002). Here we compared the number of Dn's and Ds's per nucleotide site among the 18 F-lectin bindin haplotypes. Seven positive selection positions of 18 F-lectin haplotypes were identified. All 7 sites are near H37, R64, and R70. Seven clustered amino acids may be related with species-specific recognition, because 1H and 2R residues are important for the function of F-lectin repeats. These residues are under great positive selective pressure, possibly from the receptor of the egg. The receptor of the egg may play a much more important role during fertilization than previously thought. Reproductive isolation is extremely important for these externally fertilized marine invertebrates. The recognition between conspecific sperm and egg could provide the selective pressure for the gamete recognition systems evolution. Bindin and its cognate receptor must evolve together for recognition during fertilization. The rapid divergence of GRPs within species ultimately leads to incompatibility of sperm and egg between species (Springer et al. 2008). Studies of the gamete recognition system may improve our understanding of the complex processes of speciation and adaptation (Palumbi 1992). ACKNOWLEDGMENTS This research was supported by a grant from the National Basic Research Program of China (2010CB 126401), the National Natural Science Foundation of China (NO. 40730845), the National Hi-Technology Program of China (2006AA10A408 and 20060110A4013), the Public Welfare Agriculture Project (nyhyzx07-047), and the Knowledge Innovation Program of CAS. LITERATURE CITED Alves, A.P., B. Mulloy, J.A. Diniz & P. A. Mourao. 1997. Sulfated polysaccharides from the egg jelly layer are species-specific inducers of acrosomal reaction in sperms of sea urchins. J. Biol. Chem. 272:6965-6971. Amemiya, I. 1928. Ecological studies of Japanese oysters with special reference to the salinity of their habitats. J. Coll. Agric. Univ. 9:333-382. Armed, M. 1975. Speciation of living oysters. Adv. Mar. Biol. 13:357-397. Banks, M. A., D. J. Mcgoldrick, W. Borgeson & D. Hedgecock. 1994. Gametic incompatibility and genetic divergence of Pacific and Kumamoto oysters, Crassostrea gigas and Crassostrea sikamea. Mar. Biol. 121:127-135. Batista, F. M., R. Ben-Hamadou, V. G. Fonseca, N. Taris, F. Ruano, M. A. Reis-Henriques & P. Boudry. 2008. Comparative study of shell shape and muscle scar pigmentation in the closely related cupped oysters Crassostrea angulata, C. gigas and their reciprocal hybrids. Aquat. Living Resour. 21:31-38. Bjoklund, A. K., D. Ekman & A. Elofsson. 2006. Expansion of protein domain repeats. PLOS Comput. Biol. 2:959-970. Boudry, P., S. Heurtebise, B. Collet, F. Cornette & A. Gerard. 1998. Differentiation between populations of the Portuguese oyster, Crassostrea angulata (Lamarck) and the Pacific oyster, Crassostrea gigas (Thunberg), revealed by mtDNA RFLP analysis. J. Exp. Mar. Biol. Ecol. 226:279-291. Buroker, N. E., W. K. Hershberger & K. K. Chew. 1979. Population genetics of the family Ostreidae. I. intraspecific studies of Crassostrea gigas and Saccostrea commercialis. Mar. Biol. 54:157-169. Camara, M. D., J. P. Davis, M. Sekino, D. Hedgecock, G. Li, C. J. Langdon & S. Evans. 2008. The Kumamoto oyster Crassostrea sikamea is neither rare nor threatened by hybridization in the northern Ariake Sea, Japan. J. Shellfish Res. 27:313-322. Darszon, A., J. J. Acevedo, B. E. Galindo, E. O. Hernandez-Gonzalez, T. Nishigaki, C. L. Trevino, C. Wood & C. Beltran. 2006. Sperm channel diversity and functional multiplicity. Reproduction 13l: 977-988. Foltz, K. R. & W. J. Lennarz. 1993. The molecular basis of sea urchin gamete interactions at the egg plasma membrane. Dev. Biol. 158:46-61. Hall, T. A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 41:95-98. Hasegawa, M., H. Kishino & T. Yano. 1985. Dating of the human ape splitting by a molecular clock of mitochondrial DNA. J. Mol. Evol. 22:160-174. Haure, J., A. Huvet, H. Palvadeau, M. Nourry, C. Penisson, J. L. Y. Martin & P. Boudry. 2003. Feeding and respiratory time activities in the cupped oysters Crassostrea gigas, Crassostrea angulata and their hybrids. Aquaculture 218:539-551. Hellberg, M. E. & V. D. Vacquier. 1999. Rapid evolution of fertilization selectivity and lysin cDNA sequences in teguline gastropods. Mol. Biol. Evol. 16:839-848. Honda, S., M. Kashlwagl, K. Mlyamoto, Y. Takel & S. Hirose. 2000. Multiplicity, structures, and endocrine and exocrine nature of eel fucose-binding lectins. J. Biol. Chem. 275:33151-33157. Huvet, A., K. Balabaud, N. Bierne & P. Boudry. 2001. Microsatellite analysis of 6-hour-old embryos reveals no preferential intra-specific fertilization between cupped oysters Crassostrea gigas or Crassostrea angulata. Mar. Biotechnol. 3:448-453. Huvet, A., C. Fabioux, H. McCombie, S. Lapegue & P. Boudry. 2004. Natural hybridization in genetically differentiated populations of Crassostrea gigas and C. angulata highlighted by sequence variation in flanking regions of a microsatellite locus. Mar. Ecol. Prog. Ser. 272:141-152. Huvet, A., A. Gerard, C. Ledu, P. Phe1ipot, S. Heurtebise & P. Boudry. 2002. Is fertility of hybrids enough to conclude that the two oysters Crassostrea gigas and Crassostrea angulata are the same species? Aquat. Living Resour. 15:45-52. Imai, T. & S. Sakai. 1961. Study of breeding of Japanese oyster, Crassostrea gigas. Tohoku J. Agric. Res. 12:125-171. Kaupp, U. B., J. Solzin, E. Hildebrand, J. E. Brown, A. Helbig, V. Hagen, M. Beyermann, F. Pampaloni & I. Weyand. 2003. The signal flow and motor response controlling chemotaxis of sea urchin sperm. Nat. Cell Biol. 5:109-117. Kyte, J. & R. F. Duolittle. 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157:105-132. Lee, Y.- H., T. Ota & V. D. Vacquier. 1995. Positive selections a general phenomenon in the evolution of abalone sperm lysin. Mol. Biol. Evol. 12:231-238. Leitao, A., R. Chaves, S. Santos, H. Guedes-Pinto & P. Boudry. 2007. Interspecific hybridization in oysters: restriction enzyme digestion chromosome banding confirms Crassostrea angulata x Crassostrea gigas F1 hybrids. J. Exp. Mar. Biol. Ecol. 343:253-260. Menzel, R. W. 1974. Portuguese and Japanese oysters are the same species. J. Fish Res. 31:453-456. Metz, E. C., R. E. Kane, H. Yanagamachi & S. R. Palumbi. 1994. Fertilization between closely related sea urchins is blocked by incompatibilities during sperm-egg attachment and early stages of fusion. Biol. Bull. 187:23-34. Metz, E. C., R. Robles-Sikisaka & V. D. Vacquier. 1998. Nonsynonymous substitution in abalone sperm fertilization genes exceeds substitution in introns and mitochondrial DNA. Proc. Natl. Acad. Sci. USA 95:10676-10681. Moy, G. W., S. A. Springer, S. L. Adams, W. J. Swanson & V. D. Vacquier. 2008. Extraordinary intraspecific diversity in oyster sperm bindin. Proc. Natl. Acad. Sci. USA 105:1993-1998. Moy, G. W. & V. D. Vacquier. 2008. Bindin genes of the Pacific oyster Crassostrea gigas. Gene 423:215-220. Numachi, K. I. 1962. Serological studies of species and races in oysters. Am. Nat. 96:211-217. Numachi, K. 1977. Japanese species, breed and distribution. In: T. Imai, editor. Aquaculture in shallow seas: progress in shallow sea culture. New Delhi: Amerind Publishing. pp. 123-126. Numachi, R. 1978. Biological research on the oyster. In: T. Imai, editor. Aquaculture in shallow seas. Rotterdam: Balkema. pp. 115-204. Odom, E. W. & G. R. Vasta. 2006. Characterization of a binary tandem domain F-type lectin from striped bass (Morone saxatilis). J. Biol. Chem. 281:1698-1713. Ozaki, H. & Y. Fujio. 1985. Genetic differentiation in geographical populations of Pacific oyster Crassostrea gigas around Japan. Tohoku J. Agric. Res. 36:49-61. Palumbi, S. R. 1992. Marine speciation on a small planet. Ecol. Evol. 7:114-118. Palumbi, S. R. 1998. Species formation and the evolution of gamete recognition loci. In: D. Howard & S. Berlocher, editors. Endless forms: species and speciation. New York: Oxford University Press. pp. 271-278. Reece, K. S., J. F. Cordes, J. B. Stubbs, K. L. Hudson & E. A. Francis. 2008. Molecular phylogenies help resolve taxonomic confusion with Asian Crassostrea oyster species. Mar. Biol. 53:709-721. Rozas, J., J. C. Sanchez-DelBarrio, X. Messeguer & R. Rozas. 2003. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Bioinformatics 19:2496-2597. Salto, T., M. Hstada & S. Iwangaga. 1997. A newly identified horseshoe crab lectin with binding specificity to O-antigen of bacterial lipopolysaccharides. J. Biol. Chem. 272:30703-30708. Sato, S. 2000. Bivalves in the Ariake Sea with special reference to Isahaya Bay. In: M. Sato, editor. Life in Ariake Sea: biodiversity in tidal flats and estuaries. Tokyo: Kaiyusha. pp. 150-183. Springer, S. A., G. W. Moy, D. S. Friend, W. J. Swanson & V. D. Vacquier. 2008. Oyster sperm bindin is a combinatorial fucose lectin with remarkable intra-species diversity. Int. J. Dev. Biol. 52: 759-768. Swanson, W. J. & V. D. Vacquier. 1995. Extraordinary divergence and positive Darwinian selection in a fusagenic protein coating the acrosomal process of abalone spermatozoa. Proc. Natl. Acad. Sci. USA 92:4957-4961. Swanson, W. J. & V. D. Vacquier. 2002. Rapid evolution of reproductive proteins. Nat. Rev. Genet. 3:137-144. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin & D. G. Higgins. 1997. The ClustalX Windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucl. Acids Res. 25:4876-4882. Tielker, D., S. Hacker, R. Loris, M. Strathmann, J. Wingender, S. Wilhelm, F. Rosenau & K. E. Jaeger. 2005. Pseudomonas aeruginosa lectin LecB is located in the outer membrane and is involved in biofilm formation. Microbiology 151:1313-1323. Vacquier, V. D. 1998. Evolution of gamete recognition proteins. Science 281:1995-1998. Vacquier, V. D. & G. W. Moy. 1977. Isolation of bindin: the protein responsible for adhesion of sperm to sea urchin eggs. Proc. Natl. Acad. Sci. USA 74:2456-2460. Vacquier, V. D. & G. W. Moy. 1997. The fucose sulfate polymer of egg jelly binds to sperm REJ and is the inducer of the sea urchin sperm acrosome reaction. Dev. Biol. 192:125-135. Vilela-Silva, A. C. E. S., M. O. Castro, A. P. Valente, C. H. Biermann & P. A. S. Mourao. 2002. Sulfated fucans from the egg jellies of the closely related sea urchins Strongylocentrotus droebachiensis and Strongylocentrotus pallidus ensure species-specific fertilization. J. Biol. Chem. 277:379-387. Wang, H., G. Zhang, X. Liu & X. Guo. 2008. Classification of common oysters from north China. J. Shellfish Res. 27:495-503. Yang, Z. H. 1997. PAML: a program package for phylogenetic analysis by maximum likelihood. Comput. Appl. Biosci. 13:555-556. Yang, Z. H. & R. Nielsen. 2000. Estimating synonymous and nonsynonymous substitution rates under realistic evolutionary models. Mol. Biol. Evol. 17:32-43. Yang, Z. H. & R. Nielsen. 2002. Codon-substitution models for detecting molecular adaptation at individual sites along specific lineages. Mol. Biol. Evol. 19:908-917. QI WU, (1,2) FEI XU, (1,2) YONGBO BAO, (1,2) LI LI (1) AND GUOFAN ZHANG (1), * (1) Institute of Oceanology, Chinese Academy of Sciences, Biology Building, Room 334, 7 Nanhai road, Qingdao 266071, China; (2) Graduate University of Chinese Academy of Sciences, Beijing 100049, China * Corresponding author. E-mail: gfzhang@ms.qdio.ac.cn DOI: 10.2983/035.030.0109 TABLE 1.
Primer sequences.
Primers Sequence (5'-3')
COI-F GCTATGTTTTTAGACCCCGTG
COI-R CCAGCAAGGTGAAGGCTTAG
sBindin-Fl GTCGGTGGTTCTAAAAATCTTGC
sBindin-RI TTTCATTCCACCAGGACACT
sBindin-F2 TGAGCAGTGTCTATGGCAAAT
sBindin-F3 GTCAACGGAAATACAAAAGAT
sBindin-R2 CGTATTTGCCATAGACACTGCT
sBindin-R3 TATCCACATTTCCTCAGTCTAC
5' RACE outer primer CATGGCTACATGCTGACAGCCTA
5' RACE inner primer CGCGGATCCACAGCCTACTGATGATCAGTCGATG
Oligo(dT)-adaptor GGCCACGCGTCGACTAGTACT (18)
Anchor primer AP GGCCACGCGTCGACTAGTAC
sBindin-55 TATTTCAGCAGACGAAGACG
sBindin-Inla CATAGGTTTTCTGGTGCTCC
sBindin-59 TGGGAGCACCAGAAAACCTA
sBindin-In2a CGTATTTGCCATAGACACTGCTCACA
Bindin-32 TAGTAAGCCTCGTTCTCTCT
Bindin-F6 AACGCAGATAAAAGGCAAGAA
Bindin-F GTCGGTGGTTCTAAAAATCTTGC
Bindin-R TCCAAAAACTTGCACCTCG
Primers Application
COI-F COI amplify
COI-R COI amplify
sBindin-Fl A part of repeat sequence
sBindin-RI A part of repeat sequence
sBindin-F2 3' RACE first-round PCR
sBindin-F3 3' RACE second-round PCR
sBindin-R2 5' RACE first-round PCR
sBindin-R3 5' RACE second round PCR
5' RACE outer primer 5' RACE first-round PCR
5' RACE inner primer 5' RACE second-round PCR
Oligo(dT)-adaptor 3' RACE adaptor primer
Anchor primer AP 3' RACE adaptor primer
sBindin-55 Intron-1/cDNA amplify
sBindin-Inla Intron-1 amplify
sBindin-59 Intron-2 amplify
sBindin-In2a Intron-2 amplify
Bindin-32 cDNA/repeats amplify
Bindin-F6 Repeats amplify
Bindin-F F-lectin repeat amplify
Bindin-R F-lectin repeat amplify
TABLE 2.
Haplotypes of F-lectin repeats from 3 oyster species, and
GenBank accession numbers.
GenBank Accession
Species Haplotype/n Sequences No.
C. sikamea (11) 1/1 si1 GQ408884
2/1 si2 GQ408885
3/1 si3 GQ408886
4/7 si4,7-9,11,14,17 GQ408887
5/1 si5 GQ408888
6/1 si6 GQ408889
7/1 si10 GQ408890
8/1 si12 GQ408891
9/1 si13 GQ408892
10/1 si15 GQ408893
11/1 si16 GQ408894
C. angulata (2) 1/3 anl,an3,an6 GQ408895
2/3 an2,an4,an5 GQ408896
C. gigas (5) 1/l gi1 EF219425 *
2/1 gi2 EF219426 *
3/1 gi3 EF219427 *
4/1 gi4 EF219428 *
5/1 gi5 EF219429 *
* Sequence downloads from Genbank.
TABLE 3.
Pairwise distance matrix of bindin F-lectin repeats among 18
haplotypes from 3 oyster species.
Haplotype g1 g2 g3 g4 g5 s1
g1 -- 0.0434 0.0486 0.0458 0.0593 0.0801
g2 0.3846 -- 0.0121 0.0096 0.0271 0.0827
g3 0.3313 1.4839 -- 0.0024 0.0248 0.0934
g4 0.3571 3.000 0.000 -- 0.0221 0.0902
g5 0.5012 1.2031 0.9833 1.2403 -- 0.0877
sl 1.1310 0.8301 1.0462 1.1116 1.0632 --
s2 1.0586 0.7336 1.0489 0.9939 0.9489 1.333
s3 1.0648 0.7751 0.9921 1.0534 1.0042
s4 1.1400 0.8202 1.0488 1.1250 1.0674 1.000
s5 1.2816 0.9365 1.1649 1.2419 1.1930 3.000
s6 1.2108 0.8783 1.1073 1.1802 1.1304 2.000
s7 1.2109 0.8784 1.1065 1.1802 1.1301 2.000
s8 1.2109 0.8784 1.1065 1.1802 1.1301 2.000
s9 1.2824 0.9372 1.1625 1.2427 1.1932 3.000
s10 1.2847 0.9389 1.1675 1.2445 1.1922 3.000
s11 1.2109 0.8784 1.0536 1.1802 1.1301 2.000
an1 0.5387 0.8364 0.9888 1.1980 0.3333 1.2192
an2 1.0034 1.0033 1.2484 1.3371 1.1524 0.6063
Haplotype s2 s3 s4 s5 s6 s7
g1 0.0827 0.0776 0.0752 0.0801 0.0776 0.0776
g2 0.0828 0.0802 0.0778 0.0827 0.0802 0.0803
g3 0.0883 0.0909 0.0884 0.0934 0.0909 0.0909
g4 0.0903 0.0877 0.0853 0.0902 0.0877 0.0877
g5 0.0876 0.0851 0.0827 0.0877 0.0851 0.0851
sl 0.0175 0.0050 0.0050 0.0100 0.0075 0.0075
s2 -- 0.0175 0.0125 0.0175 0.0150 0.0150
s3 1.333 -- 0.0050 0.0100 0.0075 0.0075
s4 1.500 1.000 -- 0.0050 0.0025 0.0025
s5 2.500 3.000 -- 0.0075 0.0075
s6 2.000 2.000 -- 0.0050
s7 2.000 2.000 --
s8 2.000 2.000
s9 2.500 3.000
s10 2.500 3.000
s11 2.000 2.000
an1 1.0717 1.1477 1.2366 1.3912 1.3141 1.3137
an2 0.6729 0.6063 0.5104 1.0085 0.7595 0.7601
Haplotype s8 s9 s10 s11 an1 an2
g1 0.0776 0.0801 0.0802 0.0776 0.0493 0.0892
g2 0.0803 0.0828 0.0828 0.0803 0.0270 0.0791
g3 0.0909 0.0934 0.0935 0.0884 0.0296 0.0897
g4 0.0877 0.0902 0.0903 0.0877 0.0269 0.0866
g5 0.0851 0.0877 0.0876 0.0851 0.0098 0.0695
sl 0.0075 0.0100 0.0100 0.0075 0.0776 0.0201
s2 0.0150 0.0175 0.0175 0.0150 0.0776 0.0251
s3 0.0075 0.0100 0.0100 0.0075 0.0751 0.0201
s4 0.0025 0.0050 0.0050 0.0025 0.0726 0.0151
s5 0.0075 0.0100 0.0100 0.0075 0.0776 0.0201
s6 0.0050 0.0075 0.0075 0.0050 0.0751 0.0176
s7 0.0050 0.0075 0.0075 0.0050 0.0751 0.0176
s8 -- 0.0075 0.0075 0.0050 0.0751 0.0176
s9 -- 0.0100 0.0075 0.0776 0.0202
s10 -- 0.0075 0.0776 0.0201
s11 -- 0.0751 0.0176
an1 1.3137 1.3913 1.3902 1.3137 -- 0.0621
an2 0.7581 1.0126 1.0116 0.7601 1.2754 --
Above the diagonal is genetic distance; below the diagonal is the
transition-to-transversion ratio.
TABLE 4.
Mean molecular mass and mean theoretical isoelectric
point of F-lectin among 3 oyster species.
Mean Molecular Mean Theoretical
Species Mass (kDa) Isoelectric Point
C. sikamea 14,888.45 10.27
C. angulata 14,929.39 10.43
C. gigas 14,839.77 10.65
TABLE 5.
Pairwise identity of 18 F-lectin amino acid sequences from 3 oyster
species.
Haplotype g1 g2 g3 g4 g5 s1 s2
g1
g2 0.872
g3 0.857 0.962
g4 0.872 0.977 0.984
g5 0.872 0.962 0.969 0.984
s1 0.834 0.842 0.819 0.834 0.834
s2 0.827 0.849 0.842 0.842 0.834 0.962
s3 0.842 0.849 0.827 0.842 0.842 0.984 0.962
s4 0.849 0.857 0.834 0.849 0.849 0.984 0.977
s5 0.842 0.849 0.827 0.842 0.842 0.977 0.969
s6 0.842 0.849 0.827 0.842 0.842 0.984 0.969
s7 0.842 0.849 0.827 0.842 0.842 0.977 0.969
s8 0.849 0.857 0.834 0.849 0.849 0.984 0.977
s9 0.834 0.849 0.827 0.842 0.842 0.969 0.962
s10 0.842 0.849 0.827 0.842 0.842 0.977 0.969
s11 0.849 0.857 0.834 0.849 0.849 0.984 0.977
an1 0.902 0.962 0.954 0.969 0.969 0.857 0.857
an2 0.796 0.827 0.804 0.819 0.819 0.917 0.917
Haplotype s3 s4 s5 s6 s7 s8 s9
g1
g2
g3
g4
g5
s1
s2
s3
s4 0.984
s5 0.977 0.992
s6 0.977 0.992 0.984
s7 0.977 0.992 0.984 0.984
s8 0.984 1 0.992 0.992 0.992
s9 0.969 0.984 0.977 0.977 0.977 0.984
s10 0.977 0.992 0.984 0.984 0.984 0.992 0.977
s11 0.984 1 0.992 0.992 0.992 1 0.984
an1 0.864 0.872 0.864 0.864 0.864 0.872 0.864
an2 0.917 0.932 0.924 0.924 0.924 0.932 0.917
Haplotype s10 s11 an1 an2
g1
g2
g3
g4
g5
s1
s2
s3
s4
s5
s6
s7
s8
s9
s10
s11 0.992
an1 0.864 0.872
an2 0.924 0.932 0.842 |
| Gale Copyright: | Copyright 2011 Gale, Cengage Learning. All rights reserved. |