ADAMTS-13 gene expression in antiphospholipid syndrome / Antifosfolipid sendromunda ADAMTS-13 gen ekspresyonu.
Article Type: Clinical report
Subject: Enzymes (Analysis)
Enzymes (Health aspects)
Antiphospholipid syndrome (Genetic aspects)
Antiphospholipid syndrome (Analysis)
Antiphospholipid syndrome (Health aspects)
Genes (Analysis)
Genes (Health aspects)
Gene expression (Analysis)
Gene expression (Health aspects)
Authors: Hancer, Veysel Sabri
Kucukkaya, Reyhan Diz
Topal-Sarikaya, Aysegul
Pub Date: 09/01/2011
Publication: Name: Turkish Journal of Hematology Publisher: Aves Yayincilik Audience: Academic Format: Magazine/Journal Subject: Health Copyright: COPYRIGHT 2011 Aves Yayincilik ISSN: 1300-7777
Issue: Date: Sept, 2011 Source Volume: 28 Source Issue: 3
Product: Product Code: 2831600 Enzymes; 2831630 Enzymes for Food Processing NAICS Code: 32519 Other Basic Organic Chemical Manufacturing; 325199 All Other Basic Organic Chemical Manufacturing
Accession Number: 305562372
Full Text: Abstract

Antiphospholipid syndrome (APS) is an autoimmune disorder characterized by recurrent thrombosis and fetal mortality. Thrombotic microangiopathy (TMA) is an important histological finding in catastrophic APS (CAPS) and in APS patients with nephropathy. Analysis of familial thrombotic thrombocytopenic purpura patients showed that there are mutations in the ADAMTS-13 gene that lead to functional defects in the ADAMTS-13 enzyme. The aim of this study was to investigate the prevalence of the aforementioned mutations in APS, as well as to evaluate the level and activity of the ADAMTS-13 enzyme in patients with APS. C365del, Q44Sstop codon, P475S, and C508Y mutations were analyzed in APS patients. Transcriptions were analyzed. using real-time PCR, and the level and activity of ADAMTS-13 were analyzed via fluorogenic assay. None of the mutations tested were present in the patient or control groups. The level of ADAMTS-13 mRNA in the patient group was 50% lower tlian that in the control group. Although a significant difference in ADAMTS-13 activity was not observed between the patient and control groups, a significant association was observed with the level of ADAMTS-13 (p < 0.0001). The level and activity of ADAMTS-13 were not associated with thrombotic complications, thrombocytopenia, or pregnancy complications in the patients with APS. (Turk J Hernatol 2011; 28: 213-8)

Key words: Antiphospholipid syndrome, ADAMTS-13, gene expression

Received: April 22, 2011

Accepted: April 28, 2011

Ozet

Antifosfolipid sendrom (AFS), tekrarlayan tromboz ve fetal kapplar ile karakterize olan otoimmiin bir hastaliktur. Trombotik mikroanjiyopati (TMA), katastrofik AFS ve nefropatinin eslik eitigi AFS olgulannda onemli bir histolojik bulgudur. Ailesel trombotik trombositopenik purpura olgulannin incellenmesi sonucu, ADAMTS-13 enziminin islev bozuklukuna yol acan mutasyonlann varlini gostermistir.Bu calismada ADAMTS-13 mutasyonlan ile, enzimin aktivite ve miktannin AFS'ye katkisinin olup olmadikimn araslinlmasi amaclanmistir. Bu kapsamda C365de1, Q449stop kodonu, P475S ve C508Y mutasyonlan analiz edildi. Transkripsiyon asamasi gercek zamanli polimeraz zincir reaksiyonu, enzimin aktivite ve miktari ise florojenik bir yontem ile incelendi. Varligi arasturnlan mutasyonlar kontrol ve hasta gruplannda tespit edilmedi. ADAMTS-13 mRNA ve protein miktaruin hasta grubunda kontrol grubundaki diizeyin yansi kadar oldugu saptandi. (p < 0.0001). Enzim aktivitesi actsmdan ise iki grup arasinda istatistik olarak anlamli bir fark gozlenmedi. Sonuc olarak, ADAMTS-13 enzim aktivitesi ve miktarnin AFS hastalannda trombotik komplikasyonlar, trombositopeni ve gebelik komplikasyonlari ile iliskili olmachigi saptandi. (Turk J Hematol 2011; 28: 213-8)

Anahtar kelimeler: Antifosfolipid sendrom, ADAMTS-13, gen ekspresyonu.

Gelis tarihi: 22 Nisan 2011

Kabul tarihi: 28 Nisan 2011

Introduction

Antiphospholipid syndrome (APS) is characterized by both arterial and venous thrombosis, and fetal mortality in the presence of antiphospholipid antibodies (aPLAs) (1). aPLA antibodies are directed against plasma proteins bound to anionic phospholipids (2). Research has shown that aPLA-asso-ciated vascular lesions are predominantly noninflammatory vessel alterations with thrombotic luminal obliteration (2-6). Thrombotic microangiopathy (TMA), which is histologically defined as the development of hyaline thrombi in small vessels, is a frequent finding in patients with thrombotic thrombocytopenic purpura (TTP) and hemolytic uremic syndrome (HUS).

TTP is a rare disorder caused by inhibition of or low-level ADAMTS-13 (a disintegrin-like metalloprotease with thrombospondin type-1 motif, member 13), an enzyme responsible for cleaving von Willebrand factor (vWF). vWF is a large, multi-domain glycoprotein in human blood and secretory granules of both endothelial cells and platelets (7). vWF circulates as a multimer and is composed of identical units that range in molecular weight from 500 kDa to > 20,000 kDa. Immediately downstream of the site of injury the multimeric size of vWF is physiologically regulated to prevent the formation of thrombi. ADAMTS-13 cleaves vWF between Tyr842 and Met843 in the A2 domain of the vWF monomer (7-13), yielding typical fragments of 176 and 140 kDa, as well as smaller multimers.

Severe ADAMTS-13 deficiency may result in ultralarge vWF multimers that spontaneously interact with platelet receptors and cause thrombi in microcirculation (14-17). Very low-level ADAMTS-13 activity (< 5% of values in normal plasma), caused either by mutations of the ADAMTS-13 gene [10 18-20] or inhibitory antibodies against ADAMTS-13 (15, 16), is linked to TTP/HUS. TMA is an important histological finding in patients with CAPS and in APS patients with nephropathy. The present study aimed to examine ADAMTS-13 level and activity, C365de1, Q449stop, P475S, and C508Y mutations, and mRNA levels.

Materials and Methods

Study population

The study included 37 APS patients with thrombotic complications and 33 aPLA-positive patients without thrombotic complications, and 70 age-and sex-matched healthy controls. APS was diagnosed in patients with arterial and/or venous thrombosis based on the presence of lupus anticoagulant (LA) or anticardiolipin antibodies (ACA) (1). All the healthy controls were Caucasian with a negative history of thrombosis and fetal mortality. The study protocol was approved by the Istanbul Bilim University, Faculty of Medicine Ethics Committee and written and signed informed consent was provided by all the participants.

APS patients with thrombosis

Of the 37 APS patients, 23 were female. LA was diagnosed based on activated partial thromboplastin time, kaolin clotting time, and Russell's viper venom test results, as previously reported (21). The presence of IgG and IgM antibodies was determined via enzyme-linked immunosorbent assay (ELISA) (22), and levels [greater than or equal to]3 standard deviations were regarded as positive, ACA and LA tests were repeated 2 months after the first test.

aPLA-positive patients without thrombosis

Among the 33 aPLA-positive patients without thrombosis, 28 were female. These patients had first trimester fetal mortality or thrombocytopenia, and persistently positive aPLA test results, but no thrombotic complications during [greater than or equal to]3 years of fol-low-up. In all, 14 of the patients had thrombocytopenia, 7 had first trimester fetal mortality, and 12 had both thrombocytopenia and first trimester fetal mortality in the presence of aPLA (Table 1). None of the patients had clinical evidence of TMA events.

Genotyping

Genomic DNA was extracted from venous blood samples using a High Pure PCR Template Preparation Kit (Roche Diagnostics, IN, USA). DNA was amplified via polymerase chain reaction (PCR) using 100 ng of DNA, 200 nM of each primer, 200 [micro]M of each dNTP, 1.0 [micro]M of [MgC.sub.12], and 1.5 U of Taq DNA polymerase for 35 cycles in order to analyze mutations. PCR products were digested with restriction enzymes for C365de1, Q449stop, and P475S (Table 2). For the C508Y mutation, PCR products were directly sequenced using an ABI 310 genetic analyzer (Applied Biosystems, Foster City, CA, USA).

Quantification of ADAMTS-13 transcripts

Total RNA was extracted from venous blood samples using the RNA Preparation Kit (Roche Diagnostics, IN, USA). cDNA was obtained from total RNA using the RevertAid First Strand cDNA Synthesis Kit (MBI-Fermentas, St. Leon-Rot, Germany). The target gene (ADAMTS-13) and a reference gene (HPRT1) were analyzed via real-time PCR using a LightCycler 2.0 (Roche Diagnostics, Mannheim, Germany).

Activity and antigen levels

ADAMTS-13 activity and antigen levels were simultaneously measured in the same sample via fluorogenic assay (Technozym ADAMTS-13, Technoclone, Wien, Austria). Fluorescence was measured at 360/460 nm with a spectrofluorometer (Biotek reader FLX 800, Austria).

Statistical analysis

The t-test was used to analyze associations between quantitative data and a p value < 0.05 was considered statistically significant. Correlations were investigated using Spearrnan's rank test. All calculations were performed using Graph-PAD Instat v.3.06 (GraphPad software Inc., San Diego, CA, USA).

Results

ADAMTS-13 mutations

C365del, Q449stop, P475S, and C508YADAMTS-13 mutations, which were previously reported to affect ADAMTS-13 activity, were investigated. None of these mutations were noted in the patient or control groups. In order to determine if these nucleotide changes are polymorphic, an additional 250 healthy Turkish individuals (female/male: 148/102) were genotyped, and none had the aforementioned mutations.

ADAMTS-13 mRNA

The level of ADAMTS-13 mRNA in the APS patients was 50% less than that in the control group, based on the Pfaffl equation (23), as follows:

[MATHEMATICAL EXPRESSION NOT REPRODUCIBLE IN ASCII]

ratio = [1,978.sup.-1,48]/[1,964.sup.-0,38] = 0.5

ADAMTS-13 antigen and activity

Median ADAMTS-13 activity was 92.55% (range: 62%4 24%) in the patient group and 92.72% (range: 68%-124%) in the control group. ADAMTS-13 activity was 88.39% and 92.91% in the APS patients with and without a history of thrombosis, respectively, and although ADAMTS-13 activity was lower in the APS patients with thrombosis, the difference was not statistically significant (t-test, p = 0.4369, 95% CI: 62.91-96.94). Median ADAMTS-13 antigen level was significantly lower (64.88%) in the patient group (66.63% in the APS patients with thrombosis and 63.39% in those without thrombosis) than in the control group (98.2% [range: 55%-159%]) (t-test, p < 0.0001, 95% CI: 56.91-138.94). ADAMTS-13 activity in the control group was correlated with gender (p =0.0038), but not with age. There wasn't a correlation between the level of ADAMTS-13 and its activity, and ADAMTS-13 activity varied in participants that had the same level of ADAMTS-13.

Discussion

The presence of neutralizing anti-ADAMTS-13 autoantibodies or mutations resulting in severe ADAMTS-13 deficiency is a well-known major cause of acquired and congenital TTP. ADAMTS-13 activity in TTP patients, however, is generally < 5% or 10%. Amoura et al. reported 2 APS patients with undetectable ADAMTS-13 activity that developed TTP. They also investigated ADAMTS-13 activity in their APS cohort (n = 20), and observed that mean ADAMTS-13 activity was normal (116%; range: 44%-250%) and that none of the patients had severe ADAMTS-13 deficiency (24).

The literature contains only a few studies on anti-ADAMTS-13 antibodies and ADAMTS-13 activity in APS patients. Austin et al. (25) reported that 52 of 68 APS patients had IgG antibodies against ADAMTS-13 based on ELISA, and 22 patients had low-level ADAMTS-13 activity, although median ADAMTS-13 activity was 34%. Rieger et al. reported that the prevalence of anti-ADAMTS-13 IgG and IgM antibodies among 55 APS patients was 5% and 18%, respectively. ADAMTS-13 activity in APS patients ranged from 32% to 114%, and there wasn't a correlation between autoantibody titers and ADAMTS-13 activity (26).

The present study has 2 limitations: the study population was small and although many mutations have been reported in TTP, only 4 previously reported to affect ADAMTS-13 activity were investigated; however, to the best of our knowledge this is the first study to investigate these 4 mutations in APS. The present study investigated mutations that affect ADAMTS-13 activity, mRNA level, and antigen level in APS patients with thrombosis, aPLA-positive patients without thrombosis, and healthy controls. Genotyping for ADAMTS-13 mutations (C365de1, Q449stop codon, C508Y, and P475S) showed that none of the patients or controls carried these mutations. The present study's findings are the first to show that there isn't a relationship between ADAMTS-13 mutations and APS. ADAMTS-13 mRNA and antigen levels were lower in the patients than in the controls. This finding suggests that the ADAMTS-13 gene is negatively regulated during transcription, mutation/s may be present in the promoter region, or there may be an epigenetic effect. Although ADAMTS-13 activity was also low in the APS patients with thrombosis but, ADAMTS-13 activity did not reach statistical significance when compared with controls. ADAMTS-13 activity and level were not associated with thrombotic complications, thrombocytopenia, or pregnancy complications in the patients with APS.

Acknowledgements

This study was supported by the Istanbul University Research Fund (project no. 1454).

Conflict of interest statement

The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References

(1.) Miyakis S, Lockshin MD, Atsumi T, Branch DW, Brey RL, Cervera R, Derksen RH, DE Groot PG, Koike T, Meroni PL, ReberG, Shoenfeld Y, Tincani A, Vlachoyiannopoulos PG, Krilis SA. International consensus statement on an update of the classification criteria for definite antiphospholipid syndrome (APS). J Thromb Haemost 2006;4:295-306.

(2.) Salmon JE, de Groot PG. Pathogenic role of antiphospholipid antibodies. Lupus 2008;17:405-11.

(3.) Levine JS, Branch DW, Rauch J. The antiphospholipid syndrome. N Engl J Med 2002;346:752-63.

(4.) Nimmo MC, Carter CJ. The antiphospholipid antibody syndrome: a riddle wrapped in a mystery inside an enigma. Clin Appl Immunol Rev 2003;4:125-40.

(5.) Lockshin MD, Erkan D. Treatment of antiphospholipid syndrome. N Engl J Med 2003;349:1177-9.

(6.) Diz-Kucukkaya R. Thrombosis in the antiphospholipid syndrome. Turk J Hematol 2006;2:5-14.

(7.) Moake JL, Turner NA, Stathopoulos NA, Nolasco LH, Hellums JD. Involvement of large plasma von Willebrand factor (vWF) multimers and unusually large vWF forms derived from endothelial cells in shear stress-induced platelet aggregation. J Clin Invest 1986;78:1456-61.

(8.) Furlan M, Robles R, Lammle B. Partial purification and characterization of a protease from human plasma cleaving von Willebrand factor to fragments produced by in vivo proteolysis. Blood 1996;87:4223-34.

(9.) Tsai HM. Physiologic cleavage of von Willebrand factor by a plasma protease is dependent on its conformation and requires calcium ion. Blood 1996;87:4235-44.

(10.) Levy GG, Nichols WC, Lian EC, Foroud T, McClintick JN, McGee BM, Yang AY, Siemieniak DR, Stark KR, Gruppo R, Sarode R, Shurin SB, Chandrasekaran V, Stabler SP, Sabio H, Bouhassira EE, Upshaw JD Jr, Ginsburg D, Tsai HM. Mutations in a member of the ADAMTS gene family cause thrombotic thrombocytopenic purpura. Nature 2001;413:488-94.

(11.) Soejima K, Mimura N, Hirashima M, Maeda H, Hamamoto T, Nakagaki T, Nozaki C. A novel human metalloprotease synthesized in the liver and secreted into the blood: possibly, the von Willebrand factorcleaving protease?. J Biochem 2001;130:475-80.

(12.) Cal S, Obaya AJ, Llamazares M, Garabaya C, Quesada V, Lopez-Otin C. Cloning, expression analysis, and structural characterization of seven novel human ADAMTSs, a family of metalloproteinases with disintegrin and thrombospondin-1 domains. Gene 2002;283:49-62.

(13.) Dent JA, Berkowitz SD, Ware J, Kasper CK, Ruggeri ZM. Identification of a cleavage site directing the immunochemical detection of molecular abnormalities in type IIA von Willebrand factor. Proc Natl Acad Sci U.S.A. 1990;87:6306-10.

(14.) Manea M, Kristoffersson A, Tsai HM, Zhou W, Winqvist I, Oldaeus G, Billstrom R, Bjork P, Holmberg L, Karpman D. ADAMTS13 phenotype in plasma from normal individuals and patients with thrombotic thrombocytopenic purpura. Eur J Pediatr 2007;166:249-57.

(15.) Veyradier A, Obert B, Haddad E, Cloarec S, Nivet H, Foulard M, Lesure F, Delattre P, Lakhdari M, Meyer D, Girma JP, Loirat C. Severe deficiency of the specific von Willebrand factor-cleaving protease (ADAMTS 13) activity in a subgroup of children with atypical hemolytic uremic syndrome. J Pediatr 2003;142:310-7.

(16.) Scully M, Cohen H, Cavenagh J, Benjamin S, Starke R, Killick S, Mackie I, Machin SJ. Remission in acute refractory and relapsing thrombotic thrombocytopenic purpura following rituximab is associated with a reduction in IgG antibodies to ADAMTS-13. Br J Haematol 2007;136:451-61.

(17.) Plaimauer B, Zimmermann K, Volkel D, Antoine G, Kerschbaumer R, Jenab P, Furlan M, Gerritsen H, Lammle B, Schwarz HP, Scheiflinger F. Cloning, expression, and functional characterization of the von Willebrand factor-cleaving protease (ADAMTS13). Blood 2002;100:3626-32.

(18.) Pimanda JE, Maekawa A, Wind T, Paxton J, Chesterman CN, Hogg PJ. Congenital thrombotic thrombocytopenic purpura in association with a mutation in the second CUB domain of ADAMTS13. Blood 2004;103:627-9.

(19.) Veyradier A, Lavergne JM, Ribba AS, Obert B, Loirat C, Meyer D, Girma JP. Ten candidate ADAMTS13 mutations in six French families with congenital thrombotic thrombocytopenic purpura (Upshaw Schulman syndrome). J Thromb Haemost 2004;2:424-9.

(20.) Tao Z, Anthony K, Peng Y, Choi H, Nolasco L, Rice L, Moake JL, Dong JF. Novel ADAMTS-13 mutations in an adult with delayed onset thrombotic thrombocytopenic purpura. J Thromb Haemost 2006;4:1931-35.

(21.) Pengo V, Tripodi A, Reber G, Rand JH, Ortel TL, Galli M, De Groot PG. Update of the guidelines for lupus anticoagulant detection. Subcommittee on Lupus Anticoagulant/Antiphospholipid Antibody of the Scientific and Standardisation Committee of the International Society on Thrombosis and Haemostasis. J Thromb Haemost 2009;7:1737-40.

(22.) Harris EN. Antiphospholipid antibodies. Br J Haematol 1990;74:1-9.

(23.) Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29:e45.

(24.) Amoura Z, Costedoat-Chalumeau N, Veyradier A, Wolf M, Ghillani-Dalbin P, Cacoub P, Meyer D, Piette JC. Thrombotic thrombocytopenic purpura with severe ADAMTS-13 deficiency in two patients with primary antiphospholipid syndrome. Arthritis Rheum 2004;50:3260-4.

(25.) Austin SK, Starke RD, Lawrie AS, Cohen H, Machin SJ, Mackie IJ The VWF/ADAMTS13 axis in the antiphospholipid syndrome: ADAMTS13 antibodies and ADAMTS13 dysfunction. Br J Haematol 2008;141:536-44.

(26.) Rieger M, Mannucci PM, Kremer Hovinga JA, Herzog A, Gerstenbauer G, Konetschny C, Zimmermann K, Scharrer I, Peyvandi F, Galbusera M, Remuzzi G, Bohm M, Plaimauer B, Lammle B, Scheiflinger F. ADAMTS13 autoantibodies in patients with thrombotic microangiopathies and other immunomediated diseases. Blood 2005;106:1262-7.

Veysel Sabri Hancer (1), Reyhan Diz Kfictikkaya (2), Aysegiul Topal-Sankaya (3)

(1) Department of Medical Biology and Genetics, Faculty of Medicine, Istanbul Bilim University, Istanbul, Turkey

(2) Department of Internal Medicine, Division of Hematology, Faculty of Medicine, Istanbul Bilim University, Istanbul, Turkey

(3) Department of Molecular Biology and Genetics, Faculty of Science, Istanbul University, Istanbul, Turkey

Address for Correspondence: Asst. Prof. Veysel Sabri Hancer, Department of Medical Biology and Genetics, Faculty of Medicine, Istanbul Bilim University, Esentepe, Istanbul, Turkey Phone: +90 533 634 30 14 E-mail: vshancer@istanbul.edu.tr

doi:10.5152/tjh.2011.56
Table 1. Characteristics of the APS patients and healthy controls

                          APS patients  aPLA (+) patients    Controls
                       with thrombosis            without
                                               thrombosis

                                N = 37             N = 33    N = 70

Female/male ratio                23/14               28/5     51/19

Age (years)

Median [+ or -] SD     37 [+ or -] 2.2    37 [+ or -] 2.3  39 [+ or
                                                             -] 4.2

Range                            18-54              22-56     18-53

Thrombosis, n (%)

Arterial                    14 (37.84)                  0         0

Venous                      19 (51.35)                  0         0

Arterial and venous          4 (10.81)                  0         0

Thrombocytopenia             6 (16.22)         14 (42.42)         0

Fetal losses, n (%)         11 (29.73)          7 (21.21)         0

Thrombocytopenia and                 0         12 (36.36)         0
fetal mortality n (%)

Presence of
anticardiolipin
antibodies (% of the
involved group)

lgG                               39.3                 60  negative

lgM                               47.8               46.6  negative

Lupus anticoagulant                 80               86.6  negative

Mean Ct (mRNA leve1)              0.36               0.38      0.77

ADAMTS-13 antigen (%)            66.63              63.39      98.2

ADAMTS-13 activity               88.39              92.91     92.72
(%)

APS: Antiphospholipid syndrome; aPLA: antiphospholipid antibodiesi
lgM: Immunoglobulin M; lgG: immunoglobulin G; mRNA: messenger
ribonucleic acid; ADAMTS-13: A disintegrin and metalloproteinase
with a thrombospondin type l motif, member 13; Ct: cycle threshold


Table 2. Primer sequences, probes, and restriction enzymes

Exon       Primer sequence                   PCR product    Enzyme
number,                                             (bp)
Primer
name

10 + 11,   5'GGGATCCCTATGGGTGAGTT3'                   561   Alw21I
C365de1 1

10 + 11,   5'CCTGGTGTGAACCACAGATG 3'                  561   Alw21I
C365de1 2

12,        5'GTGCCATGTAGTCTCCCAGTGACAACACC3'          327    FspBI
Q449stop
1

12,        5'CCAGAGCCTGAACACTTTGCCCAGTGC3'            327    FspBI
Q449stop
2

12, P475S  5'GTGCCATGTAGTCTCCCAGTGACAACACC3'          327  Ecol3OI
1

12, P475S  5'CCAGAGCCTGAACCACTTTGCCCAGTGC3'           327  Ecol3OI
2

13 + 14,   5'CCCAGATGCAAAGGATGAAG3'                   839        -
C508Y 1

13+14,     5'ATCAGGflCT1ACTCAGTGT3'                   839        -
C508Y 2

A-13       5'AGTACAGAGTGGCCCTCACC3'                   106
Forward

A-13       5'CCATACCGCCTGTAAACCTG3'                   106
Reverse

Probe      FAM-UPL Probe #25 (Roche)-dark
           quencher

HPRT1      5'TGACCTTGATTTATTTTGCATACC3'               102
Forward

HPRT1      5'1CGAGCAAGACGTTCAGTCT3'                   102
Reverse

Probe      FAM-UPL Probe # 73(Roche)-dark
           quencher
Gale Copyright: Copyright 2011 Gale, Cengage Learning. All rights reserved.