|
Abnormal vascular endothelial growth factor expression
in mesenchymal stem cells from both osteonecrotic and osteoarthritic
hips.
|
|
|
|
|
| Abstract: | In osteonecrosis (ON) of the hip, interruption of angiogenesis is a pathological process that may lead to impairment of the nutrient supply, cell death, and the collapse of bone. However, the process of angiogenesis in ON is not well understood. The purpose of this study was to investigate the expression of vascular endothelial growth factor (VEGF) in human mesenchymal stem cells (MSCs) in vitro. Cultured MSCs obtained from the hips of normal, ON, and osteoarthritic (OA) patients all expressed VEGF-A. Furthermore, MSCs from normal stem cells also expressed VEGF-B, but its expression had a tendency to increase in those stem cells from ON and OA patients, while VEGF-C was absent in all of the stem cells. However, VEGF-D expression consistently decreased in MSCs from ON patients, but increased in stem cells from OA donors over that of control cells. In addition, placental growth factor (PGF), which has a similar function as VEGF, was expressed in MSCs, and the levels were similar in MSCs from normal, ON, and OA donors. The results suggest that ON and OA are associated with aberrant VEGF-D expression. |
|
|
|
| Article Type: | Report |
| Subject: |
Osteoarthritis
(Development and progression) Osteoarthritis (Research) Vascular endothelial growth factor (Physiological aspects) Vascular endothelial growth factor (Measurement) Vascular endothelial growth factor (Research) Bones (Necrosis) Bones (Development and progression) Bones (Research) |
| Authors: |
Mwale, Fackson Wang, Hongtian Johnson, Aaron J. Mont, Michael A. Antoniou, John |
| Pub Date: | 01/01/2011 |
| Publication: | Name: Bulletin of the NYU Hospital for Joint Diseases Publisher: J. Michael Ryan Publishing Co. Audience: Academic Format: Magazine/Journal Subject: Health Copyright: COPYRIGHT 2011 J. Michael Ryan Publishing Co. ISSN: 1936-9719 |
| Issue: | Date: Jan, 2011 Source Volume: 69 Source Issue: 1 |
| Topic: | Event Code: 310 Science & research |
| Accession Number: | 289216157 |
| Full Text: |
Osteonecrosis (ON), also known as avascular necrosis, bone
infarction, ischemic necrosis, subchondral osteonecrosis, and aseptic
necrosis, occurs when there is cellular death of bone due to the
interruption of the blood supply. Without a blood supply, eventually,
there will be collapse of the architectural bony structure. If it
involves the bones of a joint, such as the hip, knee, or shoulder, ON
often leads to articular cartilage damage and destruction of the
articular surfaces. This event will lead to joint pain and loss of
function and is frequently severe enough to require arthroplasty
surgery. Underneath the collapsing bone in ON of the hip, there is typically an attempt at a reparative response. Unfortunately, except under conditions of extremely small lesions, the reparative response fails, as osteoclastic resorption leads to subchondral collapse. Beneath the collapsing segment, there is often a hypervascular area, with the resultant effect similar to a hypertrophic nonunion found in altered fracture healing. At present, it is not known how to definitively repair the ischemic bone, but one potential treatment method would be to differentiate mesenchymal stem cells (MSCs) from adjacent living bone tissue into osteoblasts, and then embed them within a biomatrix to stimulate angiogenesis. This would test the hypothesis that under the appropriate stimulus, these cells, together with the remaining inorganic mineral volume, could produce a matrix that mimics that of native bone. Hopefully, the repaired tissue would have properties resembling those found in healthy and fully functional bone. MSCs have been shown to undergo enhanced bone formation in a mouse model of a segmental bone defect in terms of expressing osteogenic and angiogenic factors, such as BMP2+VEGF. (1) This model mimics the cellular condensation requirements for embryonic mesenchymal osteoblastogenesis and provides the biochemical environmental factors conducive to bone formation. Geiger and colleagues have shown that if the blood supply is compromised in fracture healing, (24) application of osteogenic factors alone cannot induce successful bone healing. Angiogenesis is essential for restoring blood flow to the fracture site. Treatment with vascular endothelial growth factor (VEGF) superfamily members, VEGFA, VEGFB, VEGFC, VEGFD, or placental growth factor (PGF) are key requirements for angiogenesis. (2) Human MSCs have been found to express VEGF, suggesting that implantation of human MSCs is a practical means for a source of VEGF production. (3) Autologous MSCs have appropriate differentiation properties, easy accessibility, and proliferative capacity. Because of the potential similarity to the altered healing response found in fracture nonunions that have been successfully treated with autologous MSCs, they could potentially complement ON treatment by secreting angiogenic factors and undergoing osteoblast differentiation. The purpose of this study was to investigate the expression of the angiogenic VEGF superfamily members in MSCs from normal, ON, and osteoarthritis (OA) patients. Materials and Methods The three sources of stem cells used in the study were: 1. normal human MSCs obtained from Lonza Group, Ltd. (Basel, Switzerland); 2. MSCs from OA patients obtained from 15 milliliter aspirates drawn from the intramedullary canal of donors undergoing total hip arthroplasty for OA, using a protocol approved by the research ethics committee (REC) of the Jewish General Hospital; and 3. MSCs from ON patients, obtained in a similar manner, from donors undergoing hip arthroplasty, using the same protocol approved by the institutional review board (IRB) of Sinai Hospital of Baltimore. Bone marrow aspirates were processed as previously described. (4-7) Briefly, each aspirate was diluted 1:1 with Dulbecco's Modified Eagle Medium (DMEM) reagent (Invitrogen[TM], Burlington, Ontario, Canada) and layered over 1:1 with Ficoll (Ficoll-Paque Plus; GE Healthcare Bio-Sciences, Baie-d'Urfe, Quebec City). After centrifugation at 900 x g for 30 minutes, the mononuclear cell layer was removed from the interface, washed with DMEM, and re-suspended in DMEM supplemented with 10% fetal bovine serum (Hyclone, Logan, Utah), 100 units/ml penicillin, 100 [micro]g/ml streptomycin, and 2 mM L-glutamine. The cells were plated in 20 milliliters of media in a 176-[cm.sup.2] culture dish and incubated at 37[degrees] Celsius (C) in a 5% C[O.sub.2] humidified atmosphere. After 72 hours, nonadherent cells were discarded, and the adherent ones were thoroughly washed twice with DMEM. Thereafter, the cells were expanded, as previously described. (5) Cell Culture Approximately, one million of third or fourth passage OA and ON donor MSCs were cultured on commercial polystyrene tissue culture dishes (Sarstedt, Inc., Montreal, Quebec, Canada) in DMEM-high glucose with 10% FBS. The media was changed every 2 days for up to 7 days, after which cells were harvested for gene expression studies. Total RNA Isolation Total RNA was extracted from MSCs by a modification of the method of Chomcynski and Sacchi, (8) using TRIzol[R] reagent (Invitrogen[TM]). After centrifugation for 15 minutes at 12,000 x g at 4[degrees]C, the aqueous phase was precipitated in one volume of isopropanol, incubated for 20 minutes at room temperature, and centrifuged again for 15 minutes at 12,000 x g at 4[degrees]C. The resulting RNA pellet was air-dried, re-suspended in 40 [micro]l of diethylpyrocarbonate-treated water, and 5 [micro]l was assayed for RNA concentration and purity by measuring [A.sub.260]/[A.sub.280]. Reverse Transcription (RT) and LightCycler[R] Real-Time Polymerase Chain Reaction (PCR) Salt-free primers for target genes VEGFA, VEGFB, VEGFC, VEGFD and PGF, as well as for housekeeping gene GAPDH, were generated by Invitrogen[TM]. The sequences of the primers are shown in Table 1. For LightCycler[R] reaction, every 20 [micro]L reaction solution consists of a master mix of the following reaction components: 8 [micro]L Rnase free distilled water, 10 [micro]L SYBR Green mixture (Qiagen), 0.5 [micro]L forward primer (0.25 [micro]M), 0.5 [micro]L reverse primer (0.25 [micro]M), and 1 [micro]L cDNA. The real time PCR condition included one cycle of denaturation (95[degrees]C for 15 minutes), 45 cycles of amplification and quantification (95[degrees]C for 15 seconds, 58[degrees]C for 15 seconds, and 72[degrees]C for 15 seconds, with a single fluorescence measurement), melting curve (65[degrees] to 95[degrees]C, with a heating rate of 0.1[degrees]C per second and a continuous fluorescence measurement), and finally a cooling step to 40[degrees] C. After real-time PCR, the samples were collected by centrifugation, and the gene size was analyzed on 2.0% agarose gel. The primer sequences used for PCR shown in Table 1 were chosen because they are specific for human RNA, and they amplify a single product. GAPDH primers have been described in one of our earlier articles. (9) Calculation of Relative Units of Gene Transcription The crossing points (CPs) were determined by LightCycler[R] software, version 3.3 (Roche Diagnostics, Basel, Switzerland) and were measured at constant fluorescence level. Every sample was run in duplicate. The relative units of real-time PCR were determined by the following equation: Relative units = [2.sup.[DELTA]CP target]/[2.sup.[DELTA]CP reference] Regarding statistical analysis, all experiments were performed in triplicates, and statistical differences between the treated and the controls were analyzed by Statview (SAS Institute, Inc., Cary, North Carolina). Results were considered statistically significant at p < 0.05. All results were the average of three samples [+ or -] standard deviation. [FIGURE 1 OMITTED] Results After culturing the cells for 24 hours, MSCs from normal, ON, and OA donors had the typical appearance of stem cells, with no overt differences between the groups (Fig.1). Normal donors showed strong VEGF-A message (Fig. 2, lane 1). VEGF-A message from ON and OA MSCs were also prominent, although they had a tendency to decrease (Fig. 2, lanes 2 and 3). In view of these results, in which VEGF-A, being the most important member of the VEGF proteins, appeared in all of the stem cells and with the understanding that VEGF-A can stimulate vasculogenesis and angiogenesis, we decided to analyze VEGF B, C, and D, as well as PGF, a growth factor with similar functions as VEGF. MSCs from normal stem cells also expressed VEGF-B; however, in contrast to VEGF-A, its expression had a tendency to increase in stem cells from ON and OA patients (Fig.3). Since VEGF-C was previously reported to be active in angiogenesis, lymphangiogenesis, endothelial cell growth, survival, and permeability of blood vessels, it appeared possible that MSCs express VEGF-C. However, VEGF-C was not detected in any of the stem cells (data not shown). The expression of VEGF-D was markedly reduced in normal stem cells (Fig. 4, lane 1). Its expression was strongly down-regulated in MSCs from ON but strongly up-regulated in stem cells from OA donors (Fig. 4, lanes 2 and 3). PGF was expressed in MSCs, and the levels were similar in MSCS from normal, ON, and OA donors (Fig. 5). Discussion MSCs have the ability to recruit and participate in angiogenesis and de novo arteriogenesis, and VEGF plays a central role in the observed host-derived angiogenic response. Previously, it was proposed that ex vivo expanded autologous MSCs may serve as cell therapy to promote therapeutic angiogenesis. (10) In this and our previous studies, (4,6,7,9,11,12) we used RT-PCR analyses of MSCs, which permitted expression analyses of the interrelationships of the VEGF family members VEGF-A, VEGF-B, VEGF-C, and VEGF-D, as well as PDF genes, that have usually been studied individually concerning their participation in stem cell-mediated angiogenesis in ON and OA donor cells. [FIGURE 2 OMITTED] [FIGURE 3 OMITTED] [FIGURE 4 OMITTED] [FIGURE 5 OMITTED] We observed that MSCs from normal, ON, and OA patients were characterized by a distinct signature profile of VEGF gene expression. Thus, MSCs from control patients are characterized by the expression of VEGF-A, VEGF-B, PGF, VEGF-D, and the absence of VEGF-C. This suggests that angiogenesis involving MSCs does not require VEGFC. There is also an absence of or low level of expression of type X collagen, better known as a protein expressed by terminally hypertrophic chondrocytes. (7,12,13) MSCs from ON patients were characterized by the expression of VEGF-A, VEGF-B, PGF, and decreased expression of VEGF-D for reasons that are unclear. The decreased expression of VEGF-D suggests that angiogenesis in MSCs may not require VEFG-D. MSCs from OA patients were characterized by a reduced expression of VEGF-A and increased expressions of VEGF-B and VEGF-D. The increased expression of VEGF-B and VEGF-D in these MSCS raises questions as to whether this is related to type X collagen expression. In these cells, it is noteworthy that aggrecan and type X collagen are constitutively expressed. (5-7,12,13) Previously, we have shown that the onset of hypertrophy in the growth plate was accompanied by the strongest but transient expression of VEGF as well as aggrecan. (14) Various studies have proposed using various VEGF factors to complement osteogenic factors for the treatment of ON in animal models. (15-23) A recent report described the potential use of genetically engineered bone marrow stem cells carrying genes for VEGF and bone morphogenetic protein-6 (BMP-6) (to induce osteogenesis) for the treatment of pre-collapse ON. (16) Another report described the down-regulation of VEGF proteins and gene expression in rabbits with steroid-induced ON. (17) In another report, the expression of VEGF was assessed in six specimens from late stage ON of the femoral head. (18) These investigators found that osteoblasts from the reactive interface exhibited increased VEGF expression, which the investigators postulated might be a secondary phenomenon in an attempt to stimulate ingrowth of a reparative blood supply. They also found that osteoblasts derived from OA femoral heads exhibited down-regulation of VEGF after 24 hours of co-incubation with glucocorticoids. Other studies have assessesed the role of VEGF proteins in various animal models and clinical studies of ON. (19-23) Conclusion Our data further define the complex changes and interrelationships in the VEGF family gene expression in stem cells from ON and OA donors that may occur in the course of vascular invasion and cell death. This investigation draws attention to these VEGF molecules and their relationships to the physiological and pathological events that are part of angiogenesis. Disclosure Statement None of the authors have a financial or proprietary interest in the subject matter or materials discussed, including, but not limited to, employment, consultancies, stock ownership, honoraria, and paid expert testimony. References (1.) Kumar S, Wan C, Ramaswamy G, et al. Mesenchymal stem cells expressing osteogenic and angiogenic factors synergistically enhance bone formation in a mouse model of segmental bone defect. Mol Ther. 2010 May; 18(5): 1026-34; Epub 2010 Jan 12. (2.) Mayer H, Bertram H, Lindenmaier W, et al. Vascular endothelial growth factor (VEGF-A) expression in human mesenchymal stem cells: autocrine and paracrine role on osteoblastic and endothelial differentiation. J Cell Biochem. 2005 Jul 1; 95(4): 827-39. (3.) Kagiwada H, Yashiki T, Ohshima A, et al. Human mesenchymal stem cells as a stable source of VEGF-producing cells. J Tissue Eng Regen Med. 2008 Jun; 2(4): 184-9. (4.) Mwale F, Girard-Lauriault PL, Wang HT, et al. Suppression of genes related to hypertrophy and osteogenesis in committed human mesenchymal stem cells cultured on novel nitrogen-rich plasma polymer coatings. Tissue Eng. 2006 Sep; 12(9): 2639-47. (5.) Mwale F, Stachura D, Roughley P, Antoniou J. Limitations of using aggrecan and type X collagen as markers of chondrogenesis in mesenchymal stem cell differentiation. J Orthop Res. 2006 Aug; 24(8): 1791-8. (6.) Mwale F, Wang HT, Nelea V, et al. The effect of glow discharge plasma surface modification of polymers on the osteogenic differentiation of committed human mesenchymal stem cells. Biomaterials. 2006 Apr; 27(10): 2258-64; Epub 2005 Nov 28. (7.) Mwale F, Yao G, Ouellet JA, et al. Effect of parathyroid hormone on type X and type II collagen expression in mesenchymal stem cells from osteoarthritic patients. Tissue Eng Part A. 2010 Nov; 16(11): 3449-55; Epub 2010 Aug 18. (8.) Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987; 162: 156-9. (9.) Nelea V, Luo L, Demers CN, et al. Selective inhibition of type X collagen expression in human mesenchymal stem cell differentiation on polymer substrates surface-modified by glow discharge plasma. J Biomed Mater Res A. 2005 Oct 1; 75(1): 216-23. (10.) Al-Khaldi A, Eliopoulos N, Martineau D, et al. Postnatal bone marrow stromal cells elicit a potent VEGF-dependent neoangiogenic response in vivo. Gene Ther. 2003; 10: 621-9. (11.) Mwale F, Stachura D, Roughley P, Antoniou J. Limitations of using aggrecan and type X collagen as markers of chondrogenesis in mesenchymal stem cell differentiation. J Orthop Res. 2006; 24: 1791-8. (12.) Petit A, Wang HT, Girard-Lauriault PL, et al. Novel insights into the mechanism of decreased expression of type X collagen in human mesenchymal stem cells from patients with osteoarthritis cultured on nitrogen-rich plasma polymers: implication of cyclooxygenase-1. J Biomed Mater Res A. 2010 Sep 1; 94(3): 744-50. (13.) Mwale F, Girard-Lauriault PL, Wang HT, et al. Suppression of genes related to hypertrophy and osteogenesis in committed human mesenchymal stem cells cultured on novel nitrogen-rich plasma polymer coatings. Tissue Eng. 2006 Sep; 12(9): 2639-47. (14.) Tchetina E, Mwale F, Poole AR. Distinct phases of coordinated early and late gene expression in growth plate chondrocytes in relationship to cell proliferation, matrix assembly, remodeling, and cell differentiation. J Bone Miner Res. 2003 May; 18(5): 844-51. (15.) Mont MA, Jones LC, Seyler TM, et al. New treatment approaches for osteonecrosis of the femoral head: an overview. Instr Course Lect. 2007; 56: 197-212. (16.) Cui Q, Botchwey EA. Emerging ideas: treatment of precollapse osteonecrosis using stem cells and growth factors. Clin Orthop Relat Res. 2010 Dec 16; Epub ahead of print. (17.) Wang G, Zhang CQ, Sun Y, et al.. Changes in femoral head blood supply and vascular endothelial growth factor in rabbits with steroid-induced osteonecrosis. J Int Med Res. 2010; 38: 1060-9. (18.) Varoga D, Drescher W, Pufe M, et al.. Differential expression of vascular endothelial growth factor in glucocorticoid-related osteonecrosis of the femoral head. Clin Orthop Relat Res. 2009; 467: 3273-82. (19.) Suzuki O, Bishop AT, Sunagawa T, et al. VEGF-promoted surgical angiogenesis in necrotic bone. Microsurgery. 2004; 24: 85-91. (20.) Radke S, Battmann A, Jatzke S, et al. Expression of the angiomatrix and angiogenic proteins CYR61, CTGF, and VEGF in osteonecrosis of the femoral head. J Orthop Res. 2006; 24: 945-52. (21.) Katsube K, Bishop AT, Simari RD, et al.. Vascular endothelial growth factor (VEGF) gene transfer enhances surgical revascularization of necrotic bone. J Orthop Res. 2005; 23: 469-74. (22.) Kim TH, Hong JM, Lee JY, et al.. Promoter polymorphisms of the vascular endothelial growth factor gene is associated with an osteonecrosis of the femoral head in the Korean population. Osteoarthritis Cartilage. 2008 Mar; 16(3): 287-91; Epub 2007 Aug 16. (23.) Kabata T, Matsumoto T, Yagishita S, et al. Vascular endothelial growth factor in rabbits during development of corticosteroidinduced osteonecrosis: a controlled experiment. J Rheumatol. 2008; 35: 2383-90. (24.) Geiger F, Lorenz H, Xu W, et al. VEGF producing bone marrow stromal cells (BMSC) enhance vascularization and resorption of a natural coral bone substitute. Bone 2007; 41: 516-522. Fackson Mwale, Ph.D., Hongtian Wang, Ph.D., and John Antoniou, M.D., Ph.D., are from the Lady Davis Institute for Medical Research and Department of Surgery, SMBD-Jewish General Hospital, McGill University, Montreal (QC), Canada. Aaron J. Johnson, M.D., and Michael A. Mont, M.D., are from Rubin Institute for Advanced Orthopedics, Center for Joint Preservation and Reconstruction, Sinai Hospital of Baltimore, Baltimore, Maryland. Correspondence: Fackson Mwale, Ph.D., Lady Davis Institute for Medical Research and Department of Surgery, SMBD-Jewish General Hospital, 3755 Cote Ste-Catherine Road, Montreal, Quebec H3T 1E2, Canada; fmwale@ldi.jgh.mcgill.ca. Table 1 Primers for Human VEGFA, B, C, D, PGF and GAPDH
PCR
Product
Gene Sequence Size
VEGFA Forward: GGGCAGAATCATCACGAAGT (100-119) 211
Reverse: TGGTGATGTTGGACTCCTCA (221-310)
VEGFB Forward: CCCTTGACTGTGGAGCTCAT (163-172) 203
Reverse: CACTGGCTGTGTTCTTCCAG (346-365)
VEGFC Forward: CACTTGCTGGGCTTCTTCTC (4-23) 173
Reverse: TGCTCCTCCAGATCTTTGCT (157-176)
VEGFD Forward: TGTAAGTGCTTGCCAACAGC (565-574) 163
Reverse: GTGGATTTTCCTCCTGCAAA (708-727)
PGF Forward: GTTCAGCCCATCCTGTGTCT (216-235) 163
Reverse: AACGTGCTGAGAGAACGTCA (359-378)
GAPDH Forward: TGAAGGTCGGAGTCAACGGAT (11-31) 181
Reverse: TTCTCAGCCTTGACGGTGCCA (171-191)
PCR, polymerase chain reaction; VEGF, vascular endothelial growth
factor; PGF, placental growth factor; GAPDH, glycerol-3-phosphate
dehydrogenase. |
| Gale Copyright: | Copyright 2011 Gale, Cengage Learning. All rights reserved. |